CN109402244B - Sex identification method for mammalian embryo - Google Patents

Abstract

The invention relates to the technical field of sex identification, in particular to a sex identification method of a mammal embryo, which accurately identifies the sex of the mammal embryo by inserting a fluorescent reporter gene on a Y chromosome and by the fluorescent expression of the fluorescent reporter gene, and is simple, efficient, accurate and small in damage; in the process of constructing a male mammal model of Y chromosome containing fluorescent reporter genes, a spacer region positioned between Ddx3Y and Uty genes is selected as a targeting region to integrate exogenous genes, so that the influence of the selection of gene targeting sites on the transgenic animal is reduced; cas9 protein and single guide sgRNA designed according to a gene sequence of a targeting region are adopted in the gene editing process, the DNA of a target site can be accurately cut, and a fluorescent reporter gene is directionally inserted between Ddx3Y and Uty genes of a Y chromosome, so that a gene knock-in method is efficient and simple.

Description

Sex identification method for mammalian embryo

[ technical field ] A method for producing a semiconductor device

The invention relates to the technical field of sex identification, in particular to a sex identification method for a mammalian embryo.

[ background of the invention ]

Sex control is a biological technique for adult female animals to produce offspring of a desired sex by human intervention in the normal reproductive process of the animal. The technology has important significance in the aspects of improving the production benefit of the restricted character in the livestock production, avoiding the occurrence of the sex-linked hereditary diseases, accelerating the breeding process and the like. The discovery of sex-determining sequences on the Y chromosome is an important breakthrough of the sex determination theory of mammals and has great significance to the development of sex control technology. Current methods of sex control focus primarily on two aspects, one at the sperm level and the other at the embryo level.

Isolating X, Y sperm and sexing early embryos is currently the most effective two methods for controlling the sex ratio of offspring. X, Y the difference in DNA content of sperm heads has made it possible to isolate X, Y sperm by flow cytometry, X, Y sperm were sorted by flow cytometry and then fertilized with collected X or Y sperm and ovum as needed, and studies on sex control using this method have been successful in a variety of animals such as rabbits, pigs, cattle, sheep, buffalo, and the like. However, the main problem still exists at present that the separation cost is high, and the wide application in agricultural production is difficult. Other methods of separating X, Y sperm cells, including electrophoresis, density gradient centrifugation, and immunology, have not yielded satisfactory results and have been shown to be poorly reproducible and impractical for use in manufacturing.

At present, the most effective methods for sex determination of the embryo before implantation in mammals are mainly embryo karyotype analysis and PCR method, but both methods require partial cell removal from the embryo, thus causing some damage to the subsequent development of the embryo. In addition, the embryo karyotype analysis operation procedure is complex and has a long period, and the popularization and application of the method are also limited. The PCR method has high sensitivity, but is easy to pollute and generate false positive, and has certain limitation in application and popularization. Although sex control techniques have achieved some success and development, limitations of these current approaches limit their popularization and use in animal husbandry. Therefore, developing a simpler and more efficient method for sex control is of great importance for the development of agricultural production.

[ summary of the invention ]

In view of the foregoing, there is a need for a simpler and more efficient method for sex control that can accurately sexe mammalian embryos while reducing the incidence of false positives of PCR, and achieving 100% accuracy in embryo identification.

In order to achieve the purpose, the technical scheme adopted by the invention is as follows:

a method of sex determination of a mammalian embryo, the method comprising: constructing a male mammal model of Y chromosome containing a fluorescent reporter gene; after mating male and female mammals, the sex of the embryo of the animal is identified as male or female by observing the expression of the fluorescent gene in the embryo.

Further, the construction method of the male mammal model comprises the following steps: selecting a targeting region between two adjacent genes of a Y chromosome, determining a targeting sequence, and constructing a donor vector containing a fluorescent reporter gene according to the targeting sequence; the Y chromosome genome is then spliced under the coaction of the sgRNA and Cas9 mRNA, and the fluorescent reporter gene is then site-specifically inserted into the Y chromosome by virtue of its repair function by homologous recombination in the presence of the DNA repair template.

Further, the targeting region is located between Ddx3y gene and Uty gene.

Further, the targeting sequence is 5'-AGACTAGAGAGGCTCAATTCTGG-3'.

Further, the sequence of the denor vector containing the fluorescent reporter gene is SEQ ID NO: 2.

further, the in vitro transcription template of the sgRNA is obtained in a manner that: taking a plasmid px330 as a template, synthesizing a primer sequence, amplifying double-stranded DNA by adopting PCR, and providing the template for in vitro transcription of sgRNA, wherein an upstream primer sequence of the primer sequence is as follows: sgRNA-IVT-F:

5’-TAATACGACTCACTATAGGGAGACTAGAGAGGCTCAATTCGTTTTAGAGCTAGAAATAG-3’；

the sequence of the downstream primer is as follows: sgRNA-IVT-R: 5'-AAAAGCACCGACTCGGTGCC-3' are provided.

Wherein, the PCR reaction system for in vitro transcription template amplification of the sgRNA is as follows:

water was added to the total volume of 50. mu.L.

The PCR reaction program is: pre-denaturation at 95 ℃ for 3 min; denaturation at 95 ℃ for 30s, annealing at 60 ℃ for 20s, extension at 72 ℃ for 30s, and 35 cycles; followed by a final extension at 72 ℃ for 5 min. After completion of PCR, the PCR product was purified using the Tiangen Universal DNA purification recovery kit (cat # DP 214). .

Further, the in vitro transcription template of Cas9 mRNA is obtained by: taking a plasmid px260 as a template, synthesizing a primer sequence, amplifying double-stranded DNA by adopting PCR, and providing the template for in vitro transcription of Cas9, wherein the upstream primer sequence of the primer sequence is as follows:

CAS9 IVT F：5’-TAATACGACTCACTATAGGGAGATTTCAGGTTGGACCGGTG-3’：

the sequence of the downstream primer is as follows: CAS9 IVT R: 5'-GACGTCAGCGTTCGAATTGC-3' are provided.

Wherein, the PCR reaction system of the in vitro transcription template of the Cas9 mRNA is as follows:

water was added to the total volume of 50. mu.L.

The PCR reaction program is: pre-denaturation at 95 ℃ for 3 min; denaturation at 95 ℃ for 20s, annealing at 60 ℃ for 20s, extension at 72 ℃ for 30s, and 35 cycles; followed by extension at 72 ℃ for 5 min. The PCR product was purified in the same way as the sgRNA. After completion of PCR, the PCR product was purified using the Tiangen Universal DNA purification recovery kit (cat # DP 214). .

Further, the mammal described herein is a mouse.

The invention has the following beneficial effects:

1. the invention inserts the fluorescence reporter gene on the Y chromosome, and accurately identifies the embryo sex of the mammal through the fluorescence expression of the fluorescence reporter gene, and the method is simple, efficient, accurate and has small damage; in the process of constructing a male mammal model of Y chromosome containing fluorescent reporter genes, a spacer region positioned between Ddx3Y and Uty genes is selected as a targeting region to integrate exogenous genes, so that the influence of the selection of gene targeting sites on the transgenic animal is reduced; cas9 protein and single guide sgRNA designed according to a gene sequence of a targeting region are adopted in the process of gene editing, the DNA of a target site can be accurately cut, and a double-strand break notch (DSB) is formed; meanwhile, a constructed donor plasmid containing a fluorescent reporter gene is introduced into the position, and the fluorescent reporter gene is directionally inserted between Ddx3Y and Uty genes of the Y chromosome by utilizing the characteristic that cells can be repaired through a Homologous Recombination (HR) way, so that a gene knock-in method is efficient and simple.

[ description of the drawings ]

FIG. 1 is a diagram showing a site-specific integration pattern of the EGFP gene in the example of the present invention.

FIG. 2 is a diagram of a Y-EGFP transgenic mouse according to an embodiment of the present invention;

wherein, female mice are on the right; male mice on the left;

FIG. 3 is a diagram of the identification of integration sites at the 5 'and 3' ends of transgenic mice;

wherein M is DL2000plus, and the bands are 2000bp, 1500bp, 1000bp, 750bp, 500bp, 250bp and 100bp from top to bottom.

FIG. 4 is a off-target site sequencing plot;

FIG. 5 is a fluorescent image of early embryos obtained after mating Y-GFP mice with wild females;

FIG. 6 is a diagram of PCR-based sex determination of green fluorescent embryos and non-green fluorescent embryos.

Wherein DL1000 is Marker, and the bands are 1000bp, 700bp, 500bp, 400bp, 300bp, 200bp and 100bp from top to bottom.

[ detailed description ] embodiments

In order to make the aforementioned objects, features and advantages of the present invention comprehensible, embodiments accompanied with figures are described in detail below. In the following description, numerous specific details are set forth in order to provide a thorough understanding of the present invention. This invention may, however, be embodied in many different forms and should not be construed as limited to the embodiments set forth herein, but rather should be construed as broadly as the present invention is capable of modification in various respects, all without departing from the spirit and scope of the present invention.

1. Selection of gene targeting sites:

selecting a spacer sequence between Ddx3y and Uty genes as a targeting region for integration of the foreign gene; finding the target sequence in the targeting region: 5'-AGACTAGAGAGGCTCAATTCTGG-3' (SEQ ID NO: 1), and then aligned in the database to avoid off-target.

2. Construction of template plasmid (donor plasmid)

And (2) determining the target site as a cutting site, amplifying the DNA sequence containing EGFP by respectively amplifying homologous arm sequences at two ends of the cutting site through PCR (polymerase chain reaction) by using the plasmid containing EGFP as a template, connecting the amplified DNA sequence with the homologous arm sequences at two ends after enzyme digestion, and subcloning the amplified DNA sequence into a donor plasmid, wherein the plasmid sequence is SEQ ID NO: 2.

3. in vitro transcription and purification of Cas9 mRNA and sgRNA

(1) In vitro transcription and purification of sgRNA:

(ii) synthesizing a primer sequence (SEQ ID NO: 3-4):

sgRNA-IVT-F：

5’-TAATACGACTCACTATAGGGAGACTAGAGAGGCTCAATTCGTTTTAGAGCTAGAAATAG-3’：

sgRNA-IVT-R：

5’-AAAAGCACCGACTCGGTGCC-3’。

secondly, using plasmid px330(Addgene catalog nO.42230) as a template, adding a T7 promoter on a primer sequence to amplify double-stranded DNA so as to provide the template for in vitro transcription of sgRNA, and specifically:

the PCR reaction system is as follows: the template px330 plasmid was added with 50ng of sgRNA-IVT-F, 20. mu.M of sgRNA-IVT-R primers, 1. mu.L each, 5. mu.L of 2mM dNTPs, 5. mu.L of 10xPCR buffer, 3. mu.L of 25mM MgSO4, 1. mu.L of KOD-Plus-Neo (1 IU/. mu.L) by TOYOBO, and water was added to a total volume of 50. mu.L.

The PCR reaction program is as follows: pre-denaturation at 95 ℃ for 3 min; denaturation at 95 ℃ for 30s, annealing at 60 ℃ for 20s, extension at 72 ℃ for 30s, and 35 cycles; followed by a final extension at 72 ℃ for 5 min. After completion of PCR, the PCR product was purified using the Tiangen Universal DNA purification recovery kit (cat # DP 214).

In vitro transcription: in vitro transcription of sgRNA MeGA shortscript from Ambion was used^TMKit (cat # AM1354) and the procedure was as follows: 1. first, the reaction solution was disposed according to the following composition:

2. after all fractions were centrifuged instantaneously, incubated at 37 ℃ for 5h.

3. mu.L of TUBBO DNase was added, incubated for 15min, and the template DNA was digested.

Purification of RNA: in vitro transcribed RNA was purified using the MEGA clear Kit from Ambion (cat # AM 1908). The procedure was as follows: 1. the RNA was added to 100ul of Elution Solution and mixed well. 2. 350ul of Binding Solution was added and mixed well. 3. Add 250ul of 100% ethanol and mix well. 4. And adding the well-mixed RNA-containing mixed solution into an adsorption column, and centrifuging at 12000r for 2 min. 5. 500ul of Wash Solution was added and centrifuged at 12000r for 2 min. 6. Repeating the previous step. 7. Centrifuge for 2min using preheated 60ul of Elution Solution, 12000 r. 8. Detecting the concentration, and then subpackaging and storing at-80 ℃. .

(2) In vitro transcription and purification of Cas9 mRNA:

(ii) synthesizing a primer sequence (SEQ ID NO: 5-6):

CAS9 IVT F：5’-TAATACGACTCACTATAGGGAGATTTCAGGTTGGACCGGTG-3’：

CAS9 IVT R：5’-GACGTCAGCGTTCGAATTGC-3’。

secondly, using plasmid px260(Addgene catalog No.42229) as a template, adding a T7 promoter on a primer sequence to amplify double-stranded DNA so as to provide the template for in vitro transcription of Cas9, and specifically:

the PCR reaction system is as follows: template px260 plasmid was added with 50ng, Cas9 IVT F, Cas9 IVT R primer 20. mu. mol each 1. mu.L, 2mmol dNTPs 5. mu.L, 10xPCR buffer 5. mu.L, 25mM MgSO4 3. mu.L, TOYOBO KOD-Plus-Neo (1 IU/. mu.L) 1. mu.L, supplemented with water to a total volume of 50. mu.L. The PCR reaction program is: pre-denaturation at 95 ℃ for 3 min; denaturation at 95 ℃ for 20s, annealing and extension at 68 ℃ for 5min, and 35 cycles; followed by extension at 72 ℃ for 15 min. After completion of PCR, the PCR product was purified using the Tiangen Universal DNA purification recovery kit (cat # DP 214).

In vitro transcription of Cas9 was performed using Ambion's mMESSAGE mMachine T7 Ultra Kit (cat # AM1345), and the reaction was prepared as shown in the following list:

all fractions were mixed well and, after transient centrifugation, incubated at 37 ℃ for 5h. 3. mu.L of TUBBO DNase was added, incubated for 15min, and the template DNA was digested. The following components were then added to tail Cas 9:

after mixing, 4. mu. L E-PAP enzyme was added and mixed well. Incubate at 37 ℃ for 30 min. Purification method of Cas9 mRNA reference is made to the purification method of sgRNA.

4. Microinjection

4-week-old female C57/BL mice were injected with 10IU of pregnant mare serum gonadotropin, 48h later with 5IU of human chorionic gonadotropin, and then were caged with wild-type male C57/BL mice, and fertilized eggs were obtained for about 24 h. Transferring the fertilized eggs into a micromanipulation drop containing 5 mu g/mL cytochalasin B, uniformly mixing Cas9 mRNA and sgRNA which are transcribed and purified in vitro and a donor plasmid according to the proportion of 100ng/50ng/100ng, performing intracytoplasmic injection under a micromanipulation system, washing the injected fertilized eggs in a KSOM culture solution, transferring the fertilized eggs into the balanced KSOM culture solution, and continuously culturing for 3.5 days until the blastocyst stage.

5. Embryo transfer to obtain transgenic animals:

the blastocyst cultured in vitro for 3.5 days is transplanted into the uterine horn of a female mouse pseudopregnant for 2.5 days, and a fountain mouse is obtained after 20 days of pregnancy. Among fountain mice, mice showing green color under the irradiation of ultraviolet light (see fig. 2) were cut off at their mouse tips, and the genomes were extracted using a reagent kit for extracting the genomes of blood, tissues and cells from the roots, and then primers were designed to amplify whether both ends of the integration site of the foreign gene were consistent with the expectations. The specific operation is as follows:

(1) design of 5 'end integration site (5' junction) primer: the upstream primer is located in the genome of the mouse, the downstream primer is located on a CAG promoter, the expected amplified fragment is 1172bp, and the primer sequences are designed as follows (SEQ ID NO: 7-8):

the sequence of the upstream primer is as follows: 5'-ACCGTAAATACTCCACCC-3'

The sequence of the downstream primer is as follows: 5'-GTCTGAAGACAGCTACAG-3'

(2) Design of 3 'end integration site (3' junction) primer: the upstream primer is located on the PolyA sequence integrating the exogenous gene, the downstream primer is located in the genome of the mouse, the expected amplified fragment is 1016bp, and the primer sequences are designed as follows (SEQ ID NO: 9-10):

the sequence of the upstream primer is as follows: 5'-CTGCTGCCCGACAACCACT-3'

The sequence of the downstream primer is as follows: 5'-ACCAGAAGAGGGCATCAGAT-3'

The PCR reaction program is: at 95 ℃ for 3 min; 35 cycles of 95 ℃, 30s, 60 ℃, 30s, 72 ℃, 30 s; followed by extension at 72 ℃ for 5 min. After the PCR was completed, agarose gel electrophoresis analysis, and comparison with the wild type, an amplified band of the expected size appeared, indicating that the transgenic mice with Y-GFP were successfully obtained, and the integration site was consistent with the expected (see FIG. 3).

6. Detection of the off-target effect of the transgenic animals:

according to online software (http：//www.rgenome.net/cas-offinder/)Inputting a targeting sequence to predict potential off-target sites, and screening out all off-target sites with mismatching less than three bases. Specifically, as shown in table 1:

TABLE 1

Name (R)	Genetic loci	Base sequence	PAM	Number of mismatched bases
						Target site	AGACTAGAGAGGCTCAATTC	TGG
Off-target 1	Chr12：95987118	AGACTAGAGATGGTCAATAC	TGG	3
					Off-target 2	Chr5：127912042	AGACTAGAAAGGGTGAATTC	AGG	3
Off-target 3	Chr16：60659541	GGACAAGAGAGCCTCAATTC	AGG	3
					Off-target 4	Chr13：98724976	AAACTAGAGAGGCACATTTC	TGG	3
Off-target 5	Chr2：152363135	AGAATAGAGAGGTTCATTTC	TGG	3
					Off-target 6	Chr17：15633564	AGACTAGAGAGCCTCAAATT	CGG	3
Off-target 7	Chr10：126361375	AGACTTAAGAGGCTCAAGTC	AGG	3
					Off-target 8	Chr6：82088605	AGGCAAGAGAGGCTCAAATC	AGG	3
Off-target 9	Chr6：87272542	AGACTGGAGAGGCTCAAGGC	AGG	3

As can be seen from the above table, the total of 9 mismatching off-target sites is predicted, related primers are designed according to the above 9 loci to amplify sequences of about 250bp respectively at the upstream and downstream of the off-target site, and the off-target effect is detected, wherein the sequences of the primers are designed as shown in Table 2(SEQ ID NO: 11-28):

TABLE 2

The PCR reaction program for detecting the off-target effect comprises the following steps: pre-denaturation at 95 ℃ for 3 min; denaturation at 95 ℃ for 30s, annealing at 60 ℃ for 30s, extension at 72 ℃ for 30s, and 35 cycles; followed by a final extension at 72 ℃ for 5 min. And (3) after the PCR is finished, performing electrophoresis gel cutting, connecting the purified and recovered PCR product to an 18T vector, performing sanger sequencing, and comparing a sequencing result with an original sequence to find no off-target effect (figure 3).

7. Sex determination of early embryos:

mating the Y-GFP transgenic male mouse which is not detected to miss the target with the superovulation treated wild type female mouse, taking the fertilized egg from the ampulla of the oviduct for in vitro culture, observing early blastula in a fluorescence microscope after 3.5 days to find that about half of embryos can observe obvious green fluorescence, and the other half of embryos are normal (figure 4). In order to verify whether the green fluorescence positive embryos are all male embryos and the embryos without green fluorescence expression are all female embryos, green fluorescence and non-green fluorescence embryos are respectively selected under a microscope, single blastula are respectively placed into a PCR tube added with 2 mu L of lysate by a drawn glass pipette, a lysis procedure is firstly carried out, and then nested PCR is carried out to identify the sex of the embryos.

The formula of the lysis solution is as follows: 0.1% Tween 20, 0.1% Triton X-100, 4. mu.g/mL proteinase K.

Nested PCR primers for the Tyr Gene (Gene ID: 22173) and the kdm5d Gene (Gene ID: 20592) were designed, respectively, and the primer sequences are shown in Table 3 (SEQ ID NOS: 29-36):

TABLE 3

The Tyr gene is located on the autosome as a positive control, and the kdm5d gene is located on the Y chromosome and serves as a male embryo-specific primer. The PCR product electrophoresis shows that the selected 21 blastocysts all have positive bands of Tyr gene at 788bp, and 11 embryos with green fluorescent protein expression all have positive bands of kdm5d gene at 457bp, which also indicates that the embryos with fluorescent expression are all male and the embryos without fluorescent expression are all female (FIG. 5).

To further verify the accuracy of the method, all embryos with and without green fluorescence expression were separated under fluorescence microscopy, transplanted into the uterus of a female rat pseudopregnant for 2.5 days, and delivered for about 19 days. As a result, it was found that all green fluorescence-expressing embryos developed into male offspring, and all embryos without green fluorescence expression developed into female offspring. The result also further verifies that the accuracy of the embryo sex determination by applying the method can reach 100%.

In conclusion, the method can be used for simply, efficiently, accurately and nondestructively identifying the sex of the mammal.

The above examples are merely illustrative of several embodiments of the present invention, and the description thereof is more specific and detailed, but not to be construed as limiting the scope of the invention. It should be noted that, for a person skilled in the art, several variations and modifications can be made without departing from the inventive concept, which falls within the scope of the present invention. Therefore, the protection scope of the present invention should be subject to the appended claims.

Sequence listing

<110> Guangxi university

<120> method for identifying embryo sex of mammal

<160> 36

<170> SIPOSequenceListing 1.0

<210> 1

<211> 23

<212> DNA

<213> Artificial sequence (ren gong xu lie)

<400> 1

agactagaga ggctcaattc tgg 23

<210> 2

<211> 4336

<212> DNA

<213> Artificial sequence (ren gong xu lie)

<400> 2

gtctgaagac agctacagta tacttacata taattaatta atattttaaa agtttgcata 60

cacaacatac atgatctttt atgcattttg atacaaagta ctgaagaaaa attattatcc 120

aattctttag tttttgtaaa caaaacacat tgctggtgat cacatccagc aatgtttttt 180

taattatcat tttgttttgt ttaagatatg gtttcactgt agcttttgct gactaaaagt 240

tgcagtgtag ttctgcctaa cttgaactca gaatgatcca attgtctctg cctcaggtgc 300

taagattaaa ttaaaaggcc cagtactacc ccagggccag tactaccacc atttctgtag 360

tttacctata ctcactgtcc tgtattctgt ctctagattt tctttaactt tatttattgg 420

gggaagtttt ctacagtttg tgccctaatg atcaacctca aaagcctcac actgttaaca 480

agtaccttta cctacgaaag ctaactcatc aacccacatt ttagtgttct acatagcctt 540

gctgtggaac atggagtgtt ttaggactct atagaagagg ctggttgcat gtagctatca 600

tgctcctata ctctcagatt gcacatttgt gcatttacca cacttttttg agacagggtt 660

tctctgcata aatcctggct gtcctggaac tcaatctgtt taccaggctg gcctcgaact 720

cagaaatccg ccttcctctg cctcccaagt gctgggatta aaggtttccc cctcaagaac 780

atgagactag agaggctcaa gacattgatt attgactagt tattaatagt aatcaattac 840

ggggtcatta gttcatagcc catatatgga gttccgcgtt acataactta cggtaaatgg 900

cccgcctggc tgaccgccca acgacccccg cccattgacg tcaataatga cgtatgttcc 960

catagtaacg ccaataggga ctttccattg acgtcaatgg gtggagtatt tacggtaaac 1020

tgcccacttg gcagtacatc aagtgtatca tatgccaagt acgcccccta ttgacgtcaa 1080

tgacggtaaa tggcccgcct ggcattatgc ccagtacatg accttatggg actttcctac 1140

ttggcagtac atctacgtat tagtcatcgc tattaccatg gtcgaggtga gccccacgtt 1200

ctgcttcact ctccccatct cccccccctc cccaccccca attttgtatt tatttatttt 1260

ttaattattt tgtgcagcga tgggggcggg gggggggggg gggcgcgcgc caggcggggc 1320

ggggcggggc gaggggcggg gcggggcgag gcggagaggt gcggcggcag ccaatcagag 1380

cggcgcgctc cgaaagtttc cttttatggc gaggcggcgg cggcggcggc cctataaaaa 1440

gcgaagcgcg cggcgggcgg gagtcgctgc gttgccttcg ccccgtgccc cgctccgcgc 1500

cgcctcgcgc cgcccgcccc ggctctgact gaccgcgtta ctcccacagg tgagcgggcg 1560

ggacggccct tctcctccgg gctgtaatta gcgcttggtt taatgacggc tcgtttcttt 1620

tctgtggctg cgtgaaagcc ttaaagggct ccgggagggc cctttgtgcg ggggggagcg 1680

gctcgggggg tgcgtgcgtg tgtgtgtgcg tggggagcgc cgcgtgcggc ccgcgctgcc 1740

cggcggctgt gagcgctgcg ggcgcggcgc ggggctttgt gcgctccgcg tgtgcgcgag 1800

gggagcgcgg ccgggggcgg tgccccgcgg tgcggggggg ctgcgagggg aacaaaggct 1860

gcgtgcgggg tgtgtgcgtg ggggggtgag cagggggtgt gggcgcggcg gtcgggctgt 1920

aacccccccc tgcacccccc tccccgagtt gctgagcacg gcccggcttc gggtgcgggg 1980

ctccgtgcgg ggcgtggcgc ggggctcgcc gtgccgggcg gggggtggcg gcaggtgggg 2040

gtgccgggcg gggcggggcc gcctcgggcc ggggagggct cgggggaggg gcgcggcggc 2100

cccggagcgc cggcggctgt cgaggcgcgg cgagccgcag ccattgcctt ttatggtaat 2160

cgtgcgagag ggcgcaggga cttcctttgt cccaaatctg gcggagccga aatctgggag 2220

gcgccgccgc accccctcta gcgggcgcgg gcgaagcggt gcggcgccgg caggaaggaa 2280

atgggcgggg agggccttcg tgcgtcgccg cgccgccgtc cccttctcca tctccagcct 2340

cggggctgcc gcagggggac ggctgccttc gggggggacg gggcagggcg gggttcggct 2400

tctggcgtgt gaccggcggc tctagagcct ctgctaacca tgttcatgcc ttcttctttt 2460

tcctacagat ccttaattaa gcgacgcgtg cgggatccgc tcaattggct gctagcgctg 2520

tcgacgccac taacttctcc ctgttgaaac aagcagggga tgtcgaagag aatcccgggc 2580

caatggtgag caagggcgag gagctgttca ccggggtggt gcccatcctg gtcgagctgg 2640

acggcgacgt aaacggccac aagttcagcg tgtccggcga gggcgagggc gatgccacct 2700

acggcaagct gaccctgaag ttcatctgca ccaccggcaa gctgcccgtg ccctggccca 2760

ccctcgtgac caccctgacc tacggcgtgc agtgcttcag ccgctacccc gaccacatga 2820

agcagcacga cttcttcaag tccgccatgc ccgaaggcta cgtccaggag cgcaccatct 2880

tcttcaagga cgacggcaac tacaagaccc gcgccgaggt gaagttcgag ggcgacaccc 2940

tggtgaaccg catcgagctg aagggcatcg acttcaagga ggacggcaac atcctggggc 3000

acaagctgga gtacaactac aacagccaca acgtctatat catggccgac aagcagaaga 3060

acggcatcaa ggtgaacttc aagatccgcc acaacatcga ggacggcagc gtgcagctcg 3120

ccgaccacta ccagcagaac acccccatcg gcgacggccc cgtgctgctg cccgacaacc 3180

actacctgag cacccagtcc gccctgagca aagaccccaa cgagaagcgc gatcacatgg 3240

tcctgctgga gttcgtgacc gccgccggga tcactctcgg catggacgag ctgtacaagt 3300

aaaccggtta ggggcccgtt taaacccgct gatcagcctc gactgtgcct tctagttgcc 3360

agccatctgt tgtttgcccc tcccccgtgc cttccttgac cctggaaggt gccactccca 3420

ctgtcctttc ctaataaaat gaggaaattg catcgcattg tctgagtagg tgtcattcta 3480

ttctgggggg tggggtgggg caggacagca agggggagga ttgggaagac aatagcttct 3540

ggtgttctgc taaagaaaca gcaatccagt tacttctaat atttttgttt ttatatccat 3600

agattagtgc atcattcagc tattatcaga gaattttctt acagtaaatg gaaactaaca 3660

attaatccac aacttaacaa taatgtgaga aattttggag cattcagacc taaaaggtat 3720

gtctttaccc aaagcttctc catgtgaaga agtggaaaga ttctaagaat cctaaagatt 3780

cagggggaat gaatgactcc agggaaatct aaacataaca atactgatgc acatatgaag 3840

tcagtgtgat agcatgtaca gaggttcaat cttcaagttc tgaccatgtg gtgagctcaa 3900

ggattagtgg gttttttgaa ttcagaattt tttttaaccc tgtgttcccc actttttttt 3960

tttttttttt ttttggtatt aatgaacaaa caagggttgg gaaaggagaa ggtgttatct 4020

ttaaactatt tcctgatgta tggaaggaca tgaagcaaac ttgatcttca ccatcaaaga 4080

ctaaacagga tgtaggcctc tgatctaata gttatctgct taaaaatctt ttgcatgcat 4140

tgttgaagaa atctaggcaa gaagtttgta agggagagtg tgaatggtag gattaagaaa 4200

gggagaagtt gggctggtga gatggctcag tgggtaagag cacccgactg ctcttccgaa 4260

ggtccgaagt tcaaatccca gcaaccacat ggtggctcac aaccacccgt aatgacatct 4320

gatgccctct tctggt 4336

<210> 3

<211> 59

<212> DNA

<213> Artificial sequence (ren gong xu lie)

<400> 3

taatacgact cactataggg agactagaga ggctcaattc gttttagagc tagaaatag 59

<210> 4

<211> 20

<212> DNA

<213> Artificial sequence (ren gong xu lie)

<400> 4

aaaagcaccg actcggtgcc 20

<210> 5

<211> 41

<212> DNA

<213> Artificial sequence (ren gong xu lie)

<400> 5

taatacgact cactataggg agatttcagg ttggaccggt g 41

<210> 6

<211> 20

<212> DNA

<213> Artificial sequence (ren gong xu lie)

<400> 6

gacgtcagcg ttcgaattgc 20

<210> 7

<211> 18

<212> DNA

<213> Artificial sequence (ren gong xu lie)

<400> 7

accgtaaata ctccaccc 18

<210> 8

<211> 18

<212> DNA

<213> Artificial sequence (ren gong xu lie)

<400> 8

gtctgaagac agctacag 18

<210> 9

<211> 19

<212> DNA

<213> Artificial sequence (ren gong xu lie)

<400> 9

ctgctgcccg acaaccact 19

<210> 10

<211> 20

<212> DNA

<213> Artificial sequence (ren gong xu lie)

<400> 10

accagaagag ggcatcagat 20

<210> 11

<211> 18

<212> DNA

<213> Artificial sequence (ren gong xu lie)

<400> 11

aagagtagcc gagcagtg 18

<210> 12

<211> 19

<212> DNA

<213> Artificial sequence (ren gong xu lie)

<400> 12

gactcaaata ataagtggg 19

<210> 13

<211> 19

<212> DNA

<213> Artificial sequence (ren gong xu lie)

<400> 13

ccaagacctt gtcgctgac 19

<210> 14

<211> 18

<212> DNA

<213> Artificial sequence (ren gong xu lie)

<400> 14

tgcccacctc cttcctat 18

<210> 15

<211> 19

<212> DNA

<213> Artificial sequence (ren gong xu lie)

<400> 15

ggggttgagt ttggctttc 19

<210> 16

<211> 18

<212> DNA

<213> Artificial sequence (ren gong xu lie)

<400> 16

tgggatatgg gagggttt 18

<210> 17

<211> 18

<212> DNA

<213> Artificial sequence (ren gong xu lie)

<400> 17

ggctacggta catcacta 18

<210> 18

<211> 18

<212> DNA

<213> Artificial sequence (ren gong xu lie)

<400> 18

tcagaccaga gtccaagt 18

<210> 19

<211> 18

<212> DNA

<213> Artificial sequence (ren gong xu lie)

<400> 19

ccctcttctg gagtgtct 18

<210> 20

<211> 18

<212> DNA

<213> Artificial sequence (ren gong xu lie)

<400> 20

tgaaccttgc tctgccta 18

<210> 21

<211> 18

<212> DNA

<213> Artificial sequence (ren gong xu lie)

<400> 21

ctggtcctaa caggtgct 18

<210> 22

<211> 19

<212> DNA

<213> Artificial sequence (ren gong xu lie)

<400> 22

ggagtaaagt tgcaggtga 19

<210> 23

<211> 18

<212> DNA

<213> Artificial sequence (ren gong xu lie)

<400> 23

accaccatca ccctcagt 18

<210> 24

<211> 18

<212> DNA

<213> Artificial sequence (ren gong xu lie)

<400> 24

taagagcccg agacaatc 18

<210> 25

<211> 18

<212> DNA

<213> Artificial sequence (ren gong xu lie)

<400> 25

gctttagaag aagggacg 18

<210> 26

<211> 20

<212> DNA

<213> Artificial sequence (ren gong xu lie)

<400> 26

aagagggaga cactgataga 20

<210> 27

<211> 18

<212> DNA

<213> Artificial sequence (ren gong xu lie)

<400> 27

agctggcaca gtgaagaa 18

<210> 28

<211> 20

<212> DNA

<213> Artificial sequence (ren gong xu lie)

<400> 28

gcttgtctgg gactatacct 20

<210> 29

<211> 21

<212> DNA

<213> Artificial sequence (ren gong xu lie)

<400> 29

gttatcctca cactacttct g 21

<210> 30

<211> 21

<212> DNA

<213> Artificial sequence (ren gong xu lie)

<400> 30

gtaatcctac caagagtctc a 21

<210> 31

<211> 20

<212> DNA

<213> Artificial sequence (ren gong xu lie)

<400> 31

tcctcacact acttctgatg 20

<210> 32

<211> 20

<212> DNA

<213> Artificial sequence (ren gong xu lie)

<400> 32

gtctcaagat ggaagatcac 20

<210> 33

<211> 18

<212> DNA

<213> Artificial sequence (ren gong xu lie)

<400> 33

gcaggctaca caggagta 18

<210> 34

<211> 19

<212> DNA

<213> Artificial sequence (ren gong xu lie)

<400> 34

agggacagta acaggcata 19

<210> 35

<211> 18

<212> DNA

<213> Artificial sequence (ren gong xu lie)

<400> 35

ttggtgagat ggctgact 18

<210> 36

<211> 20

<212> DNA

<213> Artificial sequence (ren gong xu lie)

<400> 36

ggacagtaac aggcatatga 20

Claims (3)

1. A method for sex determination of a mammalian embryo, the method comprising: constructing a male mammal model of Y chromosome containing a fluorescent reporter gene; after the male mammal and the female mammal are mated, the sex of the embryo of the animal is identified as male or female by observing the expression of the fluorescent gene in the embryo;

the construction method of the male mammal model comprises the following steps: selecting a targeting region between two adjacent genes of a Y chromosome, determining a targeting sequence, and constructing a donor vector containing a fluorescent reporter gene according to the targeting sequence; then under the combined action of sgRNA and Cas9 mRNA, the Y chromosome genome is cut, and then the fluorescent reporter gene is inserted into the Y chromosome at a fixed point through the repair function of homologous recombination under the condition that DNA exists a repair template;

the targeting region is located between Ddx3y gene and Uty gene;

the targeting sequence is 5'-AGACTAGAGAGGCTCAATTCTGG-3';

the sequence of the denor vector containing the fluorescent reporter gene is SEQ ID NO. 2;

the amplification mode of the sgRNA in vitro transcription template is as follows: synthesizing a primer sequence by taking a plasmid px330 as a template, adding a T7 promoter sequence on the primer sequence, amplifying double-stranded DNA through PCR, and providing the template for in vitro transcription of sgRNA, wherein the upstream primer sequence of the primer sequence is as follows: sgRNA-IVT-F:

5’-TAATACGACTCACTATAGGGAGACTAGAGAGGCTCAATTCGTTTTAGAGCTAGAAATAG-3’；

the sequence of the downstream primer is as follows: sgRNA-IVT-R: 5'-AAAAGCACCGACTCGGTGCC-3', respectively;

the amplification mode of the in vitro transcription template of the Cas9 mRNA is as follows: taking a plasmid px260 as a template, synthesizing a primer sequence, adding a T7 promoter sequence on the primer sequence, amplifying double-stranded DNA through PCR, and providing the template for in vitro transcription of Cas9, wherein the upstream primer sequence of the primer sequence is as follows:

CAS9 IVT F：5’-TAATACGACTCACTATAGGGAGATTTCAGGTTGGACCGGTG-3’；

the sequence of the downstream primer is as follows: CAS9 IVT R: 5'-GACGTCAGCGTTCGAATTGC-3' are provided.

2. The method for sexing mammalian embryos of claim 1, wherein the PCR reaction system is:

water was added to the total volume of 50. mu.L.

3. The method of claim 1, wherein the mammal is a mouse.

Images