WO2022253185A1

WO2022253185A1 - Cas12 protein, gene editing system containing cas12 protein, and application

Info

Publication number: WO2022253185A1
Application number: PCT/CN2022/096002
Authority: WO
Inventors: 王永明; 王帅; 高思琪; 王瑶
Original assignee: 复旦大学
Priority date: 2021-05-31
Filing date: 2022-05-30
Publication date: 2022-12-08
Also published as: CN113373130A; CN113373130B

Abstract

The present invention relates to the technical field of gene editing, and in particular to a CRISPR/Cas12 gene editing system and an application thereof. The gene editing system is a complex formed by a specific Cas12 protein and sgRNA, and can accurately locate a target DNA sequence and cause cutting, so that double-strand break damage occurs to the target sequence; gene editing refers to intracellular or in vitro gene editing. Specifically, specific Cas12J-8, a Cas12a protein, and a Cas12b protein are involved, the specific Cas12J-8 protein has a relatively small number of amino acids, the specific Cas12J-8 protein, the Cas12a protein, and the Cas12b protein all have high editing efficiency, and PAM sequences identified by the three types of proteins are simple, so that the present invention has a wide prospect for application in the field of gene editing.

Description

Cas12 protein, gene editing system and application containing Cas12 protein

technical field

This application belongs to the technical field of gene editing, and specifically relates to Cas12 protein, a gene editing system containing the Cas12 protein and related applications.

Background technique

The CRISPR/Cas system is an adaptive immune system evolved by bacteria and archaea to resist the invasion of foreign viruses or plasmids. In the CRISPR/Cas12a and CRISPR/Cas12j systems, crRNA (CRISPR-derived RNA) and Cas12 protein form a complex to recognize the PAM (Protospacer Adjacent Motif) sequence of the target site. After recognition, crRNA will form a complementary structure with the targeted DNA sequence, and the Cas protein will perform the function of cutting DNA, resulting in DNA breakage and damage. The CRISPR/Cas12b system also contains tracrRNA (trans-activating RNA), which forms a complex with crRNA and Cas12b to function. tracrRNA and crRNA can be fused into a single-stranded guide RNA (single guide RNA, sgRNA) through a linking sequence. When DNA is broken and damaged, two main DNA damage repair mechanisms in cells are responsible for repair: non-homologous end-joining (Non-homologous end-joining, NHEJ) and homologous recombination (homologous recombination, HR). The result of NHEJ repair will cause base deletion or insertion, and gene knockout can be performed; in the case of providing a homologous template, HR repair can be used for site-specific insertion of genes and precise base replacement.

In addition to basic scientific research, the CRISPR/Cas12 gene editing system also has broad clinical application prospects. When using the CRISPR/Cas12 gene editing system for gene therapy, it is necessary to introduce Cas and single-stranded guide RNA into the body. At present, the most effective expression vector for gene therapy is adeno-associated virus (AAV). However, the DNA packaged by AAV virus generally does not exceed 4.5 kb. SpCas9 has been widely used because of its simple PAM sequence (NGG recognition) and high activity. However, the SpCas9 protein has 1368 amino acids, plus sgRNA and promoter, which cannot be effectively packaged into AAV virus, which limits its clinical application. In order to overcome this problem, several Cas9s with small molecular weight were invented, including SaCas9 (PAM sequence is NNGRRT); St1Cas9 (PAM sequence is NNAGAW); NmCas9 (PAM sequence is NNNNGATT); Nme2Cas9 (PAM sequence is NNNNCC); The PAM sequence is NNNNRYAC). However, these Cas9s are either easy to off-target (that is, cut at non-target sites), or have complex PAM sequences, or have low editing activity, making it difficult to be widely used.

Therefore, finding a small CRISPR/Cas system with high editing activity, high specificity, and simple PAM sequence is the hope to solve the above problems.

Contents of the invention

In response to the above problems, the inventors have conducted repeated studies and found that a series of Cas12 proteins and corresponding single-stranded guide RNAs can constitute a CRISPA/Cas12 gene editing system for effective gene editing, thus completing this paper. invention.

Therefore, in a first aspect, the present invention provides a conjugate comprising:

a) Cas12 protein, the Cas12 protein is Cas12J-8 protein, Mb4Cas12a protein, MICas12a protein, MoCas12a protein, BgCas12a protein or ChCas12b protein respectively having the amino acid sequence shown in SEQ ID NO: 1 to SEQ ID NO: 6, or is Having at least 80% sequence identity with any one of the amino acid sequences shown in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5 and SEQ ID NO: 6 Homologues of amino acid sequences that retain their biological activity: and

b) Modification part.

In a second aspect, the present invention provides a fusion protein comprising:

a) Cas12 protein, the Cas12 protein is Cas12J-8 protein, Mb4Cas12a protein, MlCas12a protein, MoCas12a protein, BgCas12a protein or ChCas12b protein respectively having the amino acid sequence shown in SEQ ID NO: 1 to SEQ ID NO: 6, or is Having at least 80% sequence identity with any one of the amino acid sequences shown in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5 and SEQ ID NO: 6 homologues of amino acid sequences that retain their biological activity;

b) additional proteins or polypeptides; and

c) an optional linker for connecting the Cas12 protein or its homologue with the other protein or polypeptide.

In a third aspect, the present invention provides a single-stranded guide RNA comprising a CRISPR repeat sequence, the CRISPR repeat sequence having any one of SEQ ID NO: 15 to SEQ ID NO: 18. Nucleic acid sequence, or a nucleic acid sequence having at least 90% sequence identity with the nucleic acid sequence shown in any one of SEQ ID NO: 15 to SEQ ID NO: 18 and retaining its biological activity, or having a nucleic acid sequence based on SEQ ID NO: 15 A nucleic acid sequence obtained by modifying the nucleic acid sequence described in any one of SEQ ID NO: 18 and retaining its biological activity.

In a fourth aspect, the present invention provides an isolated nucleic acid molecule comprising a nucleic acid sequence encoding:

a) Cas12 protein, the Cas12 protein is Cas12J-8 protein, Mb4Cas12a protein, MlCas12a protein, MoCas12a protein, BgCas12a protein or ChCas12b protein respectively having the amino acid sequence shown in SEQ ID NO: 1 to SEQ ID NO: 6, or is Having at least 80% sequence identity with any one of the amino acid sequences shown in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5 and SEQ ID NO: 6 Homologues of amino acid sequences that retain their biological activity:

b) a conjugate of the first aspect of the invention; or

c) The fusion protein of the third aspect of the present invention.

In a fifth aspect, the present invention provides an isolated nucleic acid molecule comprising a nucleic acid sequence encoding the single-stranded guide RNA of the third aspect of the present invention.

In a sixth aspect, the present invention provides a vector comprising a nucleic acid sequence encoding the following:

b) a conjugate of the first aspect of the invention; or

The fusion protein of the second aspect of the present invention.

In the seventh aspect, the present invention provides a vector comprising a nucleic acid sequence encoding the single-stranded guide RNA of the third aspect of the present invention.

In the eighth aspect, the present invention provides a CRISPR/Cas12 gene editing system, which comprises:

a) protein component comprising:

1) Cas12 protein, the Cas12 protein is Cas12J-8 protein, Mb4Cas12a protein, MlCas12a protein, MoCas12a protein, BgCas12a protein or ChCas12b protein respectively having the amino acid sequence shown in SEQ ID NO: 1 to SEQ ID NO: 6, or is Having at least 80% sequence identity with any one of the amino acid sequences shown in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5 and SEQ ID NO: 6 homologues of amino acid sequences that retain their biological activity;

2) the conjugate of the first aspect of the invention; or

3) the fusion protein of the second aspect of the present invention;

b) a nucleic acid component comprising:

The single-stranded guide RNA of the third aspect of the invention.

In a ninth aspect, the present invention provides a cell comprising: the isolated nucleic acid molecule of the sixth aspect of the present invention, or the vector of the seventh aspect of the present invention.

In a tenth aspect, the present invention provides a method for gene editing a target sequence in a cell or in vitro, the method comprising: making the Cas12 protein, the conjugate of the first aspect of the present invention or the second aspect of the present invention The fusion protein of the present invention and the single-stranded guide RNA of the third aspect of the present invention, the carrier of the sixth aspect and the seventh aspect of the present invention, or the CRISPR/Cas12 gene editing system of the eighth aspect of the present invention and the intracellular or in vitro environment wherein the Cas12 protein is respectively Cas12J-8 protein, Mb4Cas12a protein, MlCas12a protein, MoCas12a protein, BgCas12a protein or ChCas12b protein having the amino acid sequence shown in SEQ ID NO: 1 to SEQ ID NO: 6 , or having at least 80 amino acid sequences as shown in any one of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5 and SEQ ID NO: 6 % sequence identity and retain the homologue of its biologically active amino acid sequence, the target sequence is located at the 5' end of the protospacer adjacent sequence (PAM), and, for the Cas12J-8 protein, the Mb4Cas12a protein, The MlCas12a protein, the MoCas12a protein, the BgCas12a protein, and the ChCas12b protein, or their homologues, conjugates or fusion proteins, the PAMs have the sequences 5'TTN, 5'-YYN, 5'YYN, 5'YYN, 5'-YYN, and 5'-TTN.

In the eleventh aspect, the present invention provides a kit comprising: Cas12 protein, the conjugate of the first aspect of the present invention or the fusion protein of the second aspect of the present invention and the single protein of the third aspect of the present invention Strand guide RNA, the isolated nucleic acid molecule of the fourth aspect and the fifth aspect of the present invention, the carrier of the sixth aspect and the seventh aspect of the present invention, or the CRISPR/Cas12 gene editing system of the eighth aspect of the present invention; or target sequences in an in vitro environment for gene editing; wherein the Cas12 protein is Cas12J-8 protein, Mb4Cas12a protein, MlCas12a protein, MoCas12a respectively having amino acid sequences shown in SEQ ID NO: 1 to SEQ ID NO: 6 Protein, BgCas12a albumen or ChCas12b albumen, or for having any one in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5 and SEQ ID NO: 6 Homologues of amino acid sequences with at least 80% sequence identity to the indicated amino acid sequences and which retain their biological activity.

Our research group has developed a Cas12j-8 editing tool that can efficiently edit genes in a eukaryotic cell environment. The Cas12j-8 protein has a small number of amino acids, especially the minimum number of amino acids currently available in eukaryotic gene editors, and thus can be efficiently packaged into expression vectors such as adeno-associated virus vectors. Moreover, the protein has the characteristics of high specificity and simple PAM, and the protein has a small molecular weight and can be easily packaged by vector tools such as adeno-associated virus, which is very suitable for later development as a gene therapy tool.

In addition, the PAM of the Cas12j-8 protein is TTN, which is simple and has a wide range of editing. Moreover, our experiments have proved that Cas12j-8 protein has a significant advantage in editing efficiency at random sites compared with FnCas12a protein, and has a strong gene editing ability in a eukaryotic environment. Compared with the Cas12j-2 protein of the same series, Cas12j-8 has a very significant editing advantage, and the editing ability at random sites is significantly higher than that of Cas12j-2, which is more suitable for the development and application research of gene editing.

Compared with other existing Cas12a proteins and Cas12b proteins, the Cas12a protein and Cas12b protein of the present invention have higher editing activity, higher specificity, and have a relatively simple PAM sequence. PAM is YYN, which expands the field of Cas12a protein and Cas12b protein, and increases the application range of Cas12a protein and Cas12b protein.

Description of drawings

Figure 1 shows a schematic diagram of the results of editing efficiency after gene editing of two target sites by the CRISPR/Cas12J-8 gene editing system;

Figure 2 shows a schematic diagram of the results of editing efficiency after gene editing of two target sites by the CRISPR/ChCas12b gene editing system;

Figure 3 shows a schematic diagram of the results of editing efficiency after gene editing of two target sites by the CRISPR/Mb4Cas12a gene editing system;

Figure 4 shows a schematic diagram of the editing efficiency results after the CRISPR/MoCas12a gene editing system performs gene editing on two target sites;

Figure 5 shows a schematic diagram of the editing efficiency results after the CRISPR/BgCas12a gene editing system performs gene editing on two target sites;

Figure 6 shows a schematic diagram of the results of editing efficiency after gene editing of two target sites by the CRISPR/MICas12a gene editing system;

Figure 7 and Figure 8 are schematic diagrams showing the specific detection results of the CRISPR/Cas12J-8 gene editing system in the GFP reporter system HEK293T cell line;

Figure 9 shows a schematic diagram of the specific detection results of the CRISPR/ChCas12b gene editing system in the GFP reporter system HEK293T cell line;

Figure 10 shows a schematic diagram of the specific detection results of the CRISPR/Mb4Cas12a gene editing system in the GFP reporter system HEK293T cell line;

Figure 11 shows a schematic diagram of the specific detection results of the CRISPR/MoCas12a gene editing system in the GFP reporter system HEK293T cell line;

Figure 12 shows a schematic diagram of the specific detection results of the CRISPR/BgCas12a gene editing system in the GFP reporter system HEK293T cell line;

Figure 13 shows a schematic diagram of the specific detection results of the CRISPR/MICas12a gene editing system in the GFP reporter system HEK293T cell line;

Figure 14 shows the results of editing the target sites of each endogenous site by the Cas12J-8ABE base editor.

Fig. 15 shows a schematic diagram of using the GFP reporter cell line library to detect the editing of the target gene by the CRISPR/Cas system.

Figure 16 shows cell photographs of GFP reporter cell lines processed using several CRISPR/Cas12J gene editing systems, wherein the upper image is a fluorescent image, and the lower image is an ordinary microscopic image.

Figure 17 shows a schematic diagram of the editing efficiency of ChCas12b and its point mutants in GFP cell lines.

Figure 18 shows a schematic diagram of the editing efficiency of Cas12a and its point mutants in GFP cell lines.

Detailed ways

The present invention will be further described in detail below. It should be understood that the summary of the invention above and the detailed description below are only for the purpose of specifically illustrating the present invention, and are not intended to limit the present invention in any way. The protection scope of the present invention is determined by the appended claims. Without departing from the spirit and purpose of the present invention, those skilled in the art can make changes to each specific implementation.

definition

Unless otherwise stated, scientific and technical terms used in this application have the meanings commonly understood by those skilled in the art. In order to better understand the present invention, definitions and explanations of relevant terms are provided below.

The terms "Cas12 protein", "Cas12" and "Cas" used herein are used interchangeably in this application to refer to RNA-guided nucleases including Cas12 protein or functionally active fragments thereof. Cas12 protein is a protein component of the CRISPR/Cas12 genome editing system, which can target and cut DNA target sequences under the guidance of single-stranded guide RNA (gRNA), forming DNA double-strand breaks (DSB). DNA double-strand breaks can activate the inherent repair mechanisms in cells, non-homologous end joining (NHEJ) and homologous recombination (homologous recombination, HR), thereby repairing DNA damage in cells. During repair, site-specific editing is performed on that specific DNA sequence.

The term "point mutant" used herein refers to a mutein with one amino acid or multiple amino acid mutations relative to the wild-type protein, within the scope of the term "homologue" of the present invention. In the present invention, point mutants include mutants having single point mutations or multiple point mutations. Herein, the notation "AXXXB" is used to denote a point mutant, wherein amino acid A denoting XXX is mutated to B. For example, the point mutant T207A of Mb4Cas12a protein represents the mutant that T (threonine (Thr)) at position 207 of Mb4Cas12a protein is mutated to A (alanine (Ala)). Similarly, the point mutant T207A-N616S of the Mb4Cas12a protein represents that the T (threonine (Thr)) at the 207th position of the Mb4Cas12a protein is mutated into A (alanine (Ala)) and the N (asparagus at the 616th position) Amide (Asn)) is mutated to S (serine (Ser)) mutants.

The terms "single-stranded guide RNA" and "sgRNA (single guided RNA)" used herein are used interchangeably in this application and have meanings commonly understood by those skilled in the art. Generally speaking, a single-stranded guide RNA or sgRNA may comprise a CRISPR repeat sequence (repeat sequence) and a guide sequence (guide sequence), and the guide sequence is also referred to herein as a guide RNA (guide RNA or gRNA). In the context of the endogenous CRISPR system, the guide sequence is also called a spacer. In certain instances, a guide sequence is any polynucleotide sequence that has sufficient similarity to a target sequence to hybridize to and direct specific binding of the CRISPR/Cas12 complex to the target sequence. In certain embodiments, when optimally aligned, the degree of complementarity between the guide sequence and its corresponding target sequence is at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, Or at least 99%. Determining the optimal alignment is within the ability of one of ordinary skill in the art. For example, there are public and commercially available alignment algorithms and programs such as, but not limited to, ClustalW, Smith-Waterman in matlab, Bowtie, Geneious, Biopython, and SeqMan.

The term "CRISPR/Cas12 complex" as used herein refers to the complex formed by the combination of single-stranded guide RNA (single guide RNA) or mature crRNA and the Cas12 protein, which includes hybridization with the target sequence and thus makes the Cas12 protein and Cas12 protein A guide sequence to which the target sequence binds. The complex recognizes and cleaves polynucleotides that hybridize to the single-stranded guide RNA or mature crRNA.

Thus, in the context of the formation of a CRISPR/Cas12 complex, "target sequence" refers to a polynucleotide targeted by a guide sequence designed to be targeted, e.g., a sequence complementary to the guide sequence, wherein the target The hybridization between the sequence and the guide sequence will promote Cas12 to exert its activity, such as the activity of cutting the target sequence. Full complementarity is not required, as long as there is sufficient complementarity to cause hybridization and facilitate Cas12 to exert its activity. A target sequence can include any polynucleotide, such as DNA or RNA. In certain instances, the target sequence is located in the nucleus or cytoplasm of the cell. In some cases, the target sequence may be located in an organelle of a eukaryotic cell such as the mitochondria or chloroplast.

The term "target sequence" or "target polynucleotide" as used herein may be any polynucleotide endogenous or exogenous to a cell (eg, a eukaryotic cell). For example, the target polynucleotide can be a polynucleotide present in the nucleus of a eukaryotic cell. The target polynucleotide can be a sequence encoding a gene product (eg, protein) or a non-coding sequence (eg, regulatory polynucleotide or dummy DNA). In some cases, the target sequence should be related to a protospacer adjacent motif (PAM). The exact sequence and length requirements for the PAM vary depending on the Cas protein used, but the PAM is typically 2-5 bases sequence adjacent to the protospacer (target sequence). Those skilled in the art will be able to identify the PAM sequence to use with a given Cas protein.

As used herein, the terms "polynucleotide", "nucleic acid sequence", "nucleotide sequence" or "nucleic acid fragment" are used interchangeably and are single- or double-stranded RNA or DNA polymers, optionally containing synthetic unnatural, or altered nucleotide bases. Nucleotides are referred to by their single letter designations as follows: "A" for adenosine or deoxyadenosine (for RNA or DNA, respectively), "C" for cytidine or deoxycytidine, "G" for guanosine or Deoxyguanosine, "U" means uridine, "T" means deoxythymidine, "R" means purine (A or G), "Y" means pyrimidine (C or T), "K" means G or T," H" means A or C or T, "I" means inosine, and "N" means any nucleotide.

The terms "polypeptide", "peptide", and "protein" used herein are used interchangeably in this application to refer to a polymer of amino acid residues. The term applies to amino acid polymers in which one or more amino acid residues are an artificial chemical analog of the corresponding naturally occurring amino acid, and to naturally occurring amino acid polymers. The terms "polypeptide", "peptide", "amino acid sequence" and "protein" may also include modified forms including, but not limited to, glycosylation, lipid linkage, sulfation, gamma carboxylation of glutamic acid residues, hydroxylation ylation and ADP-ribosylation.

The term sequence "identity" or "homology" as used herein has an art-recognized meaning, and the percent sequence identity between two nucleic acid or polypeptide molecules or regions can be calculated using published techniques. Sequence identity can be measured along the entire length of a polynucleotide or polypeptide, or along a region of the molecule. (See, e.g., Computational Molecular Biology, Lesk,

A.M., ed., Oxford University Press, New York, 1988; Biocomputing: Informatics and Genome Projects, Smith, D.W., ed., Academic Press, New York, 1993; Computer Analysis of Sequence Data, Part I, Griffin, A.M., and Griffin, H.G., eds., Humana Press, New Jersey, 1994; Sequence Analysis in Molecular Biology, von Heinje, G., Academic Press, 1987; and Sequence Analysis Primer, Gribskov, M. and Devereux, J., eds., M Stockton Press, New York, 1991). While there are many methods of measuring identity between two polynucleotides or polypeptides, the term "identity" is well known to the skilled artisan to be suitable for conservative amino acid substitutions in peptides or proteins and can generally be made unchanged The biological activity of the resulting molecule. Generally, those skilled in the art recognize that single amino acid substitutions in non-essential regions of a polypeptide do not substantially alter biological activity (see, e.g., Watson et al., Molecular Biology of the Gene, 4th Edition, 1987, The Benjamin/Cummings Pub.co ., p. 224).

The term "vector" as used herein refers to a nucleic acid delivery vehicle into which a polynucleotide can be inserted. When the vector enables the expression of a protein encoded by the inserted polynucleotide, or when the vector enables the transcription of the inserted polynucleotide (eg, into mRNA or functional RNA), the vector is called an expression vector. A vector can be introduced into a host cell by transformation, transduction or transfection, so that the genetic material elements it carries can be expressed in the host cell. Vectors are well known to those skilled in the art, including but not limited to: plasmid vectors, viral vectors and the like. The vector may also contain various regulatory sequences to regulate expression. "Regulatory sequence" and "regulatory element" are used interchangeably herein to refer to a sequence located upstream (5' non-coding sequence), intermediate or downstream (3' non-coding sequence) of a coding sequence and which affects the transcription of the associated coding sequence, RNA processing or stability or translated nucleotide sequence. Regulatory sequences may include, but are not limited to, promoter sequences, transcription initiation sequences, enhancer sequences, selection elements, reporter genes, and the like. The regulatory sequences may be of different origin, or of the same origin but arranged in a manner different from that normally found in nature. In addition, the vector may also contain an origin of replication.

The term "promoter" as used herein refers to a nucleic acid segment capable of controlling the transcription of another nucleic acid segment. In some embodiments of the invention, the promoter is a promoter capable of controlling the transcription of a gene in a cell, whether or not it is derived from said cell. The promoter may be a constitutive promoter or a tissue specific promoter or a developmentally regulated promoter or an inducible promoter.

The term "constitutive promoter" as used herein refers to a promoter that will generally cause a gene to be expressed in most cell types under most circumstances. "Tissue-specific promoter" and "tissue-preferred promoter" are used interchangeably and refer to expression that is primarily, but not necessarily exclusively, in one tissue or organ, and may also be expressed in a particular cell or cell type promoter. A "developmentally regulated promoter" refers to a promoter whose activity is determined by developmental events. An "inducible promoter" selectively expresses an operably linked DNA sequence in response to endogenous or exogenous stimuli (environment, hormones, chemical signals, etc.).

"Introducing" a nucleic acid molecule (eg, plasmid, linear nucleic acid fragment, RNA, etc.) or protein into an organism means transforming cells of the organism with the nucleic acid or protein so that the nucleic acid or protein can function in the cell. "Transformation" as used in the present invention includes stable transformation and transient transformation.

The term "stable transformation" as used herein refers to the introduction of a foreign nucleotide sequence into the genome, resulting in stable inheritance of the foreign gene. Once stably transformed, the exogenous nucleic acid sequence is stably integrated into the genome of the organism and any successive generations thereof.

The term "transient transformation" as used herein refers to the introduction of a nucleic acid molecule or protein into a cell to perform a function without the stable inheritance of a foreign gene. In transient transformation, the exogenous nucleic acid sequence does not integrate into the genome.

As used herein, the term "complementarity" refers to the ability of a nucleic acid sequence to form one or more hydrogen bonds with another nucleic acid sequence by means of traditional Watson-Crick or other non-traditional types. Percent complementarity indicates the percentage of residues in a nucleic acid molecule that can form hydrogen bonds (e.g., Watson-Crick base pairing) with another nucleic acid sequence (e.g., 5, 6, 7, 8, 9, 10 complementary, then the complementary percentages are 50%, 60%, 70%, 80%, 90% and 100%). "Perfectly complementary" means that all contiguous residues of one nucleic acid sequence hydrogen bond with the same number of contiguous residues in the other nucleic acid sequence. "Substantially complementary" as used herein refers to a group having At least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98 over a region of 30, 35, 40, 45, 50 or more nucleotides %, 99% or 100% degree of complementarity, or refers to two nucleic acids that hybridize under stringent conditions.

The term "stringent conditions" used herein in relation to hybridization refers to conditions under which a nucleic acid having complementarity to a target sequence primarily hybridizes to the target sequence and does not substantially hybridize to non-target sequences. Stringent conditions are generally sequence-dependent and depend on many factors. In general, the longer the sequence, the higher the temperature at which the sequence will specifically hybridize to its target sequence. Non-limiting examples of stringent conditions are described in "Laboratory Techniques in Biochemistry and Molecular Biology-Hybridization With Nucleic Acid Probes" by Tijssen (1993). ), Part I, Chapter 2, "Overview of principles of hybridization and the strategy of nucleic acid probe assay", Elsevier, New York).

As used herein, the term "hybridization" refers to a reaction in which one or more polynucleotides react to form a complex that is stabilized by hydrogen bonding of the bases between the nucleotide residues . Hydrogen bonding can occur by means of Watson-Crick base pairing, Hoogstein binding, or in any other sequence-specific manner. The complex may comprise two strands forming a duplex, three or more strands forming a multi-strand complex, a single self-hybridizing strand, or any combination of these. A hybridization reaction may constitute a step in a broader process such as the initiation of PCR, or cleavage of a polynucleotide by an enzyme. A sequence that is capable of hybridizing to a given sequence is called the "complement" of that given sequence.

derivatized protein

The Cas12 protein can be derivatized, for example linked to another molecule (eg another protein or polypeptide). Typically, derivatization (e.g., labeling) of a protein does not adversely affect the desired activity of the protein (e.g., activity to bind to a single-stranded guide RNA, endonuclease activity, binding to a specific site in a target sequence guided by a guide RNA) and cleavage activity). Therefore, in the present invention, the Cas12 protein can be functionally connected (by chemical coupling, gene fusion, non-covalent connection or other means) to one or more other molecular parts, such as another protein or polypeptide, detectable label, Pharmaceutical reagents, etc.

In particular, the Cas12 protein can be linked to other functional units. For example, it can be linked to a nuclear localization signal (NLS) sequence to enhance the ability of the protein of the invention to enter the nucleus. For example, it can be linked with a targeting moiety so that the Cas12 protein is targeted. For example, it can be linked with a detectable label to facilitate the detection of Cas12 protein. For example, it can be linked with an epitope tag to facilitate the expression, detection, tracking and/or purification of the Cas12 protein.

a) Cas12 protein, the Cas12 protein is:

1) Cas12J-8 protein having the amino acid sequence shown in SEQ ID NO: 1,

There is the Mb4Cas12a protein of the amino acid sequence shown in SEQ ID NO: 2,

There is the MlCas12a protein of the amino acid sequence shown in SEQ ID NO: 3,

MoCas12a protein with the amino acid sequence shown in SEQ ID NO: 4,

There is the BgCas12a protein of the amino acid sequence shown in SEQ ID NO: 5, or

ChCas12b protein having the amino acid sequence shown in SEQ ID NO: 6,

or for

2) having at least 80% of the amino acid sequence shown in any one of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5 and SEQ ID NO: 6, At least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93 %, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, Amino acids that have at least 99.7%, at least 99.8%, at least 99.9%, at least 99.95%, at least 99.99%, at least 99.999%, at least 100%, or any percentage of 80%-100% sequence identity and retain their biological activity sequence homologues;

b) the modification part; and

c) an optional linker for connecting the Cas12 protein with the modified part.

In the present invention, the "biological activity" of the so-called Cas12 protein refers to the activity of the protein in conjunction with single-stranded guide RNA, endonuclease activity (including single-strand cleavage activity and double-strand cleavage activity), and/or in the guide RNA (gRNA)-guided binding and cleavage activity at a specific site in a target sequence, but not limited thereto.

In a preferred embodiment, said homologue can be SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5 and SEQ ID NO: 6 Any one of the point mutants of the Cas12 protein, including but not limited to the point mutants of the Mb4Cas12a protein such as T207A, R432G, I902T, T207A-N616S or T207A-N616S-I902T, the point mutant of the MlCas12a protein such as V68T, R347Q, V68T-R347Q or V68T-R347Q-V1109K, the point mutants of the MoCas12a protein such as Q784E, T902I, I1105K, Q784E-I1105K or Q784E-T902I-I1105K, the point mutants of the BgCas12a protein such as Q144R, D148G, V279I, Q144R-D148G or Q144R-D148G-V279I, or point mutants of the ChCas12b protein such as Q23T, P182R, E507D, E1090K, Q23T-P182R, Q23T-E507D, Q23T-P182R-E507D or Q23T-P182 E507D-E1090K.

It can be understood that, in addition to the Cas12 protein itself, the Cas12 protein can also be combined with other substances such as other proteins or labelable tags to impart other functions.

Thus, in one embodiment, the modified moiety may be an additional protein or polypeptide, a detectable label, or a combination thereof.

In a further embodiment, said additional protein or polypeptide is selected from an epitope tag, a reporter protein or a nuclear localization signal (NLS) sequence, cytosine deaminase (CBE), adenine deaminase (ABE), Cytosine methylase DNMT3A and MQ1, cytosine demethylase Tet1, transcription activators VP64, p65 and RTA, transcription repressor KRAB, histone acetylase p300, histone deacetylase LSD1, and endogenous One or more of Dicer FokI.

Epitope tags are well known to those skilled in the art, examples of which include but are not limited to His, V5, FLAG, HA, Myc, VSV-G, Trx, etc., and those skilled in the art know how to detection or tracking) to select the appropriate epitope tag.

Reporter proteins are well known to those skilled in the art, and examples thereof include, but are not limited to, GST, HRP, CAT, GFP, HcRed, DsRed, CFP, YFP, BFP, and the like.

Detectable labels are well known to those skilled in the art, examples of which include fluorescent dyes such as fluorescein isothiocyanate (FITC) or DAPI.

The Cas12 protein of the present invention can be coupled, conjugated or fused to the modified part through a linker, or directly connected to the modified part without a linker. Linkers are well known in the art, examples of which include but are not limited to linkers comprising 1-50 amino acids (such as Glu or Ser) or amino acid derivatives (such as Ahx, β-Ala, GABA or Ava), or PEG, etc.

In a second aspect, the present invention provides a fusion protein comprising:

a) Cas12 protein, the Cas12 protein is:

1) Cas12J-8 protein having the amino acid sequence shown in SEQ ID NO: 1,

There is the MlCas12a protein of the amino acid sequence shown in SEQ ID NO: 3,

MoCas12a protein with the amino acid sequence shown in SEQ ID NO: 4,

There is the BgCas12a protein of the amino acid sequence shown in SEQ ID NO: 5,

or

ChCas12b protein having the amino acid sequence shown in SEQ ID NO: 6,

or for

2) have at least 80% of the amino acid sequence shown in any one of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5 and SEQ ID NO: 6 , at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6% , at least 99.7%, at least 99.8%, at least 99.9%, at least 99.95%, at least 99.99%, at least 99.999%, at least 100%, or any percentage of sequence identity between 80%-100% and retain its biological activity Homologues of amino acid sequences;

b) additional proteins or polypeptides, and

c) an optional linker for connecting the Cas12 protein with the other protein or polypeptide.

Same as the first aspect of the present invention, in a preferred embodiment, the homologue can be SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO :5 and SEQ ID NO: any point mutant of the Cas12 protein shown in 6, including but not limited to the point mutant of the Mb4Cas12a protein such as T207A, R432G, I902T, T207A-N616S or T207A-N616S-I902T, the The point mutants of the MlCas12a protein such as V68T, R347Q, V68T-R347Q or V68T-R347Q-V1109K, the point mutants of the MoCas12a protein such as Q784E, T902I, I1105K, Q784E-I1105K or Q784E-T902I-I1105K, the BgCas12a Point mutants of the protein such as Q144R, D148G, V279I, Q144R-D148G or Q144R-D148G-V279I, or point mutants of the ChCas12b protein such as Q23T, P182R, E507D, E1090K, Q23T-P182R, Q23T-E507D, Q23T- P182R-E507D or Q23T-P182R-E507D-E1090K.

The additional protein or polypeptide may be selected from epitope tags, reporter proteins or nuclear localization signal (NLS) sequences, cytosine deaminase (CBE), adenine deaminase (ABE), cytosine methylase DNMT3A One of MQ1, cytosine demethylase Tet1, transcription activator VP64, p65 and RTA, transcription repressor KRAB, histone acetylase p300, histone deacetylase LSD1, and endonuclease FokI or multiple.

Epitope tags are well known to those skilled in the art, examples of which include but are not limited to His, V5, FLAG, HA, Myc, VSV-G, Trx, etc., and those skilled in the art know how to detection or tracking) to select the appropriate epitope tag. Reporter proteins are well known to those skilled in the art, and examples thereof include, but are not limited to, GST, HRP, CAT, GFP, HcRed, DsRed, CFP, YFP, BFP, and the like.

The Cas12 protein of the present invention can be coupled, conjugated or fused with the other protein or polypeptide through a linker, or directly connected with the other protein or polypeptide without a linker. Linkers are well known in the art, examples of which include but are not limited to linkers comprising 1-50 amino acids (such as Glu or Ser) or amino acid derivatives (such as Ahx, β-Ala, GABA or Ava), or PEG, etc.

In a preferred embodiment, the fusion protein comprises: Cas12J-8 protein, adenine deaminase (ABE) with the amino acid sequence shown in SEQ ID NO: 1, and optionally connecting the Cas12J-8 protein and the linker of the adenine deaminase (ABE).

In a preferred embodiment, the fusion protein is sequentially composed of the adenine deaminase (ABE), the linker, and the Cas12J-8 protein from its N-terminus to its C-terminus.

In a more preferred embodiment, the amino acid sequence of the fusion protein is shown in SEQ ID NO: 7.

In addition, the PAM of the Cas12j-8 protein is TTN, which is simple and has a wide range of editing. Moreover, our experiments have proved that Cas12j-8 protein has a significant advantage in editing efficiency at random sites compared with FnCas12a protein, and has a strong gene editing ability in a eukaryotic environment. Compared with the Cas12j-2 protein of the same series, the Cas12j-8 protein has a very significant editing advantage, and the editing ability at random sites is significantly higher than that of the Cas12j-2 protein, which is more suitable for the development and application research of gene editing.

Compared with other existing Cas12a proteins and Cas12b proteins, the Cas12a protein and Cas12b protein of the present invention have higher editing activity, higher specificity, and a relatively simple PAM sequence, and the PAM of the Cas12a protein and Cas12b protein is YYN , expanding the field of Cas12a protein and Cas12b protein, and increasing the application range of Cas12a protein and Cas12b protein.

single-stranded guide RNA

In a third aspect, the present invention provides a single-stranded guide RNA comprising a CRISPR repeat sequence, the CRISPR repeat sequence having:

A) for Cas12J-8 albumen, its homologue, conjugate or the nucleic acid sequence shown in the SEQ ID NO of fusion protein: 15,

For the nucleic acid sequence shown in SEQ ID NO of Mb4Cas12a protein, MlCas12a protein and MoCas12a protein, its homologue, conjugate or fusion protein,

For BgCas12a albumen, its homologue, the nucleic acid sequence shown in the SEQ ID NO of conjugate or fusion protein: 17, or

For ChCas12b protein, its homologue, conjugate or fusion protein SEQ ID NO: the nucleotide sequence shown in 18;

or

b) at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, A nucleic acid sequence that has at least 97%, at least 98%, at least 99%, at least 99.9%, or at least 100% sequence identity and retains its biological activity; or

c) a nucleic acid sequence modified based on the nucleic acid sequence described in any one of SEQ ID NO: 15 to SEQ ID NO: 18 and retaining its biological activity.

In one embodiment, the modification may be one or more of base phosphorylation, base sulfuration, base methylation, base hydroxylation, sequence shortening and sequence lengthening.

In a further embodiment, shortening of said sequence and lengthening of said sequence comprises the presence of one, two, three, four, five, six, seven, eight, nine or Deletions or additions of ten bases.

In yet another embodiment, the single-stranded guide RNA may further include a CRISPR spacer sequence at the 3' end of the CRISPR repeat sequence, and the CRISPR spacer sequence is 20, 21, 22, 23, 24, 25, A sequence of 26, 27, 28, 29, 30 nucleotides (preferably 24 nucleotides) capable of complementary pairing with the target sequence.

In a preferred embodiment, the CRISPR spacer sequence is a sequence of 24 nucleotides in length and capable of complementary pairing with the target sequence.

In a further embodiment, said single-stranded guide RNA further comprises a terminator at the 3' end of said spacer sequence. As an example, the terminator may be a plurality of terminators composed of at least six (eg, seven or eight) Us.

The single-stranded guide RNA can combine with the above-mentioned Cas12 protein, conjugate or fusion protein to form a complex, which can recognize the corresponding PAM and thus bind to the target sequence, thereby realizing the shearing of the target sequence or Say gene editing.

Encoding nucleic acid and vector

a) Cas12 protein, the Cas12 protein is:

1) Cas12J-8 protein having the amino acid sequence shown in SEQ ID NO: 1,

There is the MlCas12a protein of the amino acid sequence shown in SEQ ID NO: 3,

MoCas12a protein with the amino acid sequence shown in SEQ ID NO: 4,

There is the BgCas12a protein of the amino acid sequence shown in SEQ ID NO: 5,

or

ChCas12b protein having the amino acid sequence shown in SEQ ID NO: 6,

or for

b) a conjugate of the first aspect of the invention; or

c) The fusion protein of the second aspect of the invention.

Like the first and second aspects of the present invention, in a preferred embodiment, the homologue can be SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, A point mutant of any one of the Cas12 protein shown in SEQ ID NO: 5 and SEQ ID NO: 6, including but not limited to the point mutant of the Mb4Cas12a protein such as T207A, R432G, I902T, T207A-N616S or T207A-N616S- I902T, the point mutant of the MlCas12a protein such as V68T, R347Q, V68T-R347Q or V68T-R347Q-V1109K, the point mutant of the MoCas12a protein such as Q784E, T902I, I1105K, Q784E-I1105K or Q784E-T902I-I1105K, Point mutants of the BgCas12a protein such as Q144R, D148G, V279I, Q144R-D148G or Q144R-D148G-V279I, or point mutants of the ChCas12b protein such as Q23T, P182R, E507D, E1090K, Q23T-P182R, Q23T-E507D , Q23T-P182R-E507D or Q23T-P182R-E507D-E1090K.

In one embodiment, the isolated nucleic acid molecule comprises any of SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13 A nucleic acid sequence as indicated or a degenerate sequence thereof.

In one embodiment, the isolated nucleic acid molecule comprises a nucleic acid sequence encoding a fusion protein shown in SEQ ID NO:7.

In a preferred embodiment, the isolated nucleic acid molecule comprises the nucleic acid sequence shown in SEQ ID NO: 14 or its degenerate sequence.

In a further embodiment, the isolated nucleic acid molecule also encodes the single-stranded guide RNA corresponding to the Cas12 protein of the third aspect of the present invention.

As an example, the isolated nucleic acid molecule comprises a Cas12J-8 protein encoding an amino acid sequence shown in SEQ ID NO: 1, its homologue, a conjugate or a fusion protein (such as a fusion shown in SEQ ID NO: 7) Protein) nucleic acid sequence, such as SEQ ID NO: 8, or the nucleic acid sequence shown in SEQ ID NO: 14, and comprises a sequence encoding the Cas12J-8 protein, its homologue, conjugate or fusion protein comprising SEQ ID The CRISPR repeat sequence shown in NO: 15, comprising a homologous sequence having at least 90% sequence identity with SEQ ID NO: 15 and retaining its biological activity, or comprising a modified sequence based on SEQ ID NO: 15 and retaining its biological activity The nucleic acid sequence of the single-stranded guide RNA of the modified sequence of the activity, such as the nucleic acid sequence shown in SEQ ID NO: 19.

As an example, the isolated nucleic acid molecule comprises a Cas12a protein encoding an amino acid sequence shown in SEQ ID NO: 2, SEQ ID NO: 3 or SEQ ID NO: 4, a homologue, a conjugate or a fusion protein thereof Nucleic acid sequence, such as the nucleic acid sequence shown in SEQ ID NO: 9, SEQ ID NO: 10 or SEQ ID NO: 11, and comprising SEQ ID coding for the Cas12a protein, its homologue, conjugate or fusion protein The CRISPR repeat sequence shown in NO: 16, comprising a homologous sequence having at least 90% sequence identity with SEQ ID NO: 16 and retaining its biological activity, or comprising a modified sequence based on SEQ ID NO: 16 and retaining its biological activity The nucleic acid sequence of the single-stranded guide RNA of the modified sequence of the activity, such as the nucleic acid sequence shown in SEQ ID NO:20.

As an example, the isolated nucleic acid molecule comprises a nucleic acid sequence encoding a BgCas12a protein having an amino acid sequence shown in SEQ ID NO: 5, its homologue, a conjugate or a fusion protein, such as shown in SEQ ID NO: 12 Nucleic acid sequence, and comprising encoding for the BgCas12a protein, its homologue, conjugate or fusion protein comprising the CRISPR repeat sequence shown in SEQ ID NO: 17, comprising at least 90% sequence identity with SEQ ID NO: 17 and A homologous sequence that retains its biological activity, or a nucleic acid sequence comprising a single-stranded guide RNA that is transformed based on SEQ ID NO: 17 and a modified sequence that retains its biological activity, such as the nucleic acid sequence shown in SEQ ID NO: 21 .

As an example, the isolated nucleic acid molecule comprises a nucleic acid sequence encoding a ChCas12b protein having an amino acid sequence shown in SEQ ID NO: 6, its homologue, a conjugate or a fusion protein, such as shown in SEQ ID NO: 13 Nucleic acid sequence, and comprising encoding for the ChCas12b protein, its homologue, conjugate or fusion protein comprising SEQ ID NO: 18 shown in the CRISPR repeat sequence, comprising at least 90% sequence identity with SEQ ID NO: 18 and A homologous sequence that retains its biological activity, or a nucleic acid sequence that includes a single-stranded guide RNA that is modified based on SEQ ID NO: 18 and that retains its biological activity, such as the nucleic acid sequence shown in SEQ ID NO: 22 .

In a fifth aspect, the invention provides an isolated nucleic acid molecule encoding the single-stranded guide RNA of the third aspect of the invention.

In one embodiment, the nucleic acid molecule of described separation comprises SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21 and the nucleotide sequence shown in any one of SEQ ID NO:22 or its degenerate sequence .

In a preferred embodiment, said isolated nucleic acid molecule further comprises a nucleic acid sequence encoding a CRISPR spacer sequence.

After using certain tools known in the art such as expression vectors to transfect the isolated nucleic acid molecule of the present invention into corresponding cells, the isolated nucleic acid molecule of the present invention can express the Cas12 protein, Cas12 protein, Its conjugate or fusion protein, and/or the above-mentioned single-stranded guide RNA, and perform corresponding functions here, such as gene editing.

In addition, the isolated nucleic acid molecule of the present invention can express Cas12 protein, its conjugate or fusion protein, and single-stranded guide RNA separately/respectively, or express the expression product integrally, which expression method is selected according to It depends.

Furthermore, the expression product has the corresponding effects and/or functions described above, which will not be repeated here for the sake of brevity.

a) Cas12 protein, the Cas12 protein is:

1) Cas12J-8 protein having the amino acid sequence shown in SEQ ID NO: 1,

There is the MlCas12a protein of the amino acid sequence shown in SEQ ID NO: 3,

MoCas12a protein with the amino acid sequence shown in SEQ ID NO: 4,

There is the BgCas12a protein of the amino acid sequence shown in SEQ ID NO: 5,

or

ChCas12b protein having the amino acid sequence shown in SEQ ID NO: 6,

or for

b) a conjugate of the first aspect of the invention; or

c) The fusion protein of the second aspect of the invention.

In one embodiment, the vector comprises any one of SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, and SEQ ID NO: 13 Nucleic acid sequence or its degenerate sequence.

In one embodiment, the vector comprises a nucleic acid sequence encoding a fusion protein shown in SEQ ID NO:7.

In a preferred embodiment, the vector comprises the nucleic acid sequence shown in SEQ ID NO: 14 or its degenerate sequence.

The vector may be an expression vector, such as a plasmid vector such as a pUC19 vector, an episomal vector, a pAAV2_ITR vector, a retroviral vector, a lentiviral vector, an adenoviral vector or an adeno-associated viral vector.

In yet another embodiment, the vector further comprises a nucleic acid sequence encoding the single-stranded guide RNA corresponding to the Cas12 protein of the third aspect of the present invention.

As an example, the vector comprises a Cas12J-8 protein encoding an amino acid sequence shown in SEQ ID NO: 1, a homologue thereof, a conjugate or a fusion protein (such as a fusion protein shown in SEQ ID NO: 7). Nucleic acid sequence, for example the nucleic acid sequence shown in SEQ ID NO: 8 or SEQ ID NO: 14, and comprises coding for this Cas12J-8 protein, its homologue, conjugate or fusion protein comprising SEQ ID NO: 15 CRISPR repeat sequence, comprising a homologous sequence having at least 90% sequence identity with SEQ ID NO: 15 and retaining its biological activity, or comprising a modified sequence based on SEQ ID NO: 15 and retaining its biological activity The nucleic acid sequence of the single-stranded guide RNA, such as the nucleic acid sequence shown in SEQ ID NO: 19.

As an example, the vector comprises a nucleic acid sequence encoding a Cas12a protein, a homologue thereof, a conjugate or a fusion protein thereof having an amino acid sequence shown in SEQ ID NO: 2, SEQ ID NO: 3 or SEQ ID NO: 4, For example, the nucleic acid sequence shown in SEQ ID NO: 9, SEQ ID NO: 10 or SEQ ID NO: 11, and comprising SEQ ID NO: 16 coding for the Cas12a protein, its homologue, conjugate or fusion protein The shown CRISPR repeat sequence, comprising a homologous sequence having at least 90% sequence identity with SEQ ID NO: 16 and retaining its biological activity, or comprising a modification based on SEQ ID NO: 16 and retaining its biological activity The nucleic acid sequence of the single-stranded guide RNA of sequence, for example the nucleic acid sequence shown in SEQ ID NO:20.

As an example, the vector comprises a nucleic acid sequence encoding a BgCas12a protein having an amino acid sequence shown in SEQ ID NO: 5, a homologue thereof, a conjugate or a fusion protein, such as a nucleic acid sequence shown in SEQ ID NO: 12, And comprise coding for this BgCas12a albumen, its homologue, conjugate or fusion protein comprising the CRISPR repeat sequence shown in SEQ ID NO: 17, comprising and SEQ ID NO: 17 has at least 90% sequence identity and retains its biological The homologous sequence of biological activity, or the nucleic acid sequence of a single-stranded guide RNA comprising a modified sequence based on SEQ ID NO: 17 and retaining its biological activity, such as the nucleic acid sequence shown in SEQ ID NO: 21.

As an example, the vector comprises a nucleic acid sequence encoding a ChCas12b protein having an amino acid sequence shown in SEQ ID NO: 6, a homolog thereof, a conjugate or a fusion protein, such as a nucleic acid sequence shown in SEQ ID NO: 13, And comprise coding for this ChCas12b protein, its homologue, conjugate or fusion protein comprising the CRISPR repeat sequence shown in SEQ ID NO: 18, comprising and SEQ ID NO: 18 has at least 90% sequence identity and retains its biological The homologous sequence of biological activity, or the nucleic acid sequence of a single-stranded guide RNA comprising a modified sequence based on SEQ ID NO: 18 and retaining its biological activity, such as the nucleic acid sequence shown in SEQ ID NO: 22.

In the seventh aspect, the present invention provides a vector comprising a nucleic acid molecule encoding the single-stranded guide RNA of the third aspect of the present invention.

In one embodiment, the vector comprises the nucleic acid sequence shown in any one of SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21 and SEQ ID NO: 22 or a degenerate sequence thereof.

In a preferred embodiment, the vector further comprises a nucleic acid sequence encoding a CRISPR spacer sequence.

According to the above description, after the vector of the present invention is transfected into cells, the nucleic acid sequence cloned in the vector can be expressed as Cas12 protein, its conjugate or fusion protein, and/or the above-mentioned Single-stranded guide RNA, where it can perform corresponding functions, such as gene editing.

In addition, multiple vectors, such as two vectors, can be transfected into cells, one of which expresses the Cas12 protein, its conjugate or fusion protein, and the other expresses a single-stranded guide RNA. Subsequently, the expressed Cas12 protein, its conjugate or fusion protein complexes with the expressed single-stranded guide RNA to form a complex, where it performs corresponding functions, such as gene editing.

Of course, the nucleic acid sequence encoding the Cas12 protein, its conjugate or fusion protein, and the nucleic acid sequence encoding the single-stranded guide RNA can also be cloned into a vector, so that the vector is transfected into cells to express the Cas12 protein, its conjugate or fusion protein, and the single-stranded guide RNA, and perform corresponding functions here, such as gene editing.

CRISPR/Cas12 Gene Editing System

a) protein component comprising:

1) Cas12 protein, the Cas12 protein is:

1.1) Cas12J-8 protein having the amino acid sequence shown in SEQ ID NO: 1,

There is the MlCas12a protein of the amino acid sequence shown in SEQ ID NO: 3,

MoCas12a protein with the amino acid sequence shown in SEQ ID NO: 4,

ChCas12b protein having the amino acid sequence shown in SEQ ID NO: 6,

or for

1.2) have at least 80% of the amino acid sequence shown in any one of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5 and SEQ ID NO: 6 , at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6% , at least 99.7%, at least 99.8%, at least 99.9%, at least 99.95%, at least 99.99%, at least 99.999%, at least 100%, or any percentage of sequence identity between 80%-100% and retain its biological activity Homologues of amino acid sequences;

2) the conjugate of the first aspect of the invention; or

3) the fusion protein of the second aspect of the present invention; and

b) a nucleic acid component comprising: a single-stranded guide RNA corresponding to the protein component in a) according to the third aspect of the present invention;

And, the protein component and the nucleic acid component combine with each other to form a complex.

As an example, the protein component comprises a Cas12J-8 protein with the amino acid sequence shown in SEQ ID NO: 1, its homologue, conjugate or fusion protein, and the nucleic acid component comprises a single-stranded guide RNA, so The single-stranded guide RNA is a single-stranded guide RNA comprising a CRISPR repeat sequence shown in SEQ ID NO: 15, comprising a single strand of a homologous sequence having at least 90% sequence identity with SEQ ID NO: 15 and retaining its biological activity Guide RNA, or a single-stranded guide RNA comprising a modified sequence based on SEQ ID NO: 15 and retaining its biological activity.

As an example, the protein component comprises Cas12a protein, its homologue, conjugate or fusion protein having the amino acid sequence shown in SEQ ID NO: 2, SEQ ID NO: 3 or SEQ ID NO: 4, said The nucleic acid component comprises a single-stranded guide RNA that is a single-stranded guide RNA comprising a CRISPR repeat sequence shown in SEQ ID NO: 16, comprising at least 90% sequence identity with SEQ ID NO: 16 and retaining its A single-stranded guide RNA with a biologically active homologous sequence, or a single-stranded guide RNA containing a modified sequence based on SEQ ID NO: 16 and retaining its biological activity.

As an example, the protein component comprises BgCas12a protein with the amino acid sequence shown in SEQ ID NO: 5, its homologue, conjugate or fusion protein, the nucleic acid component comprises a single-stranded guide RNA, the single The strand guide RNA is a single-stranded guide RNA comprising a CRISPR repeat sequence shown in SEQ ID NO: 17, a single-stranded guide RNA comprising a homologous sequence with at least 90% sequence identity to SEQ ID NO: 17 and retaining its biological activity , or a single-stranded guide RNA comprising a modified sequence based on SEQ ID NO: 17 and retaining its biological activity.

As an example, the protein component comprises a ChCas12b protein having an amino acid sequence shown in SEQ ID NO: 6, its homologue, a conjugate or a fusion protein, the nucleic acid component comprises a single-stranded guide RNA, and the single The strand guide RNA is a single-stranded guide RNA comprising a CRISPR repeat sequence shown in SEQ ID NO: 18, a single-stranded guide RNA comprising a homologous sequence with at least 90% sequence identity to SEQ ID NO: 18 and retaining its biological activity , or a single-stranded guide RNA comprising a modified sequence based on SEQ ID NO: 18 and retaining its biological activity.

Above, the expression "at least 90% sequence identity" mentioned for single-stranded guide RNAs may be, for example, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96% , at least 97%, at least 98%, at least 99%, at least 99.9%, or at least 100% sequence identity.

The CRISPR/Cas12 gene editing system of the present invention can be directly constituted by the Cas12 protein described herein, its homologue, or their conjugates or fusion proteins and the single-stranded guide RNA described herein, or can be directly composed of the single-stranded guide RNA described herein. The expression product obtained by the vector expression constitutes.

The CRISPR/Cas12 gene editing system of the present invention realizes the recognition, positioning, cutting and gene editing of the target sequence through the joint action of the Cas12 protein contained therein and the single-stranded guide RNA.

The CRISPR/Cas12 gene editing system of the present invention can precisely locate the target sequence. The so-called "precise positioning" has two meanings: the first meaning means that the CRISPR/Cas12 gene editing system of the present invention can recognize and bind the target sequence itself, and the second meaning means that the CRISPR/Cas12 gene editing system of the present invention can Other proteins fused with the Cas12 protein or proteins that specifically recognize the sgRNA are brought to the position of the target sequence.

The CRISPR/Cas12 gene editing system of the present invention has a low tolerance to non-target sequences. Herein, the so-called "with low tolerance" means that the CRISPR/Cas12 gene editing system of the present invention is basically unable or completely unable to recognize and bind non-target sequences, or basically unable or completely unable to fuse with the Cas12 protein Other proteins or proteins that specifically recognize the sgRNA are brought to the position of the non-target sequence.

The CRISPR/Cas12 gene editing system of the present invention can target more DNA sequences in the genome because the PAM sequence on the target sequence recognized by the Cas12 protein contained therein is simpler.

cell

In a ninth aspect, the present invention provides a cell comprising: the isolated nucleic acid molecule of the fourth and fifth aspects of the present invention, or the vector of the sixth and seventh aspects of the present invention.

As an example, the cells may be prokaryotic or eukaryotic. As for the eukaryotic cell, it may be, for example, a plant cell or an animal cell. As for the animal cell, as an example, it may be a mammalian cell such as a human cell.

method

In a tenth aspect, the present invention provides a method for gene editing a target sequence in a cell or in vitro environment, the method comprising combining any one of the following (1) to (4) with the intracellular or in vitro environment The target sequence in the contact:

(1) Cas12 protein, the conjugate of the first aspect of the present invention or the fusion protein of the second aspect of the present invention, and the single-stranded guide RNA corresponding to the Cas12 protein of the third aspect of the present invention,

Wherein, the Cas12 protein is:

1) Cas12J-8 protein having the amino acid sequence shown in SEQ ID NO: 1,

There is the MlCas12a protein of the amino acid sequence shown in SEQ ID NO: 3,

MoCas12a protein with the amino acid sequence shown in SEQ ID NO: 4,

ChCas12b protein having the amino acid sequence shown in SEQ ID NO: 6,

or for

(2) the carrier of the sixth aspect and the seventh aspect of the present invention;

(3) the carrier of the sixth aspect of the present invention; and

(4) The CRISPR/Cas12 gene editing system of the eighth aspect of the present invention;

Wherein, after contacting with the target sequence, the Cas12 protein, its homologue, conjugate or fusion protein recognizes the respective protospacer adjacent sequence (PAM), and the PAM is located at the 5' end of the target sequence, and, for The Cas12J-8 protein, the Mb4Cas12a protein, the MlCas12a protein, the MoCas12a protein, the BgCas12a protein, and the ChCas12b protein, or their respective homologues, conjugates or fusion proteins, the The PAMs are 5'-TTN, 5'-YYN, 5'-YYN, 5'-YYN, 5'-YYN and 5'-TTN, respectively.

For item (1) mentioned above: as an example, there is the Cas12J-8 albumen of the amino acid sequence shown in SEQ ID NO: 1, its homologue, conjugate or fusion protein, and comprise SEQ ID NO: The CRISPR repeat sequence shown in 15, comprising a homologous sequence having at least 90% sequence identity with SEQ ID NO: 15, or comprising a single-stranded guide based on the modified sequence of SEQ ID NO: 15 and retaining its biological activity RNA;

As an example, a Cas12a protein having the amino acid sequence shown in SEQ ID NO: 2, SEQ ID NO: 3 or SEQ ID NO: 4, a homologue thereof, a conjugate or a fusion protein thereof, and a Cas12a protein comprising the amino acid sequence of SEQ ID NO: 16 CRISPR repeat sequence, comprising a homologous sequence having at least 90% sequence identity with SEQ ID NO: 16 and retaining its biological activity, or comprising a modified sequence based on SEQ ID NO: 16 and retaining its biological activity single-stranded guide RNA;

As an example, the nucleic acid sequence of the BgCas12a protein with the amino acid sequence shown in SEQ ID NO: 5, its homologues, their conjugates or fusion proteins, and the CRISPR repeat sequence shown in SEQ ID NO: 17, including and SEQ ID NO: 17 has at least 90% sequence identity and retains its biological activity homologous sequence, or comprises a single-stranded guide RNA based on SEQ ID NO: 17 modified sequence obtained and retains its biological activity;

As an example, a ChCas12b protein having the amino acid sequence shown in SEQ ID NO: 6, a homolog thereof, a conjugate or a fusion protein, and a CRISPR repeat sequence comprising SEQ ID NO: 18, comprising the same sequence as SEQ ID NO: 18 A homologous sequence having at least 90% sequence identity and retaining its biological activity, or a single-stranded guide RNA comprising a modified sequence based on SEQ ID NO: 18 and retaining its biological activity.

For item (2) above:

As an example, the nucleic acid sequence ( For example, the vector of the nucleic acid sequence shown in SEQ ID NO: 8 or SEQ ID NO: 14), and the vector comprising SEQ ID NO: 15 encoding the Cas12J-8 protein, its homologue, conjugate or fusion protein CRISPR repeat sequence, comprising a homologous sequence having at least 90% sequence identity with SEQ ID NO: 15 and retaining its biological activity, or comprising a modified sequence based on SEQ ID NO: 15 and retaining its biological activity The carrier of the nucleic acid sequence (such as the nucleic acid sequence shown in SEQ ID NO: 19) of the single-stranded guide RNA;

As an example, a nucleic acid sequence (such as SEQ ID NO: 9, SEQ ID NO: 10 or the vector of the nucleic acid sequence shown in SEQ ID NO: 11), and the vector comprising SEQ ID NO: 16 encoding for the Mb4Cas12a protein, its homologue, conjugate or fusion protein The shown CRISPR repeat sequence, comprising a homologous sequence having at least 90% sequence identity with SEQ ID NO: 16 and retaining its biological activity, or comprising a modification based on SEQ ID NO: 16 and retaining its biological activity The carrier of the nucleic acid sequence (such as the nucleic acid sequence shown in SEQ ID NO: 20) of the single-stranded guide RNA of sequence;

As an example, a vector comprising a nucleic acid sequence (such as a nucleic acid sequence shown in SEQ ID NO: 12) encoding the BgCas12a protein with the amino acid sequence shown in SEQ ID NO: 5, its homologue, conjugate or fusion protein, And comprising coding for this BgCas12a albumen, its homologue, conjugate or fusion protein comprising the CRISPR repeat sequence shown in SEQ ID NO: 17, comprising having at least 90% sequence identity with SEQ ID NO: 17 and retaining its biological The homologous sequence of biological activity, or the nucleic acid sequence (such as the nucleic acid sequence shown in SEQ ID NO: 21) of the single-stranded guide RNA comprising the modified sequence obtained based on SEQ ID NO: 17 and retaining its biological activity ;

As an example, a vector comprising a nucleic acid sequence (such as a nucleic acid sequence shown in SEQ ID NO: 13) encoding a ChCas12b protein having an amino acid sequence shown in SEQ ID NO: 6, its homologue, a conjugate or a fusion protein, And comprising coding for this ChCas12b protein, its homologue, conjugate or fusion protein comprising the CRISPR repeat sequence shown in SEQ ID NO: 18, comprising having at least 90% sequence identity with SEQ ID NO: 18 and retaining its biological The homologous sequence of biological activity, or the nucleic acid sequence (such as the nucleic acid sequence shown in SEQ ID NO: 22) of the single-stranded guide RNA comprising the modified sequence obtained based on SEQ ID NO: 18 and retaining its biological activity .

In one embodiment, the cell is a prokaryotic cell or a eukaryotic cell, such as a plant cell or an animal cell, such as a mammalian cell such as a human cell.

In one embodiment, the gene editing includes gene knockout of target sequence, site-directed base change, site-directed insertion, regulation of gene transcription level, DNA methylation regulation, DNA acetylation modification, histone acetylation modification One or more of , single base conversion, and chromatin imaging tracking.

Further, in one embodiment, the single base conversion comprises the conversion of the base adenine to guanine, the conversion of cytosine to thymine or the conversion of cytosine to uracil.

In one embodiment, in the method, the CRISPR spacer sequence of the single-stranded guide RNA forms a complete base pairing structure with the target sequence, and forms an incomplete base pairing structure with the non-target sequence.

Herein, the incomplete base complementary pairing structure refers to a structure including a part of base complementary pairing and a part of non-base complementary pairing including, for example, base mismatch (mismatch) and/or Or base bulge (bulge), etc.

In one embodiment, the incomplete complementary base pairing structure includes one or more, eg, two or more, base mismatches.

Thus, the Cas12 protein of the present invention can cut the target site on the target sequence, and under the cleavage action of the Cas12 protein, a double-strand break occurs in the target sequence. Further, when the method is carried out in cells, the cleaved target sequence can be repaired by intracellular non-homologous end joining repair or homologous recombination repair pathway, thereby realizing gene editing of the target sequence.

The CRISPR/Cas12 gene editing system of the present invention and the gene editing method using the gene editing system are found through experiments to have 40%-70% (for the Cas12J-8 protein), 12%-56% (for the ChCas12b protein) and 10% %-20% (for each other Cas12a protein) editing efficiency. In addition, for the CRISPR/Cas12J-8 gene editing system, the mismatch of the first 14bp guide RNA has an error tolerance rate close to 0%. Therefore, the gene editing system can edit target genes with high specificity, has the characteristics of high editing efficiency and low off-target rate, and can be widely used in gene editing in cells or in vitro environments.

Reagent test kit

In the eleventh aspect, the present invention provides a kit for gene editing a target sequence in a cell or in an in vitro environment, comprising:

a) Any one selected from Ti) to 6):

1) Cas12 protein or its homologue, the conjugate of the first aspect of the present invention, or the fusion protein of the second aspect of the present invention, and the single-stranded guide RNA corresponding to the Cas12 protein of the third aspect of the present invention,

Wherein, the Cas12 protein is:

1.1) Cas12J-8 protein having the amino acid sequence shown in SEQ ID NO: 1,

There is the MlCas12a protein of the amino acid sequence shown in SEQ ID NO: 3,

MoCas12a protein with the amino acid sequence shown in SEQ ID NO: 4,

There is the BgCas12a protein of the amino acid sequence shown in SEQ ID NO: 5,

or

ChCas12b protein having the amino acid sequence shown in SEQ ID NO: 6,

or for

2) the isolated nucleic acid molecules of the fourth and fifth aspects of the invention;

3) The isolated nucleic acid molecule of the fifth aspect of the invention;

4) The carrier of the sixth and seventh aspects of the present invention;

5) the carrier of the sixth aspect of the present invention; or

6) The CRISPR/Cas12 gene editing system of the eighth aspect of the present invention;

as well as

b) Instructions on how to perform gene editing on target sequences in cells or in an in vitro environment.

For item 1) above: As an example, a Cas12J-8 protein having the amino acid sequence shown in SEQ ID NO: 1, a homologue, a conjugate or a fusion protein thereof, and a Cas12J-8 protein comprising the amino acid sequence shown in SEQ ID NO: 15 A single-stranded guide RNA of a CRISPR repeat sequence, a single-stranded guide RNA comprising a homologous sequence having at least 90% sequence identity with SEQ ID NO: 15 and retaining its biological activity, or comprising a modified sequence based on SEQ ID NO: 15 A single-stranded guide RNA with a modified sequence that retains its biological activity;

As an example, the Cas12a protein having the amino acid sequence shown in SEQ ID NO: 2, SEQ ID NO: 3 or SEQ ID NO: 4, which has the same protein as SEQ ID NO: 2, SEQ ID NO: 3 or SEQ ID NO: 4 Homologs of amino acid sequences having at least 80% sequence identity, their conjugates or fusion proteins, and a single-stranded guide RNA comprising the CRISPR repeat sequence shown in SEQ ID NO: 16, comprising the same sequence as SEQ ID NO: 16 A single-stranded guide RNA with at least 90% sequence identity and a homologous sequence that retains its biological activity, or a single-stranded guide RNA that includes a modified sequence based on SEQ ID NO: 16 and retains its biological activity;

As an example, the BgCas12a protein having the amino acid sequence shown in SEQ ID NO: 5, its homologue with the amino acid sequence having at least 80% sequence identity to SEQ ID NO: 5, their conjugates or fusion proteins, And a single-stranded guide RNA comprising a CRISPR repeat sequence shown in SEQ ID NO: 17, a single-stranded guide RNA comprising a homologous sequence with at least 90% sequence identity to SEQ ID NO: 17 and retaining its biological activity, or comprising A single-stranded guide RNA based on the modified sequence of SEQ ID NO: 17 and retaining its biological activity;

As an example, the ChCas12b protein having the amino acid sequence shown in SEQ ID NO: 6, its homologue having an amino acid sequence with at least 80% sequence identity to SEQ ID NO: 6, their conjugates or fusion proteins, And a single-stranded guide RNA comprising a CRISPR repeat sequence shown in SEQ ID NO: 18, a single-stranded guide RNA comprising a homologous sequence with at least 90% sequence identity to SEQ ID NO: 18 and retaining its biological activity, or comprising A single-stranded guide RNA based on the modified sequence of SEQ ID NO: 18 and retaining its biological activity.

In a preferred embodiment, said homologue can be SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5 and SEQ ID NO: 6 Any one of the point mutants of the Cas12 protein, including but not limited to the point mutants of the Mb4Cas12a protein such as T207A, R432G, I902T, T207A-N616S or T207A-N616S-I902T, the point mutant of the MlCas12a protein such as V68T, R347Q, V68T-R347Q or V68T-R347Q-V1109K, the point mutants of the MoCas12a protein such as Q784E, T902I, I1105K, Q784E-I1105K or Q784E-T902I-I1105K, the point mutants of the BgCas12a protein such as Q144R, D148G, V279I, Q144R-D148G or Q144R-D148G-V279I, or point mutants of the ChCas12b protein such as Q23T, P182R, E507D, E1090K, Q23T-P182R, Q23T-E507D, Q23T-P182R-E507D or Q23T-P182 E507D-E 1090K.

For item 2) above:

As an example, a Cas12J-8 protein encoding an amino acid sequence shown in SEQ ID NO: 1, a homologue thereof, a conjugate or a fusion protein (such as a fusion protein shown in SEQ ID NO: 7) nucleic acid sequence (such as SEQ ID NO: 8 or the nucleic acid sequence shown in SEQ ID NO: 14) the isolated nucleic acid molecule of nucleic acid molecule, and comprise coding for this Cas12J-8 albumen, its homologue, conjugate or fusion protein comprising SEQ ID NO: The CRISPR repeat sequence shown in 15, comprising a homologous sequence having at least 90% sequence identity with SEQ ID NO: 15 and retaining its biological activity, or comprising a modified sequence based on SEQ ID NO: 15 and retaining its biological activity The isolated nucleic acid molecule of the nucleic acid sequence (such as the nucleic acid sequence shown in SEQ ID NO: 19) of the single-stranded guide RNA of the modified sequence;

As an example, the nucleic acid sequence (SEQ ID NO : 9, SEQ ID NO: 10 or the nucleic acid sequence shown in SEQ ID NO: 11) isolated nucleic acid molecules, and comprising SEQ ID NO coding for the Cas12a protein, its homologue, conjugate or fusion protein : CRISPR repeat sequence shown in 16, comprising a homologous sequence having at least 90% sequence identity with SEQ ID NO: 16 and retaining its biological activity, or comprising a modified sequence based on SEQ ID NO: 16 and retaining its biological activity The isolated nucleic acid molecule of the nucleic acid sequence (such as the nucleic acid sequence shown in SEQ ID NO: 20) of the single-stranded guide RNA of the modified sequence;

As an example, the isolated nucleic acid sequence (such as the nucleic acid sequence shown in SEQ ID NO: 12) comprising the BgCas12a protein encoding the amino acid sequence shown in SEQ ID NO: 5, its homologue, conjugate or fusion protein Nucleic acid molecule, and comprising coding for this BgCas12a protein, its homologue, conjugate or fusion protein comprising the CRISPR repeat sequence shown in SEQ ID NO: 17, comprising having at least 90% sequence identity with SEQ ID NO: 17 and A homologous sequence that retains its biological activity, or a nucleic acid sequence comprising a single-stranded guide RNA that is transformed based on SEQ ID NO: 17 and that retains its biological activity (for example, the nucleic acid sequence shown in SEQ ID NO: 21 ) isolated nucleic acid molecule;

As an example, an isolated nucleic acid sequence (such as a nucleic acid sequence shown in SEQ ID NO: 13) comprising a ChCas12b protein encoding an amino acid sequence shown in SEQ ID NO: 6, a homologue thereof, a conjugate or a fusion protein thereof Nucleic acid molecule, and comprising coding for this ChCas12b albumen, its homologue, conjugate or fusion protein comprising the CRISPR repeat sequence shown in SEQ ID NO: 18, comprising having at least 90% sequence identity with SEQ ID NO: 18 and A homologous sequence that retains its biological activity, or a nucleic acid sequence comprising a single-stranded guide RNA that is transformed based on SEQ ID NO: 18 and retains its biological activity (for example, the nucleic acid sequence shown in SEQ ID NO: 22 ) isolated nucleic acid molecule.

For item 4) above:

As an example, a nucleic acid sequence (such as SEQ ID NO: 9, SEQ ID NO: 10 or the vector of the nucleic acid sequence shown in SEQ ID NO: 11), and the vector comprising SEQ ID NO: 16 encoding for the Cas12a protein, its homologue, conjugate or fusion protein The shown CRISPR repeat sequence, comprising a homologous sequence having at least 90% sequence identity with SEQ ID NO: 16 and retaining its biological activity, or comprising a modification based on SEQ ID NO: 16 and retaining its biological activity The carrier of the nucleic acid sequence (such as the nucleic acid sequence shown in SEQ ID NO: 20) of the single-stranded guide RNA of sequence;

Of course, those skilled in the art can understand that the kit of the present invention may also contain other reagents that are helpful for gene editing.

A brief description of the sequences involved in the present invention

SEQ ID NO: 1: Cas12J-8 protein sequence

SEQ ID NO: 2: Mb4Cas12a protein sequence

SEQ ID NO: 3: MlCas12a protein sequence

SEQ ID NO: 4: MoCas12a protein sequence

SEQ ID NO: 5: BgCas12a protein sequence

SEQ ID NO: 6: ChCas12b protein sequence

SEQ ID NO: 7: fusion protein comprising Cas12J-8 protein

SEQ ID NO: 8: Coding sequence of Cas12J-8 protein

SEQ ID NO: 9: Coding sequence of Mb4Cas12a protein

SEQ ID NO: 10: coding sequence of MlCas12a protein

SEQ ID NO: 11: Coding sequence of MoCas12a protein

SEQ ID NO: 12: coding sequence of BgCas12a protein

SEQ ID NO: 13: Coding sequence of ChCas12b protein

SEQ ID NO: 14: fusion protein coding sequence comprising Cas12J-8 protein

SEQ ID NO: 15: CRISPR repeat sequence used in conjunction with Cas12J-8 protein

SEQ ID NO: 16: CRISPR repeat sequence used in conjunction with Mb4Cas12a, MlCas12a and MoCas12a proteins

SEQ ID NO: 17: CRISPR repeat sequence used in conjunction with BgCas12a protein

SEQ ID NO: 18: CRISPR repeat sequence used in conjunction with ChCas12b protein

SEQ ID NO: 19: DNA sequence of CRISPR repeat sequence of single-stranded guide RNA associated with Cas12J-8 protein

SEQ ID NO: 20: DNA sequence of CRISPR repeat sequence of single-stranded guide RNA associated with Mb4Cas12a, MlCas12a, and MoCas12a proteins

SEQ ID NO: 21: DNA sequence of CRISPR repeat sequence of single-stranded guide RNA associated with BgCas12a protein

SEQ ID NO: 22: DNA sequence of CRISPR repeat sequence of single-stranded guide RNA associated with ChCas12b protein

SEQ ID NO: 23: Cas12J-4 protein sequence

SEQ ID NO: 24: Cas12J-5 protein sequence

SEQ ID NO: 25: Cas12J-7 protein sequence

SEQ ID NO: 26: Cas12J-9 protein sequence

SEQ ID NO: 27: Coding sequence of Cas12J-4 protein

SEQ ID NO: 28: Coding sequence of Cas12J-5 protein

SEQ ID NO: 29: Coding sequence of Cas12J-7 protein

SEQ ID NO: 30: Coding sequence of Cas12J-9 protein

SEQ ID NO: 31: DNA sequence of CRISPR repeat sequence used in conjunction with Cas12J-4 protein

SEQ ID NO: 32: DNA sequence of CRISPR repeat sequence used in conjunction with Cas12J-5 protein

SEQ ID NO: 33: DNA sequence of CRISPR repeat sequence used in conjunction with Cas12J-7 protein

SEQ ID NO: 34: DNA sequence of CRISPR repeat sequence used in conjunction with Cas12J-9 protein

Example

The invention will now be described with reference to the following examples which are intended to illustrate, but not limit, the invention. Those skilled in the art know that the examples provided here are only for the purpose of describing the present invention in detail, and are not intended to limit the scope of protection claimed by the present invention.

Unless otherwise indicated, the experiments and methods described in the examples were performed substantially according to conventional methods well known in the art and described in the respective references. In addition, for those not specified specific conditions in the examples, they were carried out according to conventional conditions or conditions suggested by the manufacturer. The reagents or instruments used were not indicated by the manufacturer, and they were all commercially available conventional products.

Example 1

(1) Construction of plasmid pAAV2_Cas12_ITR

According to the gene retrieval number of each Cas12 protein listed in Table 1, download its amino acid sequence, wherein the amino acid sequences of Cas12J-8 protein, Mb4Cas12a protein, MlCas12a protein, MoCas12a protein, BgCas12a protein and ChCas12b protein are respectively as SEQ ID NO: 1 To SEQ ID NO: shown in 6.

Table 1. Cas12 protein and its NCBI protein search ID and sequence number

Cas12蛋白名称Cas12 protein name	NCBI蛋白搜索IDNCBI Protein Search ID	氨基酸序列amino acid sequence
Cas12J-8Cas12J-8	无none	SEQ ID NO：1SEQ ID NO: 1
Mb4Cas12aMb4Cas12a	WP_078273923.1WP_078273923.1	SEQ ID NO：2SEQ ID NO: 2
M1Cas12aM1Cas12a	WP_065256572.1WP_065256572.1	SEQ ID NO：3SEQ ID NO: 3
MoCas12aMoCas12a	WP_112744621.1WP_112744621.1	SEQ ID NO：4SEQ ID NO: 4
BgCas12aBgCas12a	OLA11341.1OLA11341.1	SEQ ID NO：5SEQ ID NO: 5
ChCas12bChCas12b	OQB30769OQB30769	SEQ ID NO：6SEQ ID NO: 6

The coding nucleic acid sequences of the above Cas12 proteins were codon-optimized to obtain the gene sequences of the highly expressed Cas12 proteins in human cells. Cas12J-8 protein,

The optimized gene sequences of Mb4Cas12a protein, MlCas12a protein, MoCas12a protein, BgCas12a protein and ChCas12b protein are respectively shown in SEQ ID NO: 8 to SEQ ID NO: 13.

The highly expressed gene sequences of each Cas12 protein obtained above from SEQ ID NO: 8 to SEQ ID NO: 13 were gene synthesized and constructed on the slugCas9 backbone plasmid (Addgene platform, catalog #163793) to obtain the plasmid pAAV2_Cas12_ITR.

(2-1) Construction of plasmid Cas12J-8-PSK-u6-crRNA

The pBluescriptSKII+U6-sgRNA(F+E)empty plasmid (Addgene platform, commercially available, catalog #74707) was digested with BbsI and XhoI restriction endonucleases. The digestion system was: 1 μg plasmid psk-BbsI - Sasg, 5 μL 10×CutSmart buffer (purchased from NEB Company), 1 μL BbsI and 1 μL XhoI restriction endonuclease (purchased from NEB Company), and make up to 50 μL with water. The enzyme cleavage system was reacted at 37° C. for 1 hour.

Then, the digested products were electrophoresed on 1% agarose gel at 120V for 30min.

The 3296bp DNA fragment was excised from the agarose gel, recovered with a gel recovery kit (Tiangen Biochemical Technology (Beijing) Co., Ltd., DP209) according to the instructions provided by the manufacturer, and finally eluted with ultrapure water.

According to the repeat sequence on the Cas12j-8 protein genome (its DNA sequence is SEQ ID NO: 19), the repeat sequence is gene-synthesized and constructed on the linearized pBluescriptSKII+U6-sgRNA(F+E)empty backbone, The plasmid Cas12J-8-PSK-u6-crRNA was obtained.

(2-2) Construction of plasmid psk-BbsI-Cas12a-crRNA1

The pBluescriptSKII+U6-sgRNA(F+E)empty plasmid was digested with BbsI and XhoI restriction enzymes. The enzyme digestion system was: 1 μg plasmid psk-BbsI-Sasg, 5 μL 10×CutSmart buffer (purchased from NEB Company), 1 μL BbsI and 1 μL XhoI restriction endonuclease (purchased from NEB Company), and make up to 50 μL with water. The enzyme cleavage system was reacted at 37° C. for 1 hour.

According to the repeat on the Cas12a protein genome, the truncated repeat sequences (the DNA sequences of which are respectively SEQ ID NO: 20 and SEQ ID NO: 21) were gene synthesized and constructed in linearized pBluescriptSKII+U6-sgRNA (F+ E) On the empty backbone, the plasmid psk-BbsI-Cas12a-crRNA1 is obtained.

(2-3) Construction of plasmid hU6-OQB30769_tracr-Bsa1

The pX330_sgACTA2 plasmid (Addgene platform, catalog #63712) was digested with BsaI and NotI restriction endonucleases. The enzyme digestion system was: 1 μg plasmid hU6-sa-tracr-BsaI, 5 μL 10×CutSmart buffer (purchased at NEB Company), 1 μL BsaI and 1 μL NotI restriction endonuclease (purchased from NEB Company), and make up to 50 μL with water. The enzyme cleavage system was allowed to react at 37°C for 3 hours.

The 2998bp DNA fragment was excised from the agarose gel, recovered with a gel recovery kit (Tiangen Biochemical Technology (Beijing) Co., Ltd., DP209) according to the instructions provided by the manufacturer, and finally eluted with ultrapure water.

Find out the repeat and tracr on the genome according to the genome of ChCas12b, deduce its RNA Scaffold sequence (its DNA sequence is SEQ ID NO: 22) according to the secondary structure, carry out gene synthesis on this sequence, and construct it in the linearized hU6- On the sa-tracr-BsaI backbone, the plasmid hU6-OQB30769_tracr-Bsa1 was obtained.

(3) Construction of plasmid pAAV2_Cas12-hU6-sgRNA_ITR vector

The pAAV2_Cas12_ITR plasmid expressing Cas12 protein in (1) and the Cas12J-8-PSK-u6-crRNA, psk-BbsI-Cas12a-crRNA1 and hU6-OQB30769_tracr-Bsa1 plasmids expressing the corresponding sgRNA of each protein in (2) were linearized by PCR method .

For the pAAV2_Cas12_ITR plasmid, the primer sequences are:

ATCATGGGAAATAGGCCCTCAGGTACCTCCCCAGCATGC; and

CGAGGGGGGGCCCGGTACATCATGGGAAATAGGCCCTC;

For the Cas12J-8-PSK-u6-crRNA, psk-BbsI-Cas12a-crRNA1 and hU6-OQB30769_tracr-Bsa1 plasmids, the primer sequences are:

GAGGGCCTATTTCCCATGAT; and

GTACCGGGCCCCCCCTCG.

The reaction system is as follows:

The PCR running procedure is as follows:

The PCR product was electrophoresed on 1% agarose gel with 120V voltage for 30min, and the gel recovery kit was used to purify the target DNA fragment according to the steps provided by the manufacturer, and the DNA concentration was measured with a NanoDrop ^TM Lite spectrophotometer (Thermo Scientific). Store at -20°C for long-term storage.

The linearized pAAV2_Cas12_ITR fragment and the linearized Cas12J-8-PSK-u6-crRNA, psk-BbsI-Cas12a-crRNA1 and hU6-OQB30769_tracr-Bsa1 fragments were homologously recombined according to the ratio required by the instructions. The homologous recombination enzyme used was

High-fidelity DNA Assembly Master Mix (NEB), the reaction system is as follows:

The reaction conditions are as follows:

Add the ligation product to Escherichia coli DH5α competent cells (purchased from Shanghai Weidi Biotechnology Co., Ltd.), incubate on ice for 30 min, heat shock at 42°C for 1 min, incubate on ice for 2 min, add 900 μL LB medium, and incubate at 37°C 1 hour for the activation and recovery of Escherichia coli DH5α competent cells.

The recovered Escherichia coli DH5α competent cells were spread on LB solid plates containing ampicillin resistance and cultured upside down in a 37°C incubator, and the obtained Escherichia coli DH5α monoclonals were verified by Sanger sequencing.

Shake the E. coli DH5α clone that has been correctly connected by sequencing, and extract the plasmid to obtain the plasmid pAAV2_Cas12-hU6-sgRNA_ITR for future use.

(4) Preparation of linearized plasmid pAAV2_Cas12-hU6-sgRNA_ITR

Each plasmid pAAV2_Cas12-hU6-sgRNA_ITR prepared in (3) was digested with BbsI restriction endonuclease. The digestion system was: 1 μg plasmid pAAV2_Cas12-hU6-sgRNA_ITR, 5 μL 10×CutSmart buffer (purchased from NEB Company ), 1 μL BbsI restriction endonuclease (purchased from NEB Company), and water to make up to 50 μL. The enzyme cleavage system was reacted at 37° C. for 1 hour.

DNA fragments were excised from the agarose gel, recovered with a gel recovery kit (Tiangen Biochemical Technology (Beijing) Co., Ltd., DP209) according to the instructions provided by the manufacturer, and finally eluted with ultrapure water. The DNA fragment is the linearized plasmid pAAV2_Cas12-hU6-sgRNA_ITR comprising the coding gene of each Cas12 protein above, and its size is respectively 7135bp (Cas12J-8 protein), 7866bp (Mb4Cas12a protein), 7875bp (MlCas12a protein), 7998bp ( MoCas12a protein), 7875bp (BgCas12a) and 8606bp (ChCas12b).

The DNA concentration of the recovered linearized plasmid pAAV2_Cas12-hU6-sgRNA_ITR was measured with a NanoDrop ^TM Lite spectrophotometer (Thermo Scientific), and stored at -20°C for long-term storage.

(5) Preparation of plasmid pAAV2_Cas12-hU6-sgRNA_ITR

Each gRNA was designed, and its sequence is shown in Table 2. Add cohesive end sequences corresponding to both sides of the linearized plasmid pAAV2_Cas12-hU6-sgRNA_ITR to the sense strand and antisense strand of each designed gRNA sequence pair, and synthesize two oligonucleotide single-stranded DNAs. The specific sequence of the oligonucleotide single-stranded DNA is also shown in the table below.

The oligonucleotides are annealed to single-stranded DNA to obtain double-stranded DNA. The annealing reaction system is: 1 μL 100 μM oligo-F, 1 μL 100 μM oligo-R, 28 μL water. After shaking and mixing the annealing system, place it in a PCR instrument to run the annealing program, the annealing program is: 95°C_5min, 85°C_1min, 75°C_1min, 65°C_1min, 55°C_1min, 45°C_1min, 35°C_1min, 25°C_1min, 4°C storage, cooling rate 0.3°C/s. After annealing, the resulting product was ligated to the linearized pAAV2_Cas12-hU6-sgRNA_ITR plasmid obtained in step (2) by DNA ligase (purchased from NEB Company).

Take 1 μL of the obtained ligation product and add it to Escherichia coli DH5α competent cells (purchased from Shanghai Weidi Biotechnology Co., Ltd.), incubate on ice for 30 min, heat shock at 42°C for 1 min, and incubate on ice for 2 min, add 900 μL LB medium, and incubate at 37 Cultivate at ℃ for 1 hour to activate and recover Escherichia coli DH5α competent cells.

The revived E. coli DH5α competent cells were spread on the LB solid plate containing the corresponding resistance and cultured upside down in a 37°C incubator, and the obtained E. coli DH5α monoclonal was verified by Sanger sequencing.

Shake the Escherichia coli DH5α clone with correct connection after sequencing verification, extract the plasmid, and obtain the plasmid pAAV2_Cas12-hU6-sgRNA_ITR containing the expression target sgRNA sequence, for future use.

(6) Transfection of HEK293T cell line with plasmid pAAV2_Cas12-hU6-sgRNA_ITR expressing Cas protein and sgRNA

On day 0, according to the needs of transfection, HEK293T cells containing the target sequence were plated in a 6-well plate, and the cell density was about 30%.

On day 1, transfection was performed, and the transfection process was as follows:

Take 2 μg of the plasmid to be transfected, pAAV2_Cas12-hU6-sgRNA_ITR, and add it to 100 μL of Opti-MEM medium (purchased from Gibco), and gently blow and mix.

liposome transfection reagent

2000 (purchased from Invitrogen) or polyethyleneimine (hereinafter referred to as PEI) (purchased from polysciences) flicked and mixed, pipette 5 μL

2000 or PEI was added to 100 μL of Opti-MEM medium (purchased from Gibco), mixed gently, and allowed to stand at room temperature for 5 minutes.

Mix the diluted transfection reagent and the diluted plasmid, gently pipette and mix, let stand at room temperature for 20min, then add to the culture medium containing HEK293T cells to be transfected, and then place the cells at 37°C, 5% CO ₂ Continue culturing for 3 days in the incubator.

(7) Preparation of next-generation sequencing library

HEK293T cells were collected three days after editing, and genomic DNA was extracted with a DNA kit (Tiangen Biochemical Technology (Beijing) Co., Ltd., DP304) according to the instructions provided by the DNA kit.

Perform the first round of PCR for PCR library construction, and use 2×Q5Mastermix for PCR reaction. The PCR primers are as follows:

Table 3. A list of PCR primers for next-generation sequencing

The reaction system is as follows:

The PCR running procedure is as follows:

Carry out the second round of PCR for sequencing library construction, and use 2xQ5Mastermix for PCR reaction. The PCR primers are as follows:

F2 primers:

R2 primer:

The reaction system is as follows:

The PCR running procedure is as follows:

Use the gel recovery kit for the second round of PCR products to purify DNA fragments of 330bp, 327bp, 279bp, 239bp, 311bp and 298bp according to the steps provided by the manufacturer, wherein 330bp and 327bp are the sizes of A1 and A7 respectively, 279bp and 239bp are the sizes of E2 and E3 sites, respectively, and 311bp and 298bp are the sizes of A3 and A4 sites, respectively. Thus, the preparation of the next-generation sequencing library is completed.

(8) Analysis of next-generation sequencing results

The prepared next-generation sequencing library was subjected to paired-end sequencing on the high-throughput sequencer HiseqXTen (illumina).

The editing efficiencies of the two target sites calculated by the next-generation sequencing are shown in Figures 1 to 6, wherein the X-axis represents the target site, and the Y-axis represents the editing efficiency (Indels%). It can be seen from the figure that the gene editing system containing Cas12J-8, Mb4Cas12a, MoCas12a, BgCas12a, MlCas12a and ChCas12b proteins can be used for cell gene editing, and the editing activity of the gene editing system containing Cas12J-8 protein is compared with that of The existing gene editing system of Cas12J-2 protein is higher.

Example 2

(1) Construction of plasmid pAAV2_Cas12_ITR

According to the gene retrieval number of each Cas12 protein listed in Table 1 above, download its amino acid sequence information, wherein the amino acid sequences of Cas12J-8 protein, Mb4Cas12a protein, MICas12a protein, MoCas12a protein, BgCas12a protein and ChCas12b protein are respectively as SEQ ID NO: 1 to SEQ ID NO: shown in 6.

Codon optimization was carried out on the coding nucleic acid sequence of the Cas12 protein obtained above to obtain the gene sequence of the Cas protein highly expressed in human cells. The gene sequences of Cas12J-8 protein, Mb4Cas12a protein, MlCas12a protein, MoCas12a protein, BgCas12a protein protein and ChCas12b are shown in SEQ ID NO: 8 to SEQ ID NO: 13 respectively.

The highly expressed gene sequences of each Cas protein obtained above from SEQ ID NO: 8 to SEQ ID NO: 13 were gene synthesized and constructed into the slugCas9 backbone plasmid

(Addgene platform, catalog #163793), the plasmid pAAV2_Cas12_ITR was obtained.

(2-1) Construction of plasmid Cas12J-8-PSK-u6-crRNA

The pBluescriptSKII+U6-sgRNA(F+E)empty plasmid (Addgene platform, commercially available, catalog #74707) was digested with BbsI and XhoI restriction endonucleases. The digestion system was: 1 μg plasmid psk-BbsI -Sasg, 5 μL 10×CutSmart buffer (purchased from NEB Company), 1 μL BbsI and 1 μL XhoI restriction endonuclease (purchased from NEB Company), and make up to 50 μL with water. The enzyme cleavage system was reacted at 37° C. for 1 hour.

(2-2) Construction of plasmid psk-BbsI-Cas12a-crRNA1

The pBluescriptSKII+U6-sgRNA(F+E)empty plasmid was digested with BbsI and XhoI restriction enzymes. The enzyme digestion system was: 1 μg plasmid psk-BbsI-Sasg, 5 μL 10×CutSmart buffer (purchased from NEB Company), 1 μL BbsI and 1 μL XhoI restriction endonuclease (purchased from NEB Company), and make up to 50 μL with water. The enzyme cleavage system was allowed to react at 37°C for 1 hour.

(2-3) Construction of plasmid hU6-OQB30769_tracr-Bsa1

(3) Construction of plasmid pAAV2_Cas12-hU6-sgRNA_ITR vector

For the pAAV2_Cas12_ITR plasmid, the primer sequences are:

ATCATGGGAAATAGGCCCTCAGGTACCTCCCCAGCATGC; and

CGAGGGGGGGCCCGGTACATCATGGGAAATAGGCCCTC;

GAGGGCCTATTTCCCATGAT; and

GTACCGGGCCCCCCCTCG.

The reaction system is as follows:

The PCR running procedure is as follows:

High-fidelity DNA Assembly Master Mix (NEB), the reaction system is as follows:

The reaction conditions are as follows:

(4) Preparation of linearized plasmid pAAV2_Cas12-hU6-sgRNA_ITR

Each plasmid pAAV2_Cas12-hU6-sgRNA_ITR prepared in (3) was digested and linearized with BbsI restriction endonuclease. The enzyme digestion system was: 1 μg plasmid pAAV2_Cas12-hU6-sgRNA_ITR, 5 μL 10xCutSmart buffer (purchased from NEB Company ), 1 μL BbsI restriction endonuclease (purchased from NEB Company), and water to make up to 50 μL. The enzyme cleavage system was reacted at 37° C. for 1 hour.

DNA fragments were excised from the agarose gel, recovered with a gel recovery kit (Tiangen Biochemical Technology (Beijing) Co., Ltd., DP209) according to the instructions provided by the manufacturer, and finally eluted with ultrapure water. The DNA fragment is the linearized plasmid pAAV2_Cas12_ITR comprising the coding gene of each Cas protein above, and its size is respectively 7135bp (Cas12J-8 protein), 7866bp (Mb4Cas12a protein), 7875bp (MlCas12a protein), 7998bp (MoCas12a protein), 7875bp (BgCas12a) and 8606bp (ChCas12b).

The DNA concentration of the recovered linearized plasmid pAAV2_Cas12-hU6-sgRNA_ITR was measured with a NanoDrop ^TM Lite spectrophotometer NanoDrop (Thermo Scientific), and stored at -20°C for long-term storage.

(5) Preparation of plasmid pAAV2_Cas12-U6-on target sgRNA or pAAV2_Cas12-U6-mismatch sgRNA

Design the sequences of each on target gRNA and mismatch gRNA, and their corresponding oligonucleotide single-stranded DNAs are shown in Table 4 below, where mismatch bases are shown as underlined bold bases in the sequence listing.

Anneal the oligonucleotide single-stranded DNA corresponding to the obtained on target gRNA and the oligonucleotide single-stranded DNA corresponding to different mismatch gRNAs respectively. The annealing reaction system is: 1 μL 100 μM oligo-F, 1 μL 100 μM oligo-R, 28 μL water. After shaking and mixing the annealing system, place it in a PCR instrument to run the annealing program; the annealing program is as follows: 95°C_5min, 85°C_1min, 75°C_1min, 65°C_1min, 55°C_1min, 45°C_1min, 35°C_1min, 25°C_1min, 4°C storage, cooling rate 0.3°C/s. After annealing, the obtained products were respectively ligated to the obtained linearized pAAV2_Cas12-hU6-sgRNA_ITR plasmid by DNA ligase (purchased from NEB Company).

Take 1 μL of the obtained ligation product and add it to E. coli DH5α competent cells (purchased from Shanghai Weidi Biotechnology Co., Ltd.), incubate on ice for 30 min, heat shock at 42°C for 1 min, incubate on ice for 2 min, add 900 μL LB medium, and incubate at 37°C After culturing for 1 h, the Escherichia coli DH5α competent cells were activated and recovered.

Shake the Escherichia coli DH5α clone that is connected correctly by sequencing, extract the plasmid, and obtain the plasmid pAAV2_Cas12-hU6-on target gRNA expressing the above-mentioned on target gRNA sequence and the plasmid pAAV2_Cas12-hU6-mismatch gRNA expressing the above-mentioned different mismatch gRNA sequences, respectively, spare.

(7) The obtained plasmid pAAV2_Cas12-hU6-on target gRNA expressing the on target gRNA sequence and the plasmid pAAV2_Cas12-U6-mismatch gRNA expressing the mismatch gRNA sequence were respectively transfected into GFP containing the target sequence (GGATATGTTGAAGAACACCATGAC) by liposome Reporter system HEK293T cell line.

The HEK293T cell line of the GFP reporter system containing the target sequence is obtained by inserting a PAM sequence and a specific target sequence between the initiation codon ATG and the GFP coding sequence, causing a GFP frameshift mutation, and then by slowly The virus infection was integrated into HEK293T cells, and the HEK293T cell line containing the GFP reporter system containing the target sequence was obtained. When the gene editing system cuts the target sequence, the cells will restore the GFP reading frame through the self-repair system to generate green fluorescence. The editing ability and specificity of the gene editing system can be evaluated by counting the ratio of GFP positive cells by flow cytometry.

Above-mentioned transfection process comprises the following steps:

On day 0, according to the requirements of transfection, the GFP reporter system HEK293T cell line containing the target sequence was plated on a 6-well plate, and the cell density was controlled at 30%.

The GFP reporter system HEK293T cell line containing the target sequence contains the nucleotide sequence of CMV-ATG-PAM-target site-GFP, wherein, wherein the PAM sequence is shown in Figure 7 to Figure 13, the sequence of the target site (target site) For GGATATGTTGAAGAACACCATGAC.

Add 2 μg of the plasmid pAAV2_Cas12-U6-on target gRNA to be transfected or 2 μg of the plasmid pAAV2_Cas12-U6-mismatch gRNA to be transfected into 100 μL Opti-MEM medium (purchased from Gibco), and gently blow and mix.

Will

2000 (purchased from Invitrogen) or PEI (purchased from polysciences) flick to mix, pipette 5 μL

2000 or PEI was added to 100 μL Opti-MEM medium, mixed gently, and allowed to stand at room temperature for 5 minutes.

The diluted plasmid and the diluted transfection reagent were mixed, gently blown and mixed, and the resulting mixture was allowed to stand at room temperature for 20 minutes, then added to the culture medium of the GFP reporter system HEK293T cell line containing the target sequence, and It was placed in a 37°C, 5% CO ₂ incubator to continue culturing.

The flow cytometric analysis technology analyzes the editing efficiency and off-target rate of the CRISPR gene editing system of the present invention on the target sequence.

Specifically, the HEK293T cell line cultured in a CO ₂ incubator for 3 days was collected, its specificity was detected by flow cytometry (BD Biosciences FACSCalibur), and the positive ratio of GFP was analyzed and plotted by FlowJo analysis software.

The specific detection results of the CRISPR/Cas12 gene editing system of the present invention in the GFP reporter system HEK293T cell line containing the target sequence are shown in Figures 7 to 13, wherein the upper bar shows the schematic diagram of the GFP reporter system, and the start codon ATG A specific PAM sequence and target sequence are inserted between the GFP coding sequence, resulting in GFP frameshift mutation. Therefore, when the gene editing system cuts the target sequence, the cells will restore the GFP reading frame through the self-repair system of the cells, resulting in green fluorescence. The Y-axis in the lower histograms in Figure 7 to Figure 13 represents the percentage (%) of GFP-positive cells, and the X-axis represents the oligonucleotide single-stranded DNA sequence corresponding to On-target gRNA and mismatch gRNA. It can be seen from Figures 7 to 13 that the CRISPR gene editing system of the present invention edited all target sites in the GFP reporter system HEK293T cell line, and the proportion of gene editing mediated by mismatch gRNA was significantly lower than that of on -target gRNA-mediated gene editing ratio, thus indicating that the CRISPR gene editing system of the present invention has high editing activity, low off-target rate, and high specificity. And in the research results of the CRISPR/Cas12J-8 gene editing system, no obvious mismatches were found in the first 14bp single base mismatch, indicating that the CRISPR/Cas12J-8 gene editing system has complete compatibility between the gRNA and the target sequence. The pairing requirements are extremely high, with a low fault tolerance rate and high security for practical applications.

Example 3

(1) Preparation of linearized plasmid SlugABEmax

Use the SlugABEmax plasmid (Addgene platform, catalog#163798) as a template for PCR reaction, and the primer sequence is:

Primer 1: TCTGGTGGTTTCTCCCAAGAAGA

Primer 2: TGACCCCCCGCTGCTGCCCC

The reaction system is as follows:

The PCR running procedure is as follows:

The PCR product was electrophoresed on a 1% agarose gel with a voltage of 120V for 30min, and a DNA fragment of 4152bp was purified with a gel recovery kit according to the steps provided by the manufacturer, and the DNA concentration was measured with a NanoDrop ^™ Lite spectrophotometer (Thermo Scientific). Or store at -20°C for long-term storage.

(2) Preparation of plasmid pAAV2_envTadA-Cas12J-8_ITR

Homologous recombination was performed on the linearized SlugABEmax backbone fragment and the humanized Cas12J-8 fragment (SEQ ID NO: 8) synthesized by the company according to the ratio required by the instructions. The homologous recombination enzyme used was

High-fidelity DNA Assembly Master Mix (NEB), the reaction system is as follows:

The reaction conditions are as follows:

Shake the E. coli DH5α clone that has been correctly connected by sequencing, and extract the plasmid to obtain the plasmid pAAV2_envTadA-Cas12J-8_ITR for future use.

(3) Preparation of plasmid pAAV2_envTadA-dCas12J-8_ITR

Carry out circular PCR reaction with pAAV2_envTadA-Cas12J-8_ITR as template, the primer sequence is:

Primer 3: CAACCTGGTGAAAAAGAACAACTTC

Primer 4: GCGATGCCGATCACATCGCACA

The reaction system is as follows:

The PCR running procedure is as follows:

The PCR product was electrophoresed at 120V for 30 min on a 1% agarose gel, and a DNA fragment of 6305 bp was purified using a gel recovery kit according to the steps provided by the manufacturer, and the DNA concentration was measured with a NanoDrop ^™ Lite spectrophotometer (Thermo Scientific), and T4 PNK treatment and T4 DNA ligase treatment were carried out respectively, and the reaction system was as follows:

The reaction conditions are as follows:

Add 1 μL of T4 DNA ligase (NEB) to the reaction system, shake and mix well, and incubate at room temperature for 2 h.

Shake the E. coli DH5α clone that has been correctly connected by sequencing, and extract the plasmid to obtain the plasmid pAAV2_envTadA-dCas12J-8_ITR for future use.

(5) Linearization preparation of pAAV2_envTadA-dCas12J-8_ITR

The pAAV2_envTadA-dCas12J-8_ITR plasmid was digested with Kpn1 and Not1 restriction enzymes (NEB), and the reaction system was: 2 μg plasmid pAAV2_envTadA-dCas12J-8_ITR, 5 μL 10×CutSmart buffer (purchased from NEB Company), 1 μL Kpn1 restriction endonuclease (purchased from NEB Company), 1 μL Not1 restriction endonuclease (purchased from NEB Company), water to make up to 50 μL. The enzyme cleavage system was allowed to react at 37°C for 2 hours.

DNA fragments were excised from the agarose gel, recovered with a gel recovery kit (Tiangen Biochemical Technology (Beijing) Co., Ltd., DP209) according to the instructions provided by the manufacturer, and finally eluted with ultrapure water.

The DNA concentration of the recovered linearized fragment pAAV2_envTadA-dCas12J-8_ITR was measured with a NanoDrop ^TM Lite spectrophotometer (Thermo Scientific), and stored at -20°C for long-term storage.

(6) Preparation of pAAV2_envTadA-dCas12J-8-crRNA_ITR plasmid

Using Cas12J-8-PSK-u6-crRNA as a template for PCR reaction, the primer sequence is:

Primer 5: GGAGGTACCGATCCGACGCGCCATCTCTAG

Primer 6: CCTGCGGCCGCGGGCCCCCCCTCGAAAAAAAAAAC

The reaction system is as follows:

The PCR running procedure is as follows:

The PCR product was electrophoresed on 1.5% agarose gel with a voltage of 120V for 30min, and the gel recovery kit was used to purify the Cas12J-8 crRNA DNA fragment of 394bp according to the steps provided by the manufacturer, which was measured with a NanoDrop ^TM Lite spectrophotometer (Thermo Scientific) DNA concentration, spare or store at -20°C for long-term storage.

The linearized pAAV2_envTadA-dCas12J-8_ITR fragment and the Cas12J-8crRNA fragment were subjected to homologous recombination according to the ratio required by the instructions, and the homologous recombination enzyme used was

High-fidelity DNA Assembly Master Mix (NEB), the reaction system is as follows:

The reaction conditions are as follows:

Shake the E. coli DH5α clone that has been correctly connected by sequencing, and extract the plasmid to obtain the plasmid pAAV2_envTadA-dCas12J-8-crRNA_ITR for future use.

(7) Preparation of plasmid pAAV2_envTadA-dCas12J-8-sgRNA_ITR

The pAAV2_envTadA-dCas12J-8-crRNA_ITR plasmid was digested with BbsI restriction endonuclease, and the digestion system was: 2 μg plasmid pAAV2_envTadA-dCas12J-8-crRNA_ITR, 5 μL 10×CutSmart buffer (purchased from NEB Company), 1 μL BbsI restriction endonuclease (purchased from NEB Company), water to make up to 50 μL. The enzyme cleavage system was allowed to react at 37°C for 2 hours.

The DNA concentration of the recovered linearized plasmid pAAV2_envTadA-dCas12J-8-crRNA_ITR was measured with a NanoDrop ^TM Lite spectrophotometer (Thermo Scientific), and stored at -20°C for long-term storage.

The endogenous site target sequence that meets the PAM requirements of the Cas12J-8 protein is randomly selected in the human genome, and the corresponding oligonucleotide single-stranded DNA is shown in the table below.

The oligonucleotides are annealed to single-stranded DNA to obtain double-stranded DNA. The annealing reaction system is: 1 μL 100 μM oligo-F, 1 μL 100 μM oligo-R, 28 μL water. After shaking and mixing the annealing system, place it in a PCR instrument to run the annealing program, the annealing program is: 95°C_5min, 85°C_1min, 75°C_1min, 65°C_1min, 55°C_1min, 45°C_1min, 35°C_1min, 25°C_1min, 4°C storage, cooling rate 0.3°C/s. After annealing, the resulting product was ligated to the linearized pAAV2_envTadA-dCas12J-8-crRNA_ITR vector by DNA ligase (purchased from NEB Company).

Shake the E. coli DH5α clone that has been correctly connected by sequencing, extract the plasmid, and obtain the plasmid pAAV2_envTadA-dCas12J-8-crRNA-gRNA_ITR that expresses the target sgRNA sequence for future use.

(8) Transfection of wild-type HEK293T cell line with pAAV2_envTadA-dCas12J-8-crRNA-gRNA_ITR plasmid

The resulting pAAV2_envTadA-dCas12J-8-crRNA-gRNA_ITR plasmids were transfected into wild-type HEK293T cell lines by liposomes.

Above-mentioned transfection process comprises the following steps:

On day 0, HEK293T cell lines were plated in 6-well plates according to transfection requirements, and the cell density was controlled at 30%.

Take 2 μg of the plasmid to be transfected, pAAV2_envTadA-dCas12J-8-crRNA-gRNA_ITR, and add it to 100 μL of Opti-MEM medium (purchased from Gibco), and gently mix by pipetting.

Will

Mix the diluted plasmid and the diluted transfection reagent, gently blow and mix, and let the resulting mixture stand at room temperature for 20 minutes, then add it to the culture medium for transfecting HEK293T cells, and place it at 37°C, Continue culturing for 7 days in a 5% CO ₂ incubator.

(9) Preparation of next-generation sequencing library

HEK293T cells seven days after editing were collected, and genomic DNA was extracted with a DNA kit (Tiangen Biochemical Technology (Beijing) Co., Ltd., DP304) according to the instructions provided by the DNA kit.

Carry out the first round of PCR for PCR library construction, and use 2×Q5Mastermix for PCR reaction. The PCR primers are shown in the table below:

Table 6: List of PCR primers for each endogenous site

The reaction system is as follows:

The PCR running procedure is as follows:

The second round of PCR for PCR library construction was carried out, and 2×Q5 Mastermix was used for PCR reaction, and the PCR primers were the same as the F2 primers and R2 primers given in Example 1 above.

The reaction system is as follows:

The PCR running procedure is as follows:

The second-round PCR product was purified with a gel recovery kit according to the steps provided by the manufacturer to purify the DNA fragment, and thus the next-generation sequencing library was prepared.

(10) Analysis of next-generation sequencing results

The next-generation sequencing results were calculated to obtain the editing ratio of adenine A that meets the editing requirements in each endogenous site target site, and the results are shown in FIG. 14 . It can be seen from the figure that the Cas12J-8ABE base editor has successfully edited these several endogenous site target sites, and only 938 cells containing the Cas12J-8ABE base editor protein A single amino acid can be easily packaged by AAV virus, thus making it possible to apply the CRISPR single base editor system in gene therapy of organisms.

Example 4

(1) Construction of plasmid pAAV2_Cas12_ITR

The amino acid sequences of Cas12J-4, Cas12J-5, Cas12J-7, Cas12J-8 and Cas12J-9 proteins are shown in the sequence table at the end of the text (respectively as shown in SEQ ID NO: 23-25, 1 and 26).

The coding nucleic acid sequence of each Cas12 protein is codon-optimized, and the gene sequence of the Cas12 protein highly expressed in human cells is obtained. The gene sequences of Cas12J-4, Cas12J-5, Cas12J-7, Cas12J-8 and Cas12J-9 proteins are shown in SEQ ID NO: 27-29, 8 and 30 respectively.

The highly expressed gene sequences of Cas12 proteins obtained above as shown in SEQ ID NO: 27-29, 8 and 30 were gene-synthesized, and respectively constructed on the slugCas9 backbone plasmid (Addgene platform, catalog#163793) to obtain each plasmid pAAV2_Cas12_ITR.

(2) Construction of plasmid Cas12J-PSK-u6-crRNA

The pBluescriptSKII+ U6-sgRNA(F+E)empty plasmid (Addgene platform, commercially available, catalog #74707) was digested with BbsI and XhoI restriction endonucleases. The enzyme digestion system was: 1 μg plasmid psk-BbsI- Sasg, 5 μL 10×CutSmart buffer (purchased from NEB Company), 1 μL BbsI and 1 μL XhoI restriction endonuclease (purchased from NEB Company), make up to 50 μL with water. The enzyme cleavage system was reacted at 37° C. for 1 hour.

According to the repeat sequence on Cas12J-4, Cas12J-5, Cas12J-7, Cas12J-8 and Cas12J-9 protein genome (its DNA sequence is shown by SEQ ID NO:31 to 33, 19 and 34 respectively), this repeat The sequence was gene synthesized, and constructed on the linearized pBluescriptSKII+ U6-sgRNA(F+E)empty backbone to obtain each plasmid Cas12J-PSK-u6-crRNA.

(3) Construction of plasmid pAAV2_Cas12-hU6-sgRNA_ITR vector

The pAAV2_Cas12_ITR plasmid expressing Cas12 protein in (1) and the Cas12J-PSK-u6-crRNA plasmid expressing sgRNA corresponding to each protein in (2) were linearized by PCR method.

For the pAAV2_Cas12_ITR plasmid, the primer sequences are:

ATCATGGGAAATAGGCCCTCAGGTACCTCCCCAGCATGC; and

CGAGGGGGGGCCCGGTACATCATGGGAAATAGGCCCTC;

For the Cas12J-PSK-u6-crRNA plasmid, the primer sequences are:

GAGGGCCTATTTCCCATGAT: and

GTACCGGGCCCCCCCTCG.

The reaction system is as follows:

The PCR running procedure is as follows:

The linearized pAAV2_Cas12_ITR fragment and the linearized Cas12J-PSK-u6-crRNA fragment were homologously recombined according to the ratio required by the instructions, and the homologous recombination enzyme used was

High-fidelity DNA Assembly Master Mix (NEB), the reaction system is as follows:

The reaction conditions are as follows:

The Escherichia coli DH5α clone with correct connection verified by sequencing was shaken, and the plasmid was extracted to obtain each plasmid pAAV2_Cas12-hU6-sgRNA_ITR for future use.

(4) Preparation of linearized plasmid pAAV2_Cas12-hU6-sgRNA_ITR

DNA fragments were excised from the agarose gel, recovered with a gel recovery kit (Tiangen Biochemical Technology (Beijing) Co., Ltd., DP209) according to the instructions provided by the manufacturer, and finally eluted with ultrapure water. The DNA fragment is the linearized plasmid pAAV2_Cas12_ITR comprising the coding genes of the above Cas proteins.

(5) Preparation of plasmid pAAV2_Cas12-hU6-sgRNA_ITR

Design gRNA (GGAUAUGUUGAAGAACACCAUGAC), and add cohesive end sequences corresponding to both sides of the linearized plasmid pAAV2_Cas12-hU6-sgRNA_ITR on the sense strand and antisense strand of the designed gRNA sequence, and synthesize two oligonucleotide single strands DNA, the specific sequence of these two oligonucleotide single-stranded DNA is as follows:

Oligo-F: GGATATGTTGAAGAACACCATGAC

Oligo-R: GTCATGGTGTTCTTCAACATATCC

Among them, the cohesive ends of Oligo-F for Cas12J-4, Cas12J-5, Cas12J-7, Cas12J-8, and Cas12J-9 are CGAC, GGAC, AGAC, AGAC, and AGAC, respectively, and Oligo-R for all Cas12 proteins The cohesive ends of both are AAAA.

(6) The obtained plasmid pAAV2_Cas12-hU6-sgRNA_ITR expressing the gRNA sequence was transfected into the GFP reporter system HEK293T cell line library containing the target sequence (GGATATGTTGAAGAACACCATGAC) by liposome.

The GFP reporter system HEK293T cell line library containing the target sequence is obtained in the following manner: a 5bp random sequence (as a PAM sequence) and a 24bp protospacer (as a target sequence) are inserted between the initiation codon ATG and the GFP coding sequence ), resulting in GFP frameshift mutation and no expression. The GFP gene containing the insert was driven by the CMV promoter and constructed on a lentiviral expression vector. This sequence is randomly inserted into the genome of HEK293T cells by lentivirus, making it a stable GFP reporter cell line library. When the gene editing system is used to cut the target sequence, the cells will restore the GFP reading frame through the self-repair system to generate green fluorescence, and the editing ability and specificity of the gene editing system can be evaluated by counting the ratio of GFP positive cells by flow cytometry .

Above-mentioned transfection process comprises the following steps:

On day 0, according to the requirements of transfection, the GFP reporter system HEK293T cell line library containing the target sequence was plated on a 6-well plate, and the cell density was controlled at 30%.

The GFP reporter system HEK293T cell line library containing the target sequence comprises the nucleotide sequence of CMV-ATG-PAM-target site-GFP, wherein the PAM sequence is a 5bp random sequence, and the sequence of the target site (target site) is GGATATGTTGAAGAACACCATGAC (FIG. 15).

Will

The diluted plasmid and the diluted transfection reagent were mixed, gently blown and mixed, and the resulting mixture was allowed to stand at room temperature for 20 minutes, and then added to the culture medium of the GFP reporter system HEK293T cell line library containing the target sequence, and Place it in a 37°C, 5% CO ₂ incubator to continue culturing.

Then, the editing of the target gene in the HEK293T cell line library by each CRISPR/Cas12 system was observed under a fluorescence microscope, and the results are shown in FIG. 16 . It can be seen from the figure that only the CRISPR/Cas12J-8 system group library cells emit green fluorescence, which indicates that the system has successfully edited the target gene in the cell. However, none of the other CRISPR/Cas12J gene editing system group library cells emitted any fluorescence, indicating that these systems are not capable of efficiently editing the target gene.

Example 5

(1) Construction of ChCas12b point mutant plasmid

The pAAV2_Cas12_ITR (SEQ ID NO: 13) plasmid was used as a template for a circular PCR reaction, and the primer sequences are shown in the table below:

Table 7: PCR primers for constructing ChCas12b point mutants

The reaction system is as follows:

The PCR running procedure is as follows:

The PCR product was electrophoresed on a 1% agarose gel at 120V for 30 min, and the gel recovery kit was used to purify the target DNA fragment according to the steps provided by the manufacturer. The DNA concentration was measured with a NanoDrop ^TM Lite spectrophotometer (Thermo Scientific) For T4 PNK treatment and T4 DNA ligase treatment, the reaction system is as follows:

The reaction conditions are as follows:

Shake the Escherichia coli DH5α clone that has been correctly connected by sequencing and extract the plasmids to obtain point mutants Q23T, P182R, E507D, E1090K, Q23T-P182R, Q23T-E507D, Q23T-P182R-E507D and Q23T-P182R-E507D-E1090K Plasmids, spare or store at -20°C for long-term storage.

(2) Linearization preparation of plasmid hU6-OQB30769_tracr-Bsa1

The hU6-OQB30769_tracr-Bsa1 plasmid was digested with Bsa1 restriction endonuclease (NEB), and the reaction system was: 2 μg plasmid hU6-OQB30769_tracr-Bsa1, 5 μL 10×CutSmart buffer (purchased from NEB Company), 1 μL Bsa1 restriction Endonuclease (purchased from NEB Company), water to make up to 50 μL. The enzyme cleavage system was allowed to react at 37°C for 2 hours.

The DNA concentration of the recovered linearized fragment hU6-OQB30769_tracr-Bsa1 was measured with a NanoDrop ^™ Lite spectrophotometer (Thermo Scientific), and stored at -20°C for long-term use.

(3) Construction of plasmid hU6-OQB30769_tracr-Bsa1-on target sgRNA

Design the sequence of the on target gRNA, and its corresponding oligonucleotide single-stranded DNA is shown in Table 8 below:

Table 8: Oligonucleotide single-stranded DNA on target gRNA

Anneal the oligonucleotide single-stranded DNA corresponding to the obtained on target gRNA. The annealing reaction system is: 1 μL 100 μM oligo-F, 1 μL 100 μM oligo-R, 28 μL water. After shaking and mixing the annealing system, place it in a PCR instrument to run the annealing program; the annealing program is as follows: 95°C_5min, 85°C_1min, 75°C_1min, 65°C_1min, 55°C_1min, 45°C_1min, 35°C_1min, 25°C_1min, 4°C storage, cooling rate 0.3°C/s. After annealing, the obtained product was ligated to the obtained linearized hU6-OQB30769_tracr-Bsa1 plasmid by DNA ligase (purchased from NEB Company).

Shake the Escherichia coli DH5α clone that has been correctly connected by sequencing, and extract the plasmid to obtain the plasmid hU6-OQB30769_tracr-Bsa1-on target sgRNA expressing the above on target gRNA sequence, which is ready for use.

The resulting plasmids Q23T, P182R, E507D, E1090K, Q23T-P182R, Q23T-E507D, Q23T-P182R-E507D and Q23T-P182R-E507D-E1090K expressing the ChCas12b point mutant protein were mixed with hU6-OQB30769_tracr-Bsa1-on The sgRNA was co-transfected into the GFP reporter system HEK293T cell line library containing the target sequence (GGATATGTTGAAGAACACCATGAC) by liposome.

Above-mentioned transfection process comprises the following steps:

On day 0, according to transfection requirements, the GFP reporter system HEK293T cell line containing the target sequence was plated in a 48-well plate, and the cell density was controlled at 30%.

The GFP reporter system HEK293T cell line containing the target sequence contains the nucleotide sequence of CMV-ATG-PAM-target site-GFP, wherein the PAM sequence is CGTTG, and the sequence of the target site (target site) is GGATATGTTGAAGAACACCATGAC.

Take 0.5 μg of plasmids Q23T, P182R, E507D, E1090K, Q23T-P182R, Q23T-E507D, Q23T-P182R-E507D and Q23T-P182R-E507D and Q23T-P182R-E507D-E1090K expressing ChCas12b point mutant protein in the plasmid to be transfected, and 0.3 μg of hU6 -OQB30769-tracr-Bsa1-on target sgRNA were added to 17.5 μL Opti-MEM medium (purchased from Gibco), and mixed gently by pipetting.

Mix PEI (purchased from polysciences company) lightly, pipette 0.8 μL PEI and add it to 17.5 μL Opti-MEM medium, mix gently, and let stand at room temperature for 5 minutes.

The diluted plasmid and the diluted transfection reagent were mixed, gently blown and mixed, and the resulting mixture was allowed to stand at room temperature for 15 minutes, and then added to the culture medium of the GFP reporter system HEK293T cell line containing the target sequence, and It was placed in a 37°C, 5% CO2 incubator to continue culturing.

Flow cytometry analysis was used to analyze the editing efficiency of ChCas12b point mutants on target sequences.

Specifically, the HEK293T cell line cultured in a CO2 incubator for 5 days was collected, and its specificity was detected by flow cytometry (BD Biosciences FACSCalibur), and the positive ratio of GFP was analyzed and plotted by FlowJo analysis software.

The editing efficiency results of the ChCas12b point mutant in the GFP reporter system HEK293T cell line containing the target sequence are shown in FIG. 17 . When the ChCas12b point mutant cuts the target sequence, the cells will restore the GFP reading frame through the self-repair system to produce green fluorescence. The Y-axis in Figure 17 represents the percentage (%) of GFP-positive cells, the X-axis represents ChCas12b and its different point mutants, and NC represents the negative control group (no transfection plasmid). It can be seen from Figure 17 that the target sites of the ChCas12b point mutant were edited in the GFP reporter system HEK293T cell line, and the editing efficiency of the ChCas12b point mutant was comparable to that of the wild-type ChCas12b.

Example 6

(1) Construction of Cas12a point mutant plasmid

The pAAV2_Cas12_ITR (SEQ ID NO: 9 to SEQ ID NO: 12) plasmid was used as a template for a circular PCR reaction, and the primer sequences are shown in the table below:

Table 9: PCR primers for constructing Cas12a point mutants

The reaction system is as follows:

The PCR running procedure is as follows:

The reaction conditions are as follows:

The Escherichia coli DH5α clone with correct connection verified by sequencing was shaken, and the plasmid was extracted to obtain the point mutant plasmid, which was stored for later use or stored at -20°C.

(2) Linearization preparation of plasmid psk-BbsI-Cas12a-crRNA1

The psk-BbsI-Cas12a-crRNA1 plasmid was digested with BbsI restriction endonuclease (NEB), and the reaction system was: 2 μg plasmid psk-BbsI-Cas12a-crRNA1, 5 μL 10×CutSmart buffer (purchased from NEB Company), 1 μL of BbsI restriction endonuclease (purchased from NEB Company), made up to 50 μL with water. The enzyme cleavage system was allowed to react at 37°C for 2 hours.

The DNA concentration of the recovered linearized fragment psk-BbsI-Cas12a-crRNA1 was measured with a NanoDrop ^TM Lite spectrophotometer (Thermo Scientific), and stored at -20°C for long-term use.

(3) Construction of plasmid psk-BbsI-Cas12a-crRNA1-on target sgRNA

Design the sequence of the on target gRNA, and its corresponding oligonucleotide single-stranded DNA is shown in Table 10 below:

Table 10 Oligonucleotide single-stranded DNA of on target gRNA

Anneal the oligonucleotide single-stranded DNA corresponding to the obtained on target gRNA. The annealing reaction system is: 1 μL 100 μM oligo-F, 1 μL 100 μM oligo-R, 28 μL water. After shaking and mixing the annealing system, place it in a PCR instrument to run the annealing program; the annealing program is as follows: 95°C_5min, 85°C_1min, 75°C_1min, 65°C_1min, 55°C_1min, 45°C_1min, 35°C_1min, 25°C_1min, 4°C storage, cooling rate 0.3°C/s. After annealing, the resulting product was ligated to the resulting linearized psk-BbsI-Cas12a-crRNA1 plasmid by DNA ligase (purchased from NEB Company).

Shake the Escherichia coli DH5α clone that has been correctly connected by sequencing and extract the plasmid to obtain the plasmid psk-BbsI-Cas12a-crRNA1-on target sgRNA expressing the above on target gRNA sequence, which is ready for use.

The resulting plasmids expressing the Cas12a point mutant protein were co-transfected with psk-BbsI-Cas12a-crRNA1-on target sgRNA into the GFP reporter system HEK293T cell line library containing the target sequence (GGATATGTTGAAGAACACCATGAC) by liposomes.

Above-mentioned transfection process comprises the following steps:

The GFP reporter system HEK293T cell line containing the target sequence contains the nucleotide sequence of CMV-ATG-PAM-target site-GFP, wherein the PAM sequence is GTTTT, and the sequence of the target site (target site) is GGATATGTTGAAGAACACCATGAC.

Take 0.5 μg of the plasmid to be transfected to express the Cas12a point mutant protein and 0.3 μg of psk-BbsI-Cas12a-crRNA1-on target sgRNA and add it to 17.5 μL of Opti-MEM medium (purchased from Gibco), and gently Mix by pipetting.

Flow cytometry analysis was used to analyze the editing efficiency of Cas12a point mutants on target sequences.

The editing efficiency results of Cas12a point mutants in the GFP reporter system HEK293T cell line containing the target sequence are shown in FIG. 18 . When the Cas12a point mutant cuts the target sequence, the cells will restore the GFP reading frame to some cells through the self-repair system, resulting in green fluorescence. The Y-axis in Figure 18 represents the percentage (%) of GFP-positive cells, the X-axis represents Cas12a and its different point mutants, and NC represents the negative control group (no transfection plasmid). It can be seen from Figure 18 that the Cas12a point mutants were edited at the target sites in the GFP reporter system HEK293T cell line, and the editing efficiency of the Cas12a point mutants was comparable to that of the wild-type Cas12a.

Claims

A conjugate comprising:

a) Cas12 protein, the Cas12 protein is:

1) Cas12J-8 protein having the amino acid sequence shown in SEQ ID NO: 1,

There is the Mb4Cas12a protein of the amino acid sequence shown in SEQ ID NO: 2,

There is the MlCas12a protein of the amino acid sequence shown in SEQ ID NO: 3,

MoCas12a protein with the amino acid sequence shown in SEQ ID NO: 4,

There is the BgCas12a protein of the amino acid sequence shown in SEQ ID NO: 5, or

ChCas12b protein with the amino acid sequence shown in SEQ ID NO: 6, or

2) having at least 80% of the amino acid sequence shown in any one of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5 and SEQ ID NO: 6, At least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93 %, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, Amino acids that have at least 99.7%, at least 99.8%, at least 99.9%, at least 99.95%, at least 99.99%, at least 99.999%, at least 100%, or any percentage of 80%-100% sequence identity and retain their biological activity sequence homologues;

Preferably, the homologue is a point mutant of the Mb4Cas12a protein such as T207A, R432G, I902T, T207A-N616S or T207A-N616S-I902T, and a point mutant of the MlCas12a protein such as V68T, R347Q, V68T-R347Q Or V68T-R347Q-V1109K, the point mutant of the MoCas12a protein such as Q784E, T902I, I1105K, Q784E-I1105K or Q784E-T902I-I1105K, the point mutant of the BgCas12a protein such as Q144R, D148G, V279I, Q144R-D148G Or Q144R-D148G-V279I, or point mutants of the ChCas12b protein such as Q23T, P182R, E507D, E1090K, Q23T-P182R, Q23T-E507D, Q23T-P182R-E507D or Q23T-P182R-E507D-E1090K;

b) modification part;

For example, the modified moiety is selected from another protein or polypeptide, a detectable label or a combination thereof;

For example, said additional protein or polypeptide is selected from an epitope tag, a reporter protein or a nuclear localization signal (NLS) sequence, cytosine deaminase (CBE), adenine deaminase (ABE), cytosine methylase One of DNMT3A and MQ1, cytosine demethylase Tet1, transcription activator VP64, p65 and RTA, transcription repressor KRAB, histone acetylase p300, histone deacetylase LSD1, and endonuclease FokI one or more kinds;

as well as

c) an optional linker for connecting the Cas12 protein with the modified part.
A fusion protein comprising:

a) Cas12 protein, the Cas12 protein is:

1) Cas12J-8 protein having the amino acid sequence shown in SEQ ID NO: 1,

There is the Mb4Cas12a protein of the amino acid sequence shown in SEQ ID NO: 2,

There is the MlCas12a protein of the amino acid sequence shown in SEQ ID NO: 3,

MoCas12a protein with the amino acid sequence shown in SEQ ID NO: 4,

There is the BgCas12a protein of the amino acid sequence shown in SEQ ID NO: 5, or

ChCas12b protein with the amino acid sequence shown in SEQ ID NO: 6, or

2) have at least 80% of the amino acid sequence shown in any one of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5 and SEQ ID NO: 6 , at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6% , at least 99.7%, at least 99.8%, at least 99.9%, at least 99.95%, at least 99.99%, at least 99.999%, at least 100%, or any percentage of sequence identity between 80%-100% and retain its biological activity Homologues of amino acid sequences;

Preferably, the homologue is a point mutant of the Mb4Cas12a protein such as T207A, R432G, I902T, T207A-N616S or T207A-N616S-I902T, and a point mutant of the MlCas12a protein such as V68T, R347Q, V68T-R347Q Or V68T-R347Q-V1109K, the point mutant of the MoCas12a protein such as Q784E, T902I, I1105K, Q784E-I1105K or Q784E-T902I-I1105K, the point mutant of the BgCas12a protein such as Q144R, D148G, V279I, Q144R-D148G Or Q144R-D148G-V279I, or point mutants of the ChCas12b protein such as Q23T, P182R, E507D, E1090K, Q23T-P182R, Q23T-E507D, Q23T-P182R-E507D or Q23T-P182R-E507D-E1090K;

b) additional proteins or polypeptides;

For example, said additional protein or polypeptide is selected from an epitope tag, a reporter protein or a nuclear localization signal (NLS) sequence, cytosine deaminase (CBE), adenine deaminase (ABE), cytosine methylase One of DNMT3A and MQ1, cytosine demethylase Tet1, transcription activator VP64, p65 and RTA, transcription repressor KRAB, histone acetylase p300, histone deacetylase LSD1, and endonuclease FokI one or more kinds;

as well as

C) optionally be used to connect described Cas12 albumen and the linker of described other albumen or polypeptide;

For example, the linker is a linker with a length of 1-50 amino acids;

Preferably, the fusion protein comprises: Cas12J-8 protein, adenine deaminase (ABE) having the amino acid sequence shown in SEQ ID NO: 1, and optionally connecting the Cas12J-8 protein and the adenine A linker for deaminase (ABE);

Preferably, the fusion protein is sequentially the adenine deaminase (ABE), the linker, and the Cas12J-8 protein from its N-terminus to the C-terminus;

More preferably, the amino acid sequence of the fusion protein is shown in SEQ ID NO: 7.
A single-stranded guide RNA comprising a CRISPR repeat sequence having:

a) for Cas12J-8 protein, its homologue, conjugate or the nucleic acid sequence shown in SEQ ID NO: 15 of fusion protein,

For the nucleic acid sequence shown in SEQ ID NO of Mb4Cas12a protein, M1Cas12a protein and MoCas12a protein, its homologue, conjugate or fusion protein,

For BgCas12a albumen, its homologue, the nucleic acid sequence shown in the SEQ ID NO of conjugate or fusion protein: 17, or

For ChCas12b protein, its homologue, conjugate or fusion protein SEQ ID NO: the nucleotide sequence shown in 18;

or

b) at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, A nucleic acid sequence that has at least 97%, at least 98%, at least 99%, at least 99.9%, or at least 100% sequence identity and retains its biological activity; or

c) a nucleic acid sequence modified based on any one of the nucleic acid sequences described in SEQ ID NO: 15 to SEQ ID NO: 18 and retaining its biological activity,

For example, the modification is one or more of base phosphorylation, base sulfuration, base methylation, base hydroxylation, sequence shortening and sequence lengthening,

For example, the shortening of the sequence and the lengthening of the sequence include deletions of one, two, three, four, five, six, seven, eight, nine or ten bases relative to the base sequence or add.
The single-stranded guide RNA according to claim 3, wherein the single-stranded guide RNA further comprises a CRISPR spacer sequence at the 3' end of the CRISPR repeat sequence, and the CRISPR spacer sequence has a length of 20, 21, 22, A sequence of 23, 24, 25, 26, 27, 28, 29, 30 nucleotides (preferably 24 nucleotides) capable of complementary pairing with the target sequence.
An isolated nucleic acid molecule comprising a nucleic acid sequence encoding:

a) Cas12 protein, the Cas12 protein is:

1) Cas12J-8 protein having the amino acid sequence shown in SEQ ID NO: 1,

There is the Mb4Cas12a protein of the amino acid sequence shown in SEQ ID NO: 2,

There is the MlCas12a protein of the amino acid sequence shown in SEQ ID NO: 3,

MoCas12a protein with the amino acid sequence shown in SEQ ID NO: 4,

There is the BgCas12a protein of the amino acid sequence shown in SEQ ID NO: 5, or

ChCas12b protein with the amino acid sequence shown in SEQ ID NO: 6, or

2) have at least 80% of the amino acid sequence shown in any one of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5 and SEQ ID NO: 6 , at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6% , at least 99.7%, at least 99.8%, at least 99.9%, at least 99.95%, at least 99.99%, at least 99.999%, at least 100%, or any percentage of sequence identity between 80%-100% and retain its biological activity Homologues of amino acid sequences;

Preferably, the homologue is a point mutant of the Mb4Cas12a protein such as T207A, R432G, I902T, T207A-N616S or T207A-N616S-I902T, and a point mutant of the MlCas12a protein such as V68T, R347Q, V68T-R347Q Or V68T-R347Q-V1109K, the point mutant of the MoCas12a protein such as Q784E, T902I, I1105K, Q784E-I1105K or Q784E-T902I-I1105K, the point mutant of the BgCas12a protein such as Q144R, D148G, V279I, Q144R-D148G Or Q144R-D148G-V279I, or point mutants of the ChCas12b protein such as Q23T, P182R, E507D, E1090K, Q23T-P182R, Q23T-E507D, Q23T-P182R-E507D or Q23T-P182R-E507D-E1090K;

b) the conjugate of claim 1; or

c) fusion protein according to claim 2;

For example, the isolated nucleic acid molecule comprises any one of SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, and SEQ ID NO: 13. Nucleic acid sequence or its degenerate sequence;

For example, the isolated nucleic acid molecule comprises a nucleic acid sequence encoding a fusion protein shown in SEQ ID NO: 7;

Preferably, the isolated nucleic acid molecule comprises the nucleic acid sequence shown in SEQ ID NO: 14 or its degenerate sequence.
The nucleic acid molecule of separation according to claim 5, wherein the nucleic acid molecule of wherein said separation also comprises the nucleic acid sequence of the single-stranded guide RNA corresponding to the Cas12 protein described in any one of claims 3 to 4;

For example, the isolated nucleic acid molecule comprises a Cas12J-8 protein encoding an amino acid sequence shown in SEQ ID NO: 1, its homologue, a conjugate or a fusion protein (such as a fusion protein shown in SEQ ID NO: 7) Nucleic acid sequence, such as SEQ ID NO: 8, or the nucleic acid sequence shown in SEQ ID NO: 14, and comprising SEQ ID NO coding for the Cas12J-8 protein, its homologue, conjugate or fusion protein: The CRISPR repeat sequence shown in 15, comprising a homologous sequence having at least 90% sequence identity with SEQ ID NO: 15 and retaining its biological activity, or comprising a modified sequence based on SEQ ID NO: 15 and retaining its biological activity The nucleic acid sequence of the single-stranded guide RNA of the modified sequence, such as the nucleic acid sequence shown in SEQ ID NO: 19;

For example, the isolated nucleic acid molecule comprises a nucleic acid sequence encoding a Cas12a protein, its homologue, a conjugate or a fusion protein having the amino acid sequence shown in SEQ ID NO: 2, SEQ ID NO: 3 or SEQ ID NO: 4 , such as SEQ ID NO: 9, SEQ ID NO: 10 or the nucleotide sequence shown in SEQ ID NO: 11, and comprising SEQ ID NO coding for the Cas12a protein, its homologue, conjugate or fusion protein: The CRISPR repeat sequence shown in 16, comprising a homologous sequence having at least 90% sequence identity with SEQ ID NO: 16 and retaining its biological activity, or comprising a modified sequence based on SEQ ID NO: 16 and retaining its biological activity The nucleic acid sequence of the single-stranded guide RNA of the modified sequence, for example, the nucleic acid sequence shown in SEQ ID NO: 20;

For example, the isolated nucleic acid molecule comprises a nucleic acid sequence encoding a BgCas12a protein having an amino acid sequence shown in SEQ ID NO: 5, its homologue, a conjugate or a fusion protein, such as a nucleic acid sequence shown in SEQ ID NO: 12 , and comprising coding for the BgCas12a protein, its homologue, conjugate or fusion protein comprising the CRISPR repeat sequence shown in SEQ ID NO: 17, comprising at least 90% sequence identity with SEQ ID NO: 17 and retaining its A biologically active homologous sequence, or a nucleic acid sequence comprising a single-stranded guide RNA modified based on SEQ ID NO: 17 and retaining its biological activity, such as the nucleic acid sequence shown in SEQ ID NO: 21;

For example, the isolated nucleic acid molecule comprises a nucleic acid sequence encoding a ChCas12b protein having an amino acid sequence shown in SEQ ID NO: 6, its homologue, a conjugate or a fusion protein, such as a nucleic acid sequence shown in SEQ ID NO: 13 , and comprising coding for the ChCas12b protein, its homologues, conjugates or fusion proteins comprising SEQ ID NO: 18 shown in the CRISPR repeat sequence, comprising at least 90% sequence identity with SEQ ID NO: 18 and retaining its A homologous sequence of biological activity, or a nucleic acid sequence of a single-stranded guide RNA comprising a modified sequence based on SEQ ID NO: 18 and retaining its biological activity, such as the nucleic acid sequence shown in SEQ ID NO: 22.
An isolated nucleic acid molecule, said isolated nucleic acid molecule comprising a nucleic acid sequence encoding the single-stranded guide RNA described in any one of claims 3 to 4;

For example, the isolated nucleic acid molecule comprises a nucleic acid sequence or a degenerate sequence thereof shown in any one of SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, and SEQ ID NO: 22, and preferably A nucleic acid sequence encoding a CRISPR spacer sequence is also included.
A vector comprising a nucleic acid sequence encoding the following:

a) Cas12 protein, the Cas12 protein is:

1) Cas12J-8 protein having the amino acid sequence shown in SEQ ID NO: 1,

There is the Mb4Cas12a protein of the amino acid sequence shown in SEQ ID NO: 2,

There is the MlCas12a protein of the amino acid sequence shown in SEQ ID NO: 3,

MoCas12a protein with the amino acid sequence shown in SEQ ID NO: 4,

There is the BgCas12a protein of the amino acid sequence shown in SEQ ID NO: 5, or

ChCas12b protein with the amino acid sequence shown in SEQ ID NO: 6, or

2) have at least 80% of the amino acid sequence shown in any one of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5 and SEQ ID NO: 6 , at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6% , at least 99.7%, at least 99.8%, at least 99.9%, at least 99.95%, at least 99.99%, at least 99.999%, at least 100%, or any percentage of sequence identity between 80%-100% and retain its biological activity Homologues of amino acid sequences;

Preferably, the homologue is a point mutant of the Mb4Cas12a protein such as T207A, R432G, I902T, T207A-N616S or T207A-N616S-I902T, and a point mutant of the MlCas12a protein such as V68T, R347Q, V68T-R347Q Or V68T-R347Q-V1109K, the point mutant of the MoCas12a protein such as Q784E, T902I, I1105K, Q784E-I1105K or Q784E-T902I-I1105K, the point mutant of the BgCas12a protein such as Q144R, D148G, V279I, Q144R-D148G Or Q144R-D148G-V279I, or point mutants of the ChCas12b protein such as Q23T, P182R, E507D, E1090K, Q23T-P182R, Q23T-E507D, Q23T-P182R-E507D or Q23T-P182R-E507D-E1090K;

b) the conjugate of claim 1; or

c) fusion protein according to claim 2;

For example, the vector comprises any one of the nucleic acid sequences shown in SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13 or its degenerate sequence;

For example, the vector comprises a nucleic acid sequence encoding a fusion protein shown in SEQ ID NO: 7;

Preferably, the vector comprises the nucleic acid sequence shown in SEQ ID NO: 14 or its degenerate sequence;

For example, the vector is a plasmid vector such as pUC19 vector, episomal vector, pAAV2_ITR vector, retroviral vector, lentiviral vector, adenoviral vector or adeno-associated viral vector.
The carrier according to claim 8, wherein, the carrier further comprises the nucleic acid sequence of the single-stranded guide RNA corresponding to the Cas12 protein described in any one of the coding claims 3 to 4;

For example, the vector comprises a nucleic acid sequence encoding a Cas12J-8 protein having an amino acid sequence shown in SEQ ID NO: 1, a homologue thereof, a conjugate or a fusion protein (such as a fusion protein shown in SEQ ID NO: 7) , such as SEQ ID NO: 8 or the nucleotide sequence shown in SEQ ID NO: 14, and comprising coding for the Cas12J-8 protein, its homologue, conjugate or fusion protein comprising the CRISPR shown in SEQ ID NO: 15 A repeat sequence, a homologous sequence comprising at least 90% sequence identity with SEQ ID NO: 15 and retaining its biological activity, or a single sequence comprising a modified sequence based on SEQ ID NO: 15 and retaining its biological activity The nucleic acid sequence of the strand guide RNA, such as the nucleic acid sequence shown in SEQ ID NO: 19;

For example, the vector comprises a nucleic acid sequence encoding a Cas12a protein, its homologue, a conjugate or a fusion protein having the amino acid sequence shown in SEQ ID NO: 2, SEQ ID NO: 3 or SEQ ID NO: 4, such as SEQ ID NO: ID NO: 9, SEQ ID NO: 10 or the nucleic acid sequence shown in SEQ ID NO: 11, and comprises coding for the Cas12a protein, its homologue, conjugate or fusion protein comprising SEQ ID NO: shown in 16 CRISPR repeat sequence, comprising a homologous sequence having at least 90% sequence identity with SEQ ID NO: 16 and retaining its biological activity, or comprising a modified sequence based on SEQ ID NO: 16 and retaining its biological activity The nucleic acid sequence of the single-stranded guide RNA, such as the nucleic acid sequence shown in SEQ ID NO: 20;

For example, the vector comprises a nucleic acid sequence encoding a BgCas12a protein having an amino acid sequence shown in SEQ ID NO: 5, a homolog thereof, a conjugate or a fusion protein, such as a nucleic acid sequence shown in SEQ ID NO: 12, and includes Encoding for the BgCas12a protein, its homologues, conjugates or fusion proteins comprising the CRISPR repeat sequence shown in SEQ ID NO: 17, comprising at least 90% sequence identity with SEQ ID NO: 17 and retaining its biological activity Homologous sequence, or the nucleic acid sequence of a single-stranded guide RNA comprising a modified sequence based on SEQ ID NO: 17 and retaining its biological activity, such as the nucleic acid sequence shown in SEQ ID NO: 21;

For example, the vector comprises a nucleic acid sequence encoding a ChCas12b protein having an amino acid sequence shown in SEQ ID NO: 6, a homologue, a conjugate or a fusion protein thereof, such as a nucleic acid sequence shown in SEQ ID NO: 13, and includes Encoding for the ChCas12b protein, its homologues, conjugates or fusion proteins comprising the CRISPR repeat sequence shown in SEQ ID NO: 18, comprising at least 90% sequence identity with SEQ ID NO: 18 and retaining its biological activity Homologous sequence, or the nucleic acid sequence of a single-stranded guide RNA comprising a modified sequence based on SEQ ID NO: 18 and retaining its biological activity, such as the nucleic acid sequence shown in SEQ ID NO: 22.
A carrier, said carrier comprising the nucleic acid sequence encoding the single-stranded guide RNA described in any one of claims 3 to 4;

For example, the vector comprises a nucleic acid sequence or a degenerate sequence thereof shown in any one of SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21 and SEQ ID NO: 22, and preferably also contains an encoding CRISPR The nucleic acid sequence of the spacer sequence.
A CRISPR/Cas12 gene editing system comprising:

a) protein component comprising:

1) Cas12 protein, the Cas12 protein is:

1.1) Cas12J-8 protein having the amino acid sequence shown in SEQ ID NO: 1,

There is the Mb4Cas12a protein of the amino acid sequence shown in SEQ ID NO: 2,

There is the MlCas12a protein of the amino acid sequence shown in SEQ ID NO: 3,

MoCas12a protein with the amino acid sequence shown in SEQ ID NO: 4,

There is the BgCas12a protein of the amino acid sequence shown in SEQ ID NO: 5, or

ChCas12b protein with the amino acid sequence shown in SEQ ID NO: 6, or

1.2) have at least 80% of the amino acid sequence shown in any one of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5 and SEQ ID NO: 6 , at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6% , at least 99.7%, at least 99.8%, at least 99.9%, at least 99.95%, at least 99.99%, at least 99.999%, at least 100%, or any percentage of sequence identity between 80%-100% and retain its biological activity Homologues of amino acid sequences;

Preferably, the homologue is a point mutant of the Mb4Cas12a protein such as T207A, R432G, I902T, T207A-N616S or T207A-N616S-I902T, and a point mutant of the MlCas12a protein such as V68T, R347Q, V68T-R347Q Or V68T-R347Q-V1109K, the point mutant of the MoCas12a protein such as Q784E, T902I, I1105K, Q784E-I1105K or Q784E-T902I-I1105K, the point mutant of the BgCas12a protein such as Q144R, D148G, V279I, Q144R-D148G Or Q144R-D148G-V279I, or point mutants of the ChCas12b protein such as Q23T, P182R, E507D, E1090K, Q23T-P182R, Q23T-E507D, Q23T-P182R-E507D or Q23T-P182R-E507D-E1090K;

2) The conjugate of claim 1, or

3) the fusion protein of claim 2; and

B) nucleic acid component, it comprises: the single-stranded guide RNA corresponding to the protein component in a) described in any one in claim 3 to 4;

And, the protein component and the nucleic acid component combine with each other to form a complex;

For example, the protein component comprises a Cas12J-8 protein with the amino acid sequence shown in SEQ ID NO: 1, its homologue, conjugate or fusion protein, the nucleic acid component comprises a single-stranded guide RNA, and the single The strand guide RNA is a single-stranded guide RNA comprising a CRISPR repeat sequence shown in SEQ ID NO: 15, a single-stranded guide RNA comprising a homologous sequence with at least 90% sequence identity to SEQ ID NO: 15 and retaining its biological activity , or a single-stranded guide RNA comprising a modified sequence based on SEQ ID NO: 15 and retaining its biological activity;

For example, the protein component comprises Cas12a protein, its homologue, conjugate or fusion protein having the amino acid sequence shown in SEQ ID NO: 2, SEQ ID NO: 3 or SEQ ID NO: 4, and the nucleic acid set Part comprises a single-stranded guide RNA, the single-stranded guide RNA is a single-stranded guide RNA comprising a CRISPR repeat sequence shown in SEQ ID NO: 16, comprising at least 90% sequence identity with SEQ ID NO: 16 and retaining its biological A single-stranded guide RNA of an active homologous sequence, or a single-stranded guide RNA comprising a modified sequence based on SEQ ID NO: 16 and retaining its biological activity;

For example, the protein component comprises BgCas12a protein with the amino acid sequence shown in SEQ ID NO: 5, its homologue, conjugate or fusion protein, and the nucleic acid component comprises a single-stranded guide RNA, and the single-stranded guide The RNA is a single-stranded guide RNA comprising a CRISPR repeat sequence set forth in SEQ ID NO: 17, a single-stranded guide RNA comprising a homologous sequence having at least 90% sequence identity to SEQ ID NO: 17 and retaining its biological activity, or A single-stranded guide RNA comprising a modified sequence based on SEQ ID NO: 17 and retaining its biological activity;

For example, the protein component comprises ChCas12b protein having the amino acid sequence shown in SEQ ID NO: 6, its homologue, conjugate or fusion protein, the nucleic acid component comprises a single-stranded guide RNA, and the single-stranded guide The RNA is a single-stranded guide RNA comprising a CRISPR repeat sequence set forth in SEQ ID NO: 18, a single-stranded guide RNA comprising a homologous sequence having at least 90% sequence identity to SEQ ID NO: 18 and retaining its biological activity, or A single-stranded guide RNA comprising a modified sequence based on SEQ ID NO: 18 and retaining its biological activity.
A cell comprising: the isolated nucleic acid molecule of any one of claims 5 to 7, or the vector of any one of claims 8 to 10;

For example, the cells are prokaryotic cells or eukaryotic cells, the eukaryotic cells are, for example, plant cells or animal cells, and the animal cells are, for example, mammalian cells such as human cells.
A method for gene editing a target sequence in a cell or an in vitro environment, the method comprising: contacting any one of the following (1) to (4) with the target sequence in a cell or an in vitro environment:

(1) Cas12 protein, the conjugate according to claim 1 or the fusion protein according to claim 2, and the single chain corresponding to the Cas12 protein according to any one of claims 3 to 4 guide RNA,

Wherein, the Cas12 protein is:

1) Cas12J-8 protein having the amino acid sequence shown in SEQ ID NO: 1,

There is the Mb4Cas12a protein of the amino acid sequence shown in SEQ ID NO: 2,

There is the MlCas12a protein of the amino acid sequence shown in SEQ ID NO: 3,

MoCas12a protein with the amino acid sequence shown in SEQ ID NO: 4,

There is the BgCas12a protein of the amino acid sequence shown in SEQ ID NO: 5, or

ChCas12b protein with the amino acid sequence shown in SEQ ID NO: 6, or

2) have at least 80% of the amino acid sequence shown in any one of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5 and SEQ ID NO: 6 , at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6% , at least 99.7%, at least 99.8%, at least 99.9%, at least 99.95%, at least 99.99%, at least 99.999%, at least 100%, or any percentage of sequence identity between 80%-100% and retain its biological activity Homologues of amino acid sequences;

Preferably, the homologue is a point mutant of the Mb4Cas12a protein such as T207A, R432G, I902T, T207A-N616S or T207A-N616S-I902T, and a point mutant of the MlCas12a protein such as V68T, R347Q, V68T-R347Q Or V68T-R347Q-V1109K, the point mutant of the MoCas12a protein such as Q784E, T902I, I1105K, Q784E-I1105K or Q784E-T902I-I1105K, the point mutant of the BgCas12a protein such as Q144R, D148G, V279I, Q144R-D148G Or Q144R-D148G-V279I, or point mutants of the ChCas12b protein such as Q23T, P182R, E507D, E1090K, Q23T-P182R, Q23T-E507D, Q23T-P182R-E507D or Q23T-P182R-E507D-E1090K;

For example, a Cas12J-8 protein having the amino acid sequence shown in SEQ ID NO: 1, its homologue, a conjugate or a fusion protein, and a CRISPR repeat sequence comprising SEQ ID NO: 15, comprising the same sequence as SEQ ID NO: 15 A homologous sequence with at least 90% sequence identity, or a single-stranded guide RNA comprising a modified sequence modified based on SEQ ID NO: 15 and retaining its biological activity;

For example, a Cas12a protein having the amino acid sequence shown in SEQ ID NO: 2, SEQ ID NO: 3 or SEQ ID NO: 4, a homologue, a conjugate or a fusion protein thereof, and a CRISPR protein comprising SEQ ID NO: 16 A repeat sequence, a homologous sequence comprising at least 90% sequence identity with SEQ ID NO: 16 and retaining its biological activity, or a single sequence comprising an engineered sequence modified based on SEQ ID NO: 16 and retaining its biological activity Strand guide RNA;

For example, the nucleic acid sequence of the BgCas12a protein with the amino acid sequence shown in SEQ ID NO: 5, its homologues, their conjugates or fusion proteins, and the CRISPR repeat sequence shown in SEQ ID NO: 17, including and SEQ ID NO: 17 has a homologous sequence with at least 90% sequence identity and retains its biological activity, or a single-stranded guide RNA comprising a modified sequence based on SEQ ID NO: 17 and retains its biological activity;

For example, a ChCas12b protein having the amino acid sequence shown in SEQ ID NO: 6, a homologue thereof, a conjugate or a fusion protein, and a CRISPR repeat sequence comprising SEQ ID NO: 18, comprising at least A homologous sequence with 90% sequence identity and retaining its biological activity, or a single-stranded guide RNA comprising a modified sequence based on SEQ ID NO: 18 and retaining its biological activity;

(2) The carrier according to claim 8 and the carrier according to claim 10;

For example, comprising a nucleic acid sequence (such as SEQ ID NO: 7 shown in the fusion protein) encoding the Cas12J-8 protein with the amino acid sequence shown in SEQ ID NO: 1, its homologue, conjugate or fusion protein (such as SEQ ID NO: 7) ID NO: 8 or the vector of the nucleic acid sequence shown in SEQ ID NO: 14), and comprising the CRISPR shown in SEQ ID NO: 15 comprising coding for the Cas12J-8 protein, its homologue, conjugate or fusion protein A repeat sequence, a homologous sequence comprising at least 90% sequence identity with SEQ ID NO: 15 and retaining its biological activity, or a single sequence comprising a modified sequence based on SEQ ID NO: 15 and retaining its biological activity The carrier of the nucleic acid sequence (such as the nucleic acid sequence shown in SEQ ID NO: 19) of the strand guide RNA;

For example, comprising a nucleic acid sequence encoding a Cas12a protein, a homolog thereof, a conjugate or a fusion protein having an amino acid sequence shown in SEQ ID NO: 2, SEQ ID NO: 3 or SEQ ID NO: 4 (such as SEQ ID NO: 9. The carrier of the nucleic acid sequence shown in SEQ ID NO: 10 or SEQ ID NO: 11), and the vector containing the nucleic acid sequence shown in SEQ ID NO: 16 for the Mb4Cas12a protein, its homologue, conjugate or fusion protein. CRISPR repeat sequence, comprising a homologous sequence having at least 90% sequence identity with SEQ ID NO: 16 and retaining its biological activity, or comprising a modified sequence based on SEQ ID NO: 16 and retaining its biological activity The carrier of the nucleic acid sequence (such as the nucleic acid sequence shown in SEQ ID NO: 20) of single-stranded guide RNA;

For example, a vector comprising a nucleic acid sequence (such as a nucleic acid sequence shown in SEQ ID NO: 12) encoding a BgCas12a protein having an amino acid sequence shown in SEQ ID NO: 5, a homologue thereof, a conjugate or a fusion protein thereof, and comprising Encoding for the BgCas12a protein, its homologues, conjugates or fusion proteins comprising the CRISPR repeat sequence shown in SEQ ID NO: 17, comprising at least 90% sequence identity with SEQ ID NO: 17 and retaining its biological activity Homologous sequence, or the nucleic acid sequence (for example, the nucleic acid sequence shown in SEQ ID NO: 21) of the single-stranded guide RNA comprising the modified sequence obtained based on SEQ ID NO: 17 and retaining its biological activity;

For example, a vector comprising a nucleic acid sequence (such as a nucleic acid sequence shown in SEQ ID NO: 13) encoding a ChCas12b protein having an amino acid sequence shown in SEQ ID NO: 6, a homologue thereof, a conjugate or a fusion protein thereof, and comprising Encoding for the ChCas12b protein, its homologues, conjugates or fusion proteins comprising the CRISPR repeat sequence shown in SEQ ID NO: 18, comprising at least 90% sequence identity with SEQ ID NO: 18 and retaining its biological activity The homologous sequence of or comprising the nucleotide sequence (such as the nucleic acid sequence shown in SEQ ID NO: 22) of the single-stranded guide RNA based on SEQ ID NO: 18 transformation obtained and retaining its biological activity;

(3) The carrier according to claim 9; and

(4) CRISPR/Cas12 gene editing system according to claim 11;

Wherein, after contacting with the target sequence, the Cas12 protein, its homologue, conjugate or fusion protein recognizes the respective protospacer adjacent sequence (PAM), and the PAM is located at the 5' end of the target sequence, and, for The Cas12J-8 protein, the Mb4Cas12a protein, the MlCas12a protein, the MoCas12a protein, the BgCas12a protein, and the ChCas12b protein, or their respective homologues, conjugates or fusion proteins, the PAMs are 5'-TTN, 5'-YYN, 5'-YYN, 5'-YYN, 5'-YYN and 5'-TTN;

For example, the cells are prokaryotic cells or eukaryotic cells, the eukaryotic cells are, for example, plant cells or animal cells, and the animal cells are, for example, mammalian cells such as human cells;

For example, the gene editing includes gene knockout of target sequence, site-directed base change, site-directed insertion, regulation of gene transcription level, DNA methylation regulation, DNA acetylation modification, histone acetylation modification, single base One or more of conversion and chromatin imaging tracking, for example, the single base conversion includes conversion of the base adenine to guanine, cytosine to thymine or cytosine to uracil.
The method according to claim 13, wherein the CRISPR spacer sequence of the single-stranded guide RNA forms a complete base pairing structure with the target sequence, and forms an incomplete base pairing structure with the non-target sequence;

For example, the incomplete base pairing structure includes one or more such as two or more base mismatching structures.
A kit for gene editing a target sequence in a cell or in an in vitro environment, comprising:

a. Any one selected from the following 1) to 6):

1) Cas12 protein, the conjugate according to claim 1 or the fusion protein according to claim 2, and the single chain corresponding to the Cas12 protein according to any one of claims 3 to 4 guide RNA,

Wherein, the Cas12 protein is:

a) Cas12J-8 protein having the amino acid sequence shown in SEQ ID NO: 1,

There is the Mb4Cas12a protein of the amino acid sequence shown in SEQ ID NO: 2,

There is the MlCas12a protein of the amino acid sequence shown in SEQ ID NO: 3,

MoCas12a protein with the amino acid sequence shown in SEQ ID NO: 4,

There is the BgCas12a protein of the amino acid sequence shown in SEQ ID NO: 5, or

ChCas12b protein with the amino acid sequence shown in SEQ ID NO: 6, or

b) have at least 80% of the amino acid sequence shown in any one of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5 and SEQ ID NO: 6 , at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6% , at least 99.7%, at least 99.8%, at least 99.9%, at least 99.95%, at least 99.99%, at least 99.999%, at least 100%, or any percentage of sequence identity between 80%-100% and retain its biological activity Homologues of amino acid sequences;

Preferably, the homologue is a point mutant of the Mb4Cas12a protein such as T207A, R432G, I902T, T207A-N616S or T207A-N616S-I902T, and a point mutant of the MlCas12a protein such as V68T, R347Q, V68T-R347Q Or V68T-R347Q-V1109K, the point mutant of the MoCas12a protein such as Q784E, T902I, I1105K, Q784E-I1105K or Q784E-T902I-I1105K, the point mutant of the BgCas12a protein such as Q144R, D148G, V279I, Q144R-D148G Or Q144R-D148G-V279I, or point mutants of the ChCas12b protein such as Q23T, P182R, E507D, E1090K, Q23T-P182R, Q23T-E507D, Q23T-P182R-E507D or Q23T-P182R-E507D-E1090K;

For example, the Cas12J-8 protein with the amino acid sequence shown in SEQ ID NO: 1, its homologue, conjugate or fusion protein, and the single-stranded guide RNA comprising the CRISPR repeat sequence shown in SEQ ID NO: 15, comprising and SEQ ID NO: 15 has at least 90% sequence identity and retains the single-stranded guide RNA of the homologous sequence of its biological activity, or comprises the single strand of the modified sequence obtained based on SEQ ID NO: 15 and retains its biological activity Strand guide RNA;

For example, the Cas12a protein having the amino acid sequence shown in SEQ ID NO: 2, SEQ ID NO: 3 or SEQ ID NO: 4 has at least Homologues of amino acid sequences with 80% sequence identity, their conjugates or fusion proteins, and a single-stranded guide RNA comprising a CRISPR repeat sequence shown in SEQ ID NO: 16, comprising at least 90 The single-stranded guide RNA of the homologous sequence of % sequence identity and retains its biological activity, or comprises the single-stranded guide RNA of the transformation sequence obtained based on SEQ ID NO: 16 and retains its biological activity;

For example, a BgCas12a protein having the amino acid sequence shown in SEQ ID NO: 5, its homologue with an amino acid sequence having at least 80% sequence identity to SEQ ID NO: 5, their conjugates or fusion proteins, and comprising A single-stranded guide RNA of the CRISPR repeat sequence shown in SEQ ID NO: 17, a single-stranded guide RNA comprising a homologous sequence having at least 90% sequence identity with SEQ ID NO: 17 and retaining its biological activity, or comprising a single-stranded guide RNA based on SEQ ID NO: 17 ID NO: 17 modified single-stranded guide RNA with a modified sequence that retains its biological activity;

For example, a ChCas12b protein having the amino acid sequence shown in SEQ ID NO: 6, its homologue with an amino acid sequence having at least 80% sequence identity to SEQ ID NO: 6, their conjugates or fusion proteins, and comprising A single-stranded guide RNA of the CRISPR repeat sequence shown in SEQ ID NO: 18, a single-stranded guide RNA comprising a homologous sequence having at least 90% sequence identity with SEQ ID NO: 18 and retaining its biological activity, or comprising a single-stranded guide RNA based on SEQ ID NO: 18 ID NO: 18 modified single-stranded guide RNA with a modified sequence that retains its biological activity;

2) The nucleic acid molecule of separation according to claim 5 and the nucleic acid molecule of separation according to claim 7;

For example, the nucleic acid sequence (such as SEQ ID NO: 8 or the nucleic acid sequence shown in SEQ ID NO: 14) isolated nucleic acid molecule, and the nucleic acid molecule comprising SEQ ID NO: 15 encoding for the Cas12J-8 protein, its homologue, conjugate or fusion protein CRISPR repeat sequence, comprising a homologous sequence having at least 90% sequence identity with SEQ ID NO: 15 and retaining its biological activity, or comprising a modified sequence based on SEQ ID NO: 15 and retaining its biological activity The isolated nucleic acid molecule of the nucleic acid sequence (such as the nucleic acid sequence shown in SEQ ID NO: 19) of the single-stranded guide RNA;

For example, a nucleic acid sequence (SEQ ID NO: 9) comprising a Cas12a protein encoding an amino acid sequence shown in SEQ ID NO: 2, SEQ ID NO: 3 or SEQ ID NO: 4, its homologue, a conjugate or a fusion protein , SEQ ID NO: 10 or the nucleic acid sequence shown in SEQ ID NO: 11) isolated nucleic acid molecules, and comprising SEQ ID NO: 16 encoding for the Cas12a protein, its homologue, conjugate or fusion protein The shown CRISPR repeat sequence, comprising a homologous sequence having at least 90% sequence identity with SEQ ID NO: 16 and retaining its biological activity, or comprising a modification based on SEQ ID NO: 16 and retaining its biological activity The isolated nucleic acid molecule of the nucleic acid sequence (such as the nucleic acid sequence shown in SEQ ID NO:20) of the single-stranded guide RNA of sequence;

For example, an isolated nucleic acid molecule comprising a nucleic acid sequence (such as a nucleic acid sequence shown in SEQ ID NO: 12) encoding a BgCas12a protein having an amino acid sequence shown in SEQ ID NO: 5, its homologue, a conjugate or a fusion protein , and comprising a CRISPR repeat sequence coding for the BgCas12a protein, its homologue, conjugate or fusion protein comprising SEQ ID NO: 17, comprising at least 90% sequence identity with SEQ ID NO: 17 and retaining its Biologically active homologous sequence, or the nucleotide sequence (for example, the nucleic acid sequence shown in SEQ ID NO: 21) comprising a single-stranded guide RNA that is modified based on SEQ ID NO: 17 and retains its biological activity. isolated nucleic acid molecules;

For example, an isolated nucleic acid molecule comprising a nucleic acid sequence (such as a nucleic acid sequence shown in SEQ ID NO: 13) encoding a ChCas12b protein having an amino acid sequence shown in SEQ ID NO: 6, its homologue, a conjugate or a fusion protein , and comprising a CRISPR repeat sequence coding for the ChCas12b protein, its homologue, conjugate or fusion protein comprising SEQ ID NO: 18, comprising at least 90% sequence identity with SEQ ID NO: 18 and retaining its Biologically active homologous sequence, or the nucleotide sequence (for example, the nucleic acid sequence shown in SEQ ID NO: 22) of the single-stranded guide RNA comprising the modified sequence obtained based on SEQ ID NO: 18 and retaining its biological activity isolated nucleic acid molecules;

3) The isolated nucleic acid molecule according to claim 6;

4) The carrier according to claim 8 and the carrier according to claim 10;

For example, comprising a nucleic acid sequence (such as SEQ ID NO: 7 shown in the fusion protein) encoding the Cas12J-8 protein with the amino acid sequence shown in SEQ ID NO: 1, its homologue, conjugate or fusion protein (such as SEQ ID NO: 7) ID NO: 8 or the vector of the nucleic acid sequence shown in SEQ ID NO: 14), and comprising the CRISPR shown in SEQ ID NO: 15 comprising coding for the Cas12J-8 protein, its homologue, conjugate or fusion protein A repeat sequence, a homologous sequence comprising at least 90% sequence identity with SEQ ID NO: 15 and retaining its biological activity, or a single sequence comprising a modified sequence based on SEQ ID NO: 15 and retaining its biological activity The carrier of the nucleic acid sequence (such as the nucleic acid sequence shown in SEQ ID NO: 19) of the strand guide RNA;

For example, comprising a nucleic acid sequence encoding a Cas12a protein, a homolog thereof, a conjugate or a fusion protein having an amino acid sequence shown in SEQ ID NO: 2, SEQ ID NO: 3 or SEQ ID NO: 4 (such as SEQ ID NO: 9. The carrier of the nucleic acid sequence shown in SEQ ID NO: 10 or SEQ ID NO: 11), and the vector containing the coding sequence shown in SEQ ID NO: 16 for the Cas12a protein, its homologue, conjugate or fusion protein CRISPR repeat sequence, comprising a homologous sequence having at least 90% sequence identity with SEQ ID NO: 16 and retaining its biological activity, or comprising a modified sequence based on SEQ ID NO: 16 and retaining its biological activity The carrier of the nucleic acid sequence (such as the nucleic acid sequence shown in SEQ ID NO: 20) of single-stranded guide RNA;

For example, a vector comprising a nucleic acid sequence (such as a nucleic acid sequence shown in SEQ ID NO: 12) encoding a BgCas12a protein having an amino acid sequence shown in SEQ ID NO: 5, a homologue thereof, a conjugate or a fusion protein thereof, and comprising Encoding for the BgCas12a protein, its homologues, conjugates or fusion proteins comprising the CRISPR repeat sequence shown in SEQ ID NO: 17, comprising at least 90% sequence identity with SEQ ID NO: 17 and retaining its biological activity Homologous sequence, or the nucleic acid sequence (for example, the nucleic acid sequence shown in SEQ ID NO: 21) of the single-stranded guide RNA comprising the modified sequence obtained based on SEQ ID NO: 17 and retaining its biological activity;

For example, a vector comprising a nucleic acid sequence (such as a nucleic acid sequence shown in SEQ ID NO: 13) encoding a ChCas12b protein having an amino acid sequence shown in SEQ ID NO: 6, a homologue thereof, a conjugate or a fusion protein thereof, and comprising Encoding for the ChCas12b protein, its homologues, conjugates or fusion proteins comprising the CRISPR repeat sequence shown in SEQ ID NO: 18, comprising at least 90% sequence identity with SEQ ID NO: 18 and retaining its biological activity The homologous sequence of or comprising the nucleotide sequence (such as the nucleic acid sequence shown in SEQ ID NO: 22) of the single-stranded guide RNA based on SEQ ID NO: 18 transformation obtained and retaining its biological activity;

5) The vector according to claim 9; or

6) CRISPR/Cas12 gene editing system according to claim 11;

as well as

b. Instructions on how to perform gene editing on a target sequence in a cellular or in vitro environment.