CN108753732B

CN108753732B - RXR alpha protein stable low-expression RXR alpha gene knockout cell line and preparation method thereof

Info

Publication number: CN108753732B
Application number: CN201810692094.1A
Authority: CN
Inventors: 张建清; 李云秀; 蒋友胜; 吴东亭; 彭金铃
Original assignee: Shenzhen Center For Disease Control And Prevention (shenzhen Health Inspection Center Shenzhen Institute Of Preventive Medicine)
Current assignee: Shenzhen Center For Disease Control And Prevention (shenzhen Health Inspection Center Shenzhen Institute Of Preventive Medicine)
Priority date: 2018-06-28
Filing date: 2018-06-28
Publication date: 2021-01-26
Anticipated expiration: 2038-06-28
Also published as: CN108753732A

Abstract

The invention belongs to the technical field of biological preparation, and particularly relates to an RXR alpha gene knockout cell line with stable and low expression of RXR alpha protein and a preparation method thereof. The cell line is an RXR alpha gene knockout cell line, the number of knocked bases is not an integral multiple of 3, the expression of RXR alpha protein in the cell is obviously reduced, the genotype is stable and can be passaged, so that the stability of the RXR alpha protein low-expression cell line is greatly improved, and the stable passage and continuous culture of the cell line are facilitated. The invention provides a preparation method of the cell line, which comprises the steps of designing a CRISPR knockout gRNA sequence according to RXR alpha gene sequence information, constructing a gRNA expression vector, and detecting gRNA shearing activity at an in vitro cell level. Then, a nuclear transfer method is adopted, cas9 and a gRNA expression vector are used for co-transfecting an immortalized cell of human neuroblastoma, namely an SK-N-SH cell, stable cell clone is obtained through G418 drug screening, and the cell clone which is not knocked out by an integral multiple 3 gene of the RXR alpha gene is identified through PCR and gene sequencing, so that an RXR alpha gene knocked-out cell line with RXR alpha protein stable low expression is obtained.

Description

RXR alpha protein stable low-expression RXR alpha gene knockout cell line and preparation method thereof

Technical Field

The invention belongs to the technical field of biological preparation, and particularly relates to an RXR alpha gene knockout cell line with stable and low expression of RXR alpha protein.

Background

There are three major spliceosomes for the mRNA of the RXR (Homo sapiens discontinuous X receptor) gene, namely RXR α (NM _002957.5), RXR β (NM _001291920.1) and RXR γ (NM _ 001291921.1).

The RXR alpha receptor in cells can be combined with various medicaments, and is closely related to a plurality of diseases of human beings, including but not limited to tumors, diabetes, neurodegenerative diseases and steatohepatitis. The construction of the RXR alpha protein high expression and low expression cell line is helpful for discussing the pathogenesis of diseases related to the RXR alpha receptor and developing effective medicaments aiming at disease targets. The CRISPR/Cas technology is to use a specific guide RNA (sequence-specific guide RNA) to guide endonuclease Cas9 protein to cut at a target point to form a DNA Double-strand Break (DSB), and this DNA damage can initiate a repair mechanism in a cell, and mainly includes two pathways: the first is a low fidelity Non-homologous end joining pathway (NHEJ), which is a major repair mechanism for DNA breakage damage in cells, and the repair mechanism is very prone to errors, resulting in base deletion or insertion after repair, thereby causing frame shift mutation and finally achieving the purpose of gene knockout. The second DNA break repair pathway is homology-mediated repair (HR), which is a repair mechanism based on homologous recombination with high fidelity but low probability of occurrence.

For example, the effective construction of a cell line with RXR alpha protein stable low expression is important for the research of the biological effect of RXR alpha protein in organisms and the development of drugs for related diseases, and the invention aims to solve the problem.

Disclosure of Invention

In view of the problems in the prior art, the primary object of the present invention is to provide a cell line for knockout of RXR α gene with stable and low expression of RXR α protein, wherein the cell line is obtained by knocking out a designed gene sequence from an immortalized cell (SK-N-SH cell) taken from human neuroblastoma (RXR/KO-SK-N-SH cell), and the knocked-out site is 1 st to 180 th bases of the 4 th exon of the RXR α gene.

Specifically, the cell lines are RXR/KO-SK-N-SH-7# (or RXR/KO-SK-N-SH-35#) and RXR/KO-SK-N-SH-15#, RXR/KO-SK-N-SH-7# (or RXR/KO-SK-N-SH-35#), respectively, and are RXR alpha allele knock-out homozygote cell lines; the RXR/KO-SK-N-SH-15# is an RXR alpha gene double-genotype knockout cell line; the sequences of the knockout are 61-122(62bp) and 61-122(62bp), 61-70(10bp) and 114-141(28bp) bases of the 4 th exon of RXR alpha respectively, and the sequences are Seq No.1, Seq No.2 and Seq No.3 respectively.

The cell line is identified by gene sequencing and Western Blot, and shows that the cell lines constructed by the invention are cell lines knocked out by RXR alpha genes, the expression level of RXR alpha protein is obviously reduced, and the expression level of the RXR alpha protein of the cell line is 13% and 17% of that of wild SK-N-SH cells (P is less than 0.01); the cell line is a RXR alpha allele knockout homozygote and RXR alpha gene double-genotype knockout cell line, the cell line is stable in genotype, mRNA and protein of an RXR alpha receptor can be stably and lowly expressed in cells, and the processes of drug screening and protein expression level identification are not required to be regularly carried out, so that the cell construction procedure is simplified, the reliability, the stability and the research efficiency of research on related functions of the RXR alpha protein on a test material are greatly improved, wild cells are not doped, and the proliferation culture difficulty of the RXR alpha protein underexpression cells is reduced. The cell strain obtained by the invention has no wild type doping, and compared with the prior art of liposome transfection technology in the world, the scheme has obvious advantages.

Another object of the present invention is to provide a method for preparing said cell line. The method is detailed as follows:

(1) according to RXR alpha gene sequence information, 3 pieces of gRNA (3) are knocked out by CRISPR, a gRNA expression vector is constructed, and the gRNA expression vector and a cas9 expression vector are co-transfected to PK15 pig kidney cell in vitro cell level to detect gRNA shearing activity.

(2) And then, transfecting SK-N-SH neuroblastoma cells by a gRNA expression vector and a cas9 expression vector by a nuclear transfer method, screening by G418 drugs to obtain stable cell clones, identifying whether the stable cell clones are cell clones knocked out by non-3 integral multiple bases of RXR alpha genes by PCR and gene sequencing, and finally identifying the RXR alpha protein expression level of the stable cell clones by Western blot to obtain the RXR alpha protein stable low-expression cell line with the genotype capable of being stably inherited.

Specifically, the preparation method comprises the following preparation steps:

(1) setting RXR alpha gene knockout target sites and designing gRNA;

(2) constructing a gRNA expression vector;

(3) identification of gRNA cleavage activity: performing lipofection on PK15 pig kidney cells, and performing enzyme digestion on the PK15 pig kidney cells by using T7E1 to identify the gRNA shearing activity;

(4) screening of RXR alpha gene knockout cell lines: transfecting a gRNA expression vector and a cas9 expression vector into an SK-N-SH neuroblastoma cell in a nuclear transfer mode, and adding G418 to perform screening, cloning and culturing;

(5) identification of RXR alpha gene knockout cell lines.

The preferable scheme of the step (1) is that according to the RXR alpha gene sequence, an exon4 shared by RXR alpha-a/b/c is selected as a knockout target site; the CRISPR knockout gRNA was designed using online software CRISPR DESIGN software, and complementary DNAOligos primers were synthesized.

Compared with the prior art, the invention has the technical effects that:

(1) the invention effectively constructs a cell line with RXR alpha protein stable low expression, the expression quantity of the RXR alpha protein of the cell line is 13 percent and 17 percent of that of wild SK-N-SH cells (P is less than 0.01); the cell line is a double-genotype knockout cell line of an RXR alpha allele knockout homozygote and an RXR alpha gene, has stable genotype, can stably and lowly express the RXR alpha protein, and does not need to periodically screen medicines and identify the protein expression level, thereby greatly improving the reliability and the research efficiency of a test material for researching the related functions of the RXR alpha protein and reducing the proliferation culture difficulty of the RXR alpha protein lowly-expressed cells.

(2) The cell strain obtained by the invention has no wild type doping, and compared with the prior art of liposome transfection technology in the world, the scheme has obvious advantages.

(3) The preparation method simplifies the procedure of cell construction, is simple and easy to obtain, has good reproducibility, and is beneficial to industrial application.

Drawings

FIG. 1, schematic representation of knockout site selection.

FIG. 2, gRNA sequence design schematic.

FIG. 3, schematic cell morphology of PK15 after 17h transfection of porcine kidney cells with EGFP.

FIG. 4, expression of EGFP green fluorescent protein 17h after transfection of EGFP into PK15 pig kidney cells.

FIG. 5 shows a flowchart for identifying the cleavage activity of gRNA plasmid.

FIG. 6, schematic representation of the results of three gRNA activity identifications.

FIG. 7 is a diagram showing the results of the enzyme-mixed cutting of the first cell clone T7, wherein 7(a) -7(c) are diagrams showing the results of the enzyme-mixed cutting of T7 of different cell clones.

FIG. 8 shows the results of enzymatic excision of the first cell clone T7.

FIG. 9 shows the cleavage of the second cell clone T7.

FIG. 10 is a schematic diagram of the identification of the relative expression of RXR alpha protein of the RXR alpha gene knockout cell line of the invention, wherein, 1-3 wild type cells; 7# cells are knocked out by 4-6RXR alpha genes; 7-10RXR alpha gene knockouts 15# cells.

FIG. 11 is a schematic diagram of the determination of the relative expression of RXR alpha protein in the RXR alpha gene knockout cell line of the present invention, wherein SK-N-SH is a wild-type cell; RXR/KO-SK-N-SH-7# is RXR alpha gene knockout No. 7 cell; RXR/KO-SK-N-SH-15# is a cell with RXR alpha gene knocked out by 15 #.

Detailed Description

The present invention will be described in further detail with reference to examples and drawings, but the embodiments of the invention are not limited thereto.

Example 1

(1) Setting of RXR alpha gene knockout target site and design of gRNA

Selecting an exon4 shared by RXR alpha-a/b/c as a knockout target sequence according to an RXR alpha gene sequence, designing a CRISPR target site, and performing knockout site selection at the position indicated by an arrow in figure 1;

the selected target site for the knockout is 1-180 th base of the 4 th exon of RXR alpha gene, and DNA Oli gos primers are designed by 44-66(CTTCAAGCGGACGGTGCGCAAGG), 79-101(CCTGCCGCGACAACAAGGACTGC) and 106-128(TTGACAAGCGGCAGCGGAACCGG) th bases respectively to synthesize double-stranded gRNA.

CRISPR knock-out grnas were designed using online software and complementary DNAOligos primers were synthesized, see the gRNA sequence design shown in fig. 2.

In fig. 2, Guid #1- #5 are knock-out target sites with higher scores selected by software design, Guid #1, #2, #5 are selected to design gRNA synthesis primers, and the corresponding primer sequences are RXR α -gRNA-F1/R1, RXR α -gRNA-F2/R2, RXR α -gRNA-F3/R3, respectively, and the sequences are as follows:

RXRα-gRNA-F1:ACCG CTTCAAGCGGACGGTGCGCAG

RXRα-gRNA-R1:AAAAC TGCGCACCGTCCGCTTGAAG；

RXRα-gRNA-F2:ACCG GCAGTCCTTGTTGTCGCGGC G

RXRα-gRNA-R2:AAAAC GCCGCGACAACAAGGACTGC；

RXRα-gRNA-F3:ACCG TTGACAAGCGGCAGCGGAACG

RXRα-gRNA-R3:AAAACGTTCCGCTGCCGCTTGTCAA。

RXR alpha gene amplification primers are RXR alpha-iden-F1: AGGCCATTCCAGGGTTCTC, RXR alpha-iden-R1: CTGTTGTCCATCTCGGGTGT during gRNA activity identification; the total length of the RXR alpha sequence amplified by the primer is 748 bp. If gRNA is inactive, only one sequence with the total length of 748bp is obtained after agarose gel electrophoresis; if the gRNA has cleavage activity, it can cause gene deletion or insertion, and its PCR product can be cut by T7 enzyme, and there are many bands after agarose gel electrophoresis.

(2) Construction of gRNA expression vector

After gRNA synthesis, primers are dissolved into 10 mu M by water, 10 mu L of primers are added respectively at upstream and downstream, the temperature is 95 ℃, 10min and the room temperature is 30min, then a framework is connected, the framework is a T vector which is connected with a U6 promoter and gRNAtail, and the enzyme cutting site is BsaI. After backbone preparation, ligation was performed with T4 ligase for 4h at 16 ℃.

After connection, single plasmid clone is selected by transformation and plate coating, the accuracy of the plasmid clone core sequence is detected by sequencing, and a large amount of plasmids are extracted by shaking bacteria and frozen.

(3) Liposome transfection

The method of CRISPR-Cas9 is used for verifying the shearing activity of the plasmid by transiently transfecting cells and detecting the integrity of a target gene.

(3.1) the PK15 porcine kidney cells were recovered in 24-well plates (4 wells) and transiently transfected according to the invitrogen lipofectamin2000 protocol. One well was transfected with the EGFP plasmid to observe transfection efficiency, and another well was co-transfected with the plasmid, respectively. The transfection parameters were as follows:

liposome transfection parameter A solution

And B, liquid B: lipo2000(1.5 μ l) + Opti-Mem (23.5 μ l) ═ 25 μ l

And mixing the solution A and the solution B and transfecting the mixture into four-hole cells.

(3.2) determining the transfection condition of the target plasmid according to the fluorescence expression intensity 17h after the PK15 porcine kidney cells are transfected with the EGFP plasmid. After 17h of transfection of the PK15 porcine kidney cells with the EGFP plasmid, pictures are taken by a fluorescence microscope, and the expression of the EGFP in the cells is shown in the figure 3 and the figure 4. FIG. 3 is the initial state of cells under natural light of a fluorescence microscope after PK15 pig kidney cells are transfected for 17h, and shows that the cell contour is clear after liposome transfection, which shows that the liposome transfection has no obvious influence on the cell activity. FIG. 4 is the same as the field of view of the microscope of FIG. 3, showing the fluorescence state of EGFP green fluorescent protein at the excitation wavelength, reflecting the transfection efficiency of the experimental group liposome by observing the fluorescence expression ratio, and determining whether the experimental group cells can be used for the later activity identification. The comparison of the two figures shows that the transfection efficiency reaches more than 80 percent, and PK15 porcine kidney cells can be used as a template for activity identification.

(3.3) characterization of gRNA cleavage Activity

This is performed with reference to the flow shown in fig. 5. And collecting cells after the cell transfection is finished for 48 hours, extracting DNA, and performing activity identification by using a T7 endonuclease method. The principle of identifying the activity of the gRNA vector by T7 enzyme digestion is as follows: specific guide RNA molecules (sequence-specific guide RNA, gRNA) in a CRISPR-Cas9 system specifically recognize RXR alpha gene knockout site sequences, guide endonuclease Cas9 protein to cut at a target spot to cause partial base deletion or change, after the sequence is amplified, the sequence is denatured and renatured, a wild type sequence and a mutant type sequence in a PCR product can anneal to form double chains, the base change at the cutting position cannot realize alkaline complementation and can form a bubble-shaped DNA structure, and T7 endonuclease can specifically cut the bubble-shaped single chain and cut the PCR product into two sections. Thus, the electrophoretic bands after cleavage with T7 appear as multiple bands.

(3.3.1) primer information

TABLE 3-1 table of the Activity cause

(3.3.2) PCR reaction System

And (3) injection and analysis: 1: the enzyme Premix EXTTaq from TAKARA was used

TABLE 3-2 PCR reaction System

(3.3.3) PCR reaction conditions

TABLE 3-3 PCR reaction procedure

The sizes of bands after enzyme digestion are shown in FIG. 6, and the sizes of the bands after enzyme digestion of the three gRNAs are 536+212, 566+182 and 602+146 respectively.

The process is a PCR amplification procedure: pre-denaturation at 98 ℃ for 5 min; denaturation at 98 ℃ for 10 sec; annealing at 55 deg.C for 30sec, extending at 72 deg.C for 1min, and circulating for 35 times; extending for 5min at 72 ℃ to ensure the completeness of extension and the completeness of PCR amplification; and (3) cooling and storing at 20 ℃ for 2min, and increasing the stability of the PCR product.

(4) Screening of RXR alpha gene knockout cell lines:

the verification proves that the three gRNAs have gene shearing activity and can be applied to the construction of a gene knockout cell line. When the SK-N-SH cell culture growth reaches 80% -90% confluence, the plasmid is subjected to nuclear transformation by a nuclear transformation instrument according to the proportion of gRNA1, gRNA2, gRNA3, cas9 and pcDNA3.1, namely 1:1:1:2:1, and the cell generation number is P3. Cell transfection was observed 24h after transfection. And (4) dividing the plate when the confluence degree reaches 80-90%, adding G418 the next day for screening, and obtaining the monoclonal after 7 days. Selecting the monoclonal to be cultured in a 96-well plate, expanding the monoclonal to a 48-well plate after the monoclonal grows full, continuing culturing, digesting half of the cells to be used as lysate for PCR identification when the confluence degree is 80-90%, and culturing the rest cells in original wells.

(5) Identification of RXR α gene knockout cell lines:

(5.1) enzymatic identification of cell clone T7

T7 enzyme digestion is adopted to identify whether the cell is a gene knockout cell clone, and PCR amplification and T7 enzyme digestion are required. Performing PCR amplification by adopting a 20-microliter system, sampling 2 microliter of PCR products, dividing the rest 18 microliter into two groups, mixing 9 microliter of PCR products with water at a ratio of 1:1, mixing the other 9 microliter of PCR products with wild type PCR products at a ratio of 1:1, performing T7 enzyme digestion after denaturation annealing, and indicating heterozygous knockout if the PCR products can be cut by direct cutting, and indicating homozygous knockout if the PCR products can be cut by mixed cutting. If the mixture is not cut, the result is negative.

The project selects 250+ cell clones to identify 140 cell lines, and because the identification quantity is large, the cell clones are firstly mixed and cut, and then the mixed and cut cell clones are selected to be directly cut, wherein the first cell clone T7 enzyme mixed cutting result is shown in figure 7, and the first cell clone T7 enzyme directly cut result is shown in figure 8.

The T7 enzyme digestion identification result shows that the No. 35 clone cell can be cut by T7 enzyme mixed cutting but can not be cut directly, so that the No. 35 clone cell can be preliminarily identified as homozygous knockout and is named as RXR/KO-SK-N-SH-35 #.

Wherein, a suspected positive clone RXR/KO-SK-N-SH-35# is obtained by identifying one batch; the other batch is identified to obtain two suspected positive clones, No. 7 and No. 15 respectively, the T7 enzyme digestion results are shown in FIG. 9, and the cell lines are RXR/KO-SK-N-SH-7#, RXR/KO-SK-N-SH-15 #.

(5.2) sequencing of the Gene suspected of Positive clone

Carrying, detecting and sequencing the PCR products of the 7#, 15#, and 35# suspected positive clone cell lysates with T, wherein the 7# and 35# genotypes are the same and are the gene knockout of the 61 th-122 (62bp) th base deletion of the 4 th exon of the RXR alpha allele, and the RXR/KO-SK-N-SH-7# and the RXR/KO-SK-N-SH-35# are RXR alpha allele knockout homozygotes; 15# is a RXR alpha gene double-genotype knockout cell line, which is the deletion of the 61 st to 122 th (62bp) and 61 st to 70 th (10bp) bases of the 4 th exon of RXR alpha and 114 th and 141 th (28bp) bases respectively. All 3 cell lines are knocked out of non-3 integral multiple bases, and all the cell lines can generate effective frame shift mutation, so that the gene knocking-out effect is finally achieved.

(5.3) identification of RXR alpha protein expression level of RXR alpha gene knockout positive clone RXR alpha

Gene sequencing shows that the genotypes of RXR/KO-SK-N-SH-7# and RXR/KO-SK-N-SH-35# are the same, so Western Blot identification is only carried out on the two cell lines of RXR/KO-SK-N-SH-7# and RXR/KO-SK-N-SH-15# in the part. The identification results are shown in fig. 10 and 11, and the RXR alpha protein expression in 7# and 15# cells is obviously reduced, and the RXR alpha protein expression amount of 7# and 15# cell lines is 13% and 17% of WT cells (P < 0.01).

The identification results show that through the partial research, the laboratory successfully constructs the RXR alpha gene knockout cell line with stable and low expression of the RXR alpha protein, the cell line is RXR/KO-SK-N-SH-7# (or RXR/KO-SK-N-SH-35#), and RXR/KO-SK-N-SH-15#, and the RXR alpha protein low expression research test material can be provided for subsequent tests.

The above embodiments are preferred embodiments of the present invention, but the present invention is not limited to the above embodiments, and any other changes, modifications, substitutions, combinations, and simplifications which do not depart from the spirit and principle of the present invention should be construed as equivalents thereof, and all such changes, modifications, substitutions, combinations, and simplifications are intended to be included in the scope of the present invention.

Sequence listing

<110> Shenzhen disease prevention and control center

<120> RXR alpha protein stable low-expression RXR alpha gene knockout cell line and preparation method thereof

<160> 3

<170> SIPOSequenceListing 1.0

<210> 1

<211> 62

<212> DNA

<213> RXR α exon4, base 61 to 122 (Artificial Sequence)

<400> 1

gcaaggacct gacctacacc tgccgcgaca acaaggactg cctgattgac aagcggcagc 60

gg 62

<210> 2

<211> 10

<212> DNA

<213> RXR α exon4 base 61 to 70 bases (Artificial Sequence)

<400> 2

gcaaggacct 10

<210> 3

<211> 28

<212> DNA

<213> RXR α exon4, base 114 to 141 (Artificial Sequence)

<400> 3

cggcagcgga accggtgcca gtactgcc 28

Claims

1. A RXR alpha gene knockout cell line with RXR alpha protein stable low expression is characterized in that the cell line is formed by knocking out target sites from an immortalized cell, namely SK-N-SH cell, taken from human neuroblastoma through CRISPR DESIGN software design, and cloning cells obtained after gene knockout, wherein the target sites of the gene knockout are the 1 st to 180 th basic groups of the 4 th exon of the RXR alpha gene;

the cell lines are RXR/KO-SK-N-SH-7# and RXR/KO-SK-N-SH-15# respectively;

RXR/KO-SK-N-SH-7# is an RXR alpha allele knockout homozygote, RXR/KO-SK-N-SH-15# is an RXR alpha gene double-genotype knockout cell line, and is respectively subjected to base deletion at 61-122(62bp) and 61-122(62bp), 61-70(10bp) and 114-141(28bp), and the knockout sequences are respectively Seq No.1, Seq No.2 and Seq No. 3.

2. A method for preparing the RXR alpha gene knockout cell line with stable and low expression of the RXR alpha protein according to claim 1,

(1) according to RXR alpha gene sequence information, a CRISPR knockout gRNA is designed, a gRNA expression vector is constructed, and the gRNA expression vector and a cas9 expression vector are co-transfected to PK15 pig kidney cell in vitro cell level to detect gRNA shearing activity;

(2) by adopting a nuclear transfer method, a gRNA expression vector and a cas9 expression vector transfect a neuroblastoma cell SK-N-SH together, a G418 drug is adopted for screening to obtain a stable cell clone, PCR and gene sequencing are used for identifying whether the stable cell clone is a gene knockout cell clone with RXR alpha gene deletion of non-3 integral multiple of bases, and finally, the RXR alpha protein expression level is identified by Western blot to obtain an RXR alpha gene knockout cell line with a genotype capable of being stably inherited.

3. The method according to claim 2, comprising the following steps:

(1) setting RXR alpha gene knockout target sites and designing gRNA;

(2) constructing a gRNA expression vector;

(3) identification of gRNA cleavage activity: carrying out lipofection, and carrying out enzyme digestion on T7E1 to identify the gRNA shearing activity;

(4) screening of RXR alpha gene knockout cell lines: co-transfecting a gRNA expression vector and a cas9 expression vector to SK-N-SH neuroblastoma cells in a nuclear transfer mode, and adding G418 to perform screening, cloning and culturing;

(5) identification of RXR alpha gene knockout cell lines.

4. The preparation method according to claim 3, wherein the step (1) is to select exon4 shared by RXR α -a/b/c as a knock-out site according to the sequence of the RXR α gene, design a CRISPR knock-out target site, the selected knock-out target site is the bases of the 4 th exon of the RXR α gene from 1 to 180 th, and design DNA Oligos primers with the bases of the 4 th exon of the RXR α gene from 44 to 66(CTTCAAGCGGACGGTGCGCAAGG), from 79 to 101(CCTGCCGCGACAACAAGGACTGC) and from 106 and 128(TTGACAAGCGGCAGCGGAACCGG) to synthesize double-stranded gRNA;

CRISPR knockout grnas were designed using online software CRISPRDESIGN, and complementary DNA Oligos primers were synthesized.

5. The method according to claim 3, wherein the step (2) is a gRNA vector construction, and the method specifically comprises: after gRNA synthesis, primers are dissolved into 10 mu M by water, 10 mu L of primers are added respectively at upstream and downstream, the temperature is 95 ℃, 10min and the room temperature is 30min, then a framework is connected, the framework is a T vector which is connected with a U6 promoter and gRNAtail, the enzyme cutting site is BsaI, and after the framework is prepared, the T4 ligase is used for connecting for 4h at 16 ℃.

6. The preparation method according to claim 3, wherein the step (3) is to verify the shearing activity of the plasmid by transiently transfecting cells and detecting the integrity of the target gene by using the method of CRISPR-Cas 9; :

(3.1) recovering PK15 pig kidney cells in a 24-well plate, and transiently transfecting the cells according to invitrogen lipofectamin2000 instructions, wherein the total number of the wells is 4; one well was transfected with EGFP plasmid to observe transfection efficiency, and the other three wells were co-transfected with gRNA vector plasmids, respectively;

(3.2) determining the transfection condition of the target transfection plasmid according to the fluorescence expression intensity 17h after the PK15 pig kidney cells are transfected with the EGFP plasmid;

(3.3) collecting cells after cell transfection is finished for 48 hours, extracting DNA, and performing activity identification by using a T7 endonuclease method;

reaction procedure: the enzyme was cleaved at 37 ℃ for 60 min.

7. The method according to claim 3, wherein the step (4) is:

cell transfection:

the verification proves that the three gRNAs have gene shearing activity and can be applied to the construction of a knockout cell line; when the SK-N-SH cell culture growth reaches 80% -90% confluence, carrying out nuclear transformation on the plasmid by using a nuclear transformation instrument according to the proportion of gRNA1, gRNA2, gRNA3, cas9 and pcDNA3.1 to 1:1:1:2:1, wherein the cell generation number is P3; observing cell transfection conditions 24h after transfection; dividing into disks when the confluence degree reaches 80% -90%, adding G418 for screening the next day, and obtaining monoclone after 7 days; selecting the monoclonal to be cultured in a 96-well plate, expanding the monoclonal to a 48-well plate after the monoclonal grows full, continuously culturing, digesting half of the cells to be used as lysate for PCR identification when the confluence degree is 80-90%, and culturing the rest cells in original wells.

8. The method according to claim 3, wherein the step (5) is:

(5.1) enzymatic identification of the cell clone T7 EI:

adopting T7 enzyme digestion to identify whether the cell is a gene knockout cell clone, and carrying out PCR amplification and enzyme digestion; performing PCR amplification by adopting a 20-mu-L system, removing 2 mu L of PCR products for sample application, dividing the rest 18 mu L into two groups, mixing 9 mu L with water in a ratio of 1:1, mixing the other 9 mu L with a wild type PCR product in a ratio of 1:1, performing denaturation annealing, and performing T7 enzyme digestion; if the straight cutting can be cut, the heterozygous knockout is shown, and if the straight cutting cannot be cut, the homozygous knockout is shown if the mixed cutting can be cut; the batch is identified to obtain a suspected positive clone RXR/KO-SK-N-SH-35 #; the other batch is identified to obtain two suspected positive clones, namely RXR/KO-SK-N-SH-7# and RXR/KO-SK-N-SH-15 #;

(5.2) sequencing the gene of the suspected positive clone cell:

the PCR product of the suspected positive clone cell lysate is subjected to loading, detection and sequencing with T, and the result shows that 7# and 35# have the same genotype and are homozygotes knocked out by RXR alpha allele, and 15# is an RXR alpha gene double-genotype knocked-out cell line; the base deletions of 61-122(62bp), 61-70(10bp) and 114-141(28bp) of the 4 th exon of the RXR alpha gene respectively;

(5.3) positive clone cell protein expression level identification:

through Western Blot identification, the expression level of the RXR alpha protein in the cells is reduced after the RXR alpha gene knockout cell line constructed by the invention is subjected to RXR alpha gene knockout.

9. An RXR alpha gene knockout cell line with RXR alpha protein stably expressed at low level is characterized in that the cell line is RXR/KO-SK-N-SH-7# or RXR/KO-SK-N-SH-35#, RXR/KO-SK-N-SH-15#, and the cell line is prepared by the preparation method of any one of claims 2 to 8.