CN111876422A - Screening report system capable of being used for enriching CRISPR/Cas9-mediated accurate NHEJ repair cells - Google Patents

Abstract

The invention discloses a screening report system for enriching CRISPR/Cas9-mediated accurate NHEJ repair cells, which comprises an accurate NHEJ repair screening report vector and a cell genome long fragment targeting vector co-transfected in target editing cells with the screening report vector, wherein the accurate NHEJ repair screening report vector comprises a screening report gene expression box and two sgRNA expression boxes, a transcription region of the screening report gene expression box comprises a double sgRNA target site construction sequence inserted in a selected partition position of a drug screening gene sequence, and the double sgRNA target sites respectively take sgRNAs transcribed by the two sgRNA expression boxes as guide sequences of the targeting screening report gene expression box. The screening report system of the invention can efficiently enrich the positive cell clone with the target gene long segment accurately deleted by cotransfection and drug screening.

Description

Screening report system capable of being used for enriching CRISPR/Cas9-mediated accurate NHEJ repair cells

Technical Field

The invention belongs to the technical field of genetic engineering, and relates to a construction method of a screening report vector for enriching CRISPR/Cas9-mediated accurate NHEJ repair cells and application of the screening report vector in accurate deletion of cell genome long fragments.

Background

Accurate editing, which enables safe modification of the genome, is becoming an important means for studying gene functions and breeding new animal species. The CRISPR/Cas9 technology can modify a target gene more conveniently and efficiently, and in a CRISPR/Cas9 system, a Cas9 nuclease can perform targeted recognition on a target genome site under the guidance of a single-stranded guide RNA (sgRNA) to trigger double-strand breaks (DSBs) of DNA. There are two major pathways for double strand break Repair (Repair) of DNA: non-homologous end joining (NHEJ) and homologous recombination (HDR). Classical NHEJ is considered to be an error-prone DSBs repair pathway, usually leading to random insertions or deletions (indels) of the target site. And HDR is more suitable for precise editing such as single base substitution, target fragment typing and knockout and the like.

Classical NHEJ pathway mediated gene fragment deletion has been the first choice for gene deletion, but due to its small indels, the deleted genotype cannot be accurately predicted and set. Thus, classical NHEJ-mediated gene deletion individuals have a certain degree of genetic safety problems. HDR-mediated donor-dependent gene fragment deletion can achieve the purpose of precise editing, but the efficiency of HDR repair is far lower than NHEJ repair in practical application, and the repair efficiency of HDR decreases with the extension of the length of the edited fragment (donor integration), and is difficult to be widely applied.

Recent studies have found a DNA double strand break repair mode different from the classical NHEJ pathway, in which when Cas9 nuclease causes double strand break of DNA, both free ends of DNA are not digested and modified, but the break cuts are directly connected by DNA ligase. This repair is known as exact-NHEJ repair (Accurate-NHEJ, acNHEJ for short). The repair of acNHEJ is accurate and predictable, and the repair efficiency of acNHEJ is nearly the same as that of classical NHEJ. However, the length of the precise fragment deletion mediated by acNHEJ repair is only within 100bp, and the precise deletion of the long fragment mediated by acNHEJ is not reported.

CRISPR/Cas9 in combination with NHEJ mediated repair of DSBs is commonly used for gene deletion studies. However, with the continuous innovation of gene editing technology, the research application of gene editing on animal individuals has begun to shift to the safe and accurate direction. Therefore, whether a target gene can be efficiently and accurately edited becomes a standard whether a gene editing tool can be widely used. At present, the technical problems to be solved are needed: improving the efficiency of precisely deleting long gene fragments and developing a corresponding gene editing/screening report system.

Disclosure of Invention

The invention aims to provide a screening report system for enriching CRISPR/Cas9-mediated accurate NHEJ repair cells.

In order to achieve the purpose, the invention adopts the following technical scheme:

an accurate NHEJ repair recombination screening gene comprises a double sgRNA target site construction sequence which is inserted into a selected partition position of a screening/reporting gene (such as a drug screening gene) sequence (the partition position is positioned between two bases in the drug screening gene sequence, the drug screening gene is recombined by inserting the double sgRNA target site construction sequence, and the expression of the drug screening gene can be blocked), wherein the double sgRNA target site construction sequence comprises a three-base sequence which is used for forming two sgRNA sequences with a gene (such as the drug screening gene) target sequence positioned at the upstream and downstream of the partition position, and two PAM sequences which are respectively connected with the corresponding sgRNA sequences.

Preferably, the double sgRNA target site construction sequence further comprises an unrelated sequence (without any target sequence) for linking the two PAM sequences.

Preferably, the unrelated sequence is a short fragment of 130-150 bp.

An accurate NHEJ repair screening report vector comprises a screening report gene expression box and two sgRNA expression boxes, wherein a transcription region of the screening report gene expression box comprises a fluorescent report gene sequence and an accurate NHEJ repair recombination screening gene sequence constructed by utilizing a drug screening gene (and the double sgRNA target site construction sequence), and the double sgRNA target sites respectively use sgRNAs transcribed by the two sgRNA expression boxes as guide sequences for targeting the accurate NHEJ repair recombination screening gene sequence.

Preferably, the precise NHEJ repair screening reporter vector performs precise NHEJ repair by disrupting the double sgRNA target site of the CRISPR/Cas9-mediated reporter vector itself (specifically, the precise NHEJ repair recombination screening gene sequence) in the transfected target editing cell, restores (i.e., removes the disruption by precise deletion of the double sgRNA target site construct sequence) the drug screening gene sequence in the transcription region of the screening reporter expression cassette and allows the precise NHEJ repair screening reporter vector to express corresponding drug resistance.

Preferably, the fluorescent reporter gene sequence is co-expressed with the reconstituted drug selection gene sequence, wherein the fluorescent reporter gene sequence is located downstream of the precise NHEJ repair recombination selection gene sequence (i.e., downstream of the reconstituted drug selection gene sequence).

Preferably, the screening reporter gene expression cassette further comprises eukaryotic promoter and termination sequences flanking the transcribed region of the expression cassette.

A system for screening enriched long-fragment precise deletion cells comprises the precise NHEJ repair screening report vector and a first targeting vector and a second targeting vector which are co-transfected with the screening report vector in a target editing cell and used for precisely deleting (for example, repairing through precise NHEJ) long fragments among selected sites of a cell genome, wherein the length of the long fragments is more than or equal to that of the double sgRNA target site construction sequences.

Preferably, the long fragment is 100-1300 bp.

The invention has the beneficial effects that:

the invention constructs a double-target site recognition sequence structure on the basis of an accurate NHEJ repair mechanism, and constructs a universal screening report vector based on double sgRNA-CRISPR/Cas9 mediated accurate deletion by utilizing the sequence structure. The screening reporter vector itself can be self-cleaved and then the complete drug screening gene sequence generated by precise NHEJ repair. After the screening report vector and targeting vectors of various different target genes are respectively cotransfected and subjected to drug screening, positive cell clones with target gene long fragments accurately deleted can be enriched and obtained.

The invention establishes a vector system which can be specially applied to screening and enriching long-fragment accurate deletion cells based on accurate NHEJ repair by utilizing the screening report vector. The system can simply, conveniently and efficiently screen and enrich precisely deleted cells on the premise of not influencing the integrity of genome, and can enable the precise deletion of the gene long fragment mediated by the double sgRNA-CRISPR/Cas9 and based on the precise NHEJ repair to be applied to the research of gene function, the cultivation of new animal species and the treatment of genetic diseases.

Drawings

FIG. 1 is a schematic diagram of screening report vector acNHEJ-USR.

FIG. 2 is a flow chart of the procedure for enriching precise NHEJ repair-mediated gene editing cells in a transfection system combining acNHEJ-USR and targeting vectors.

FIG. 3 shows the electrophoresis chart of pXL-CMV-Purol (CGAagg) vector enzyme digestion identification.

FIG. 4 shows the electrophoresis of pXL-CMV-Purol (CGAagg) - (cctTCG) Puror-T2A-GFP vector.

FIG. 5 shows the restriction map of pXL-U6-sgT1-U6-sgT2-CMV-Puro L.sgT1-sgT2.Puro R-T2A-GFP vector.

FIG. 6 is an acnHEJ-USR map.

FIG. 7 is a schematic of the knockdown at the AAVS1 site (AAVS1 genomic loci) (precise deletion of the about 1kb long fragment mediated by ACNHEJ).

FIG. 8 is the restriction enzyme identification electrophoretogram of pX330-U6-AAVS1.sgRNA1-spCas 9.

FIG. 9 is the restriction enzyme identification electrophoretogram of pX330-U6-AAVS1.sgRNA2-spCas 9.

FIG. 10 shows the cell pool genomic DNA amplification results.

FIG. 11 shows the results of TA cloning in different treatment groups.

FIG. 12 is a graph showing the effect of different screening methods on the efficiency of gene deletion at the AAVS1 site; wherein, WT%: the proportion of wild type gene copies that are not deleted; muNHEJ%: the proportion of gene copies that are not precisely deleted; acNHEJ%: the proportion of gene copies that are deleted exactly.

FIG. 13 is a schematic illustration of the knockdown in the lnc-sscg3623 site (acNHEJ mediated precise deletion of a long fragment of about 1200 bp).

FIG. 14 shows the result of the sequencing analysis of PK15 cells.

Detailed Description

The present invention will be described in further detail with reference to the accompanying drawings and examples. The embodiments are for facilitating understanding of the technical solutions of the present invention, and are not intended to limit the scope of the present invention.

(I) screening Reporter vector for enriching CRISPR/Cas9-mediated precise NHEJ repair cells (AccutateneJ-based Universal repair Reporter, ACNHEJ-USR)

Referring to fig. 1, the screening report vector acNHEJ-USR constructed in the present invention comprises two element units arranged in a linear relationship: one element unit mainly comprises two sgRNA expression cassettes U6-sgRNA which are both expressed by the promoter U6, the two sgRNA expression cassettes are connected in series, and when the sgRNAs expressed by the two sgRNA expression cassettes are different, the two sgRNA expression cassettes are distinguished by U6-sgT1 and U6-sgT2 respectively; the other element unit mainly comprises an expression cassette CMV-Purol.sgT1-sgT2.Puror-T2A-GFP which is initiated by a CMV promoter and contains a green fluorescent protein gene sequence GFP and a recombinant puromycin resistance gene sequence Purol.sgT1-sgT2.PruoR in a transcription region, and GFP and Purol.sgT1-sgT2.Puror are connected by a cleavage peptide sequence (for example, T2A). The expression cassettes in both element units have a termination sequence downstream of the transcribed region.

In the expression cassette CMV-purol.sgT1-sgT2.Puror-T2A-GFP, a recombinant puromycin resistance gene sequence Puro.sgT1-sgT2.Puror is constructed by inserting a section of exogenous sequence into the puromycin resistance gene sequence Puro (so that Puro is divided into two sections which are respectively marked as Purol and Puror), and specifically, a sequence which is used for forming two sgRNA target sites with puromycin resistance gene target sequences positioned on the upper stream and the lower stream of the partition position is inserted into the partition position selected from the Puro. The puromycin resistance gene is interrupted by the two sgRNA target sites, so that the expression cassette CMV-purOL.sgT1-sgT2.Puror-T2A-GFP can not normally express puromycin resistance and green fluorescent protein.

Since the two sgRNA target sites are respectively composed of a puromycin resistance gene sequence (target sequence) of 17bp, NNN of 3bp bases and a PAM sequence NGG, the 5 'end of the exogenous sequence is NNN-NGG, the 3' end is NGG-NNN, and the NNN of the 5 'end and the target sequence upstream thereof can constitute one sgRNA (e.g., sgrna.t1, abbreviated as sgT1), and the NNN of the 3' end and the target sequence downstream thereof can constitute another sgRNA (e.g., sgrna.t2, abbreviated as sgT 2).

The exogenous sequence also includes an unrelated sequence (a raff sequence) for separating two target sites without a target sequence (e.g., the puromycin resistance gene target sequence described above, a cellular genome target gene site target sequence). The size of the irrelevant sequence is 130-150bp (the literature reports that paired sgRNAs can efficiently mediate accurate deletion of genome position intervals of about 100bp, and the irrelevant sequence selected by the invention is more than 100bp, so that the working efficiency of a screening report vector acnHEJ-USR in cells is ensured, namely the efficiency of repairing the report vector through accurate NHEJ is ensured, and meanwhile, the efficiency of enriching long-fragment accurate deleted cells by using the screening report vector is improved).

In the screening reporter vector acNHEJ-USR, two sgrnas transcribed from two tandem sgRNA expression cassettes (e.g., sgrna.t1 and sgrna.t2) can guide Cas9 to recognize and target two sgRNA target sites in the expression cassettes CMV-purol.sgt1-sgt2.puror-T2A-GFP in the presence of Cas9, thereby initiating repair of fragmentation of acNHEJ-USR itself. By finishing the repair of accurate NHEJ, the exogenous sequence is deleted, and Puro separated into two sections is accurately repaired through acnHEJ to form the expression cassette CMV-Puro-T2A-GFP capable of normally expressing puromycin resistance and green fluorescent protein.

The working principle of screening report vector acNHEJ-USR is as follows: acNHEJ-USR itself can generate puromycin resistance through precise NHEJ repair, cotransfect acNHEJ-USR and a cell genome targeting vector (acNHEJ-mediated), and enrich gene editing cells for precise NHEJ repair (long fragment deletion) through puromycin drug screening.

Wherein, acNHEJ-USR can actually complete the repair in two ways: (1) if the acNHEJ-USR is repaired in a classical NHEJ (classic NHEJ) mode, random indels can be generated by the repair, so that the puromycin resistance gene sequence cannot be accurately repaired, the open reading frame of the gene is subjected to frame shift mutation, and the expression cassette CMV-purOL.sgT1-sgT2.purOR-T2A-GFP cannot be normally expressed, and the cell cannot have puromycin resistance. (2) If acNHEJ-USR is repaired in the exact nhej (accurate nhej) mode, the two sgrnas guide Cas9 to recognize the target site on purol.sgt1-sgt2.puror, and then cleave exactly at the 3 rd base upstream of the PAM sequence (the sgT2 sequence labeled in fig. 1 is cleaved 5' upstream of the PAM sequence in its complement) respectively. The resulting gap breaks discard the middle segment with a certain probability and are directly connected by means of exact NHEJ repair. Thus, the puromycin resistance gene is accurately repaired and can be completely expressed, and the cell has puromycin resistance. Meanwhile, the GFP gene sequence is connected in series behind the puromycin resistance gene sequence and is expressed along with the repair of the puromycin resistance gene. Role of green fluorescent protein: on the one hand, the efficiency of the precise repair in the cell pool is observed by green fluorescence, and on the other hand, the drug screening of puromycin resistance gene can be replaced by flow sorting.

Referring to fig. 2, the experimental procedure for specific screening enrichment is as follows:

1. designing a CRISPR/Cas9 targeting vector needing an editing site in a cell genome;

2. co-transfecting the constructed CRISPR/Cas9 targeting vector and acnHEJ-USR with a cell;

3. 48 hours after transfection, puromycin (puromycin) was added to the cell culture medium;

4. screening for 3-5 days by puromycin, and removing the drug;

5. diluting the screened cell pool by a limiting dilution method and then spreading the cell pool on a 96-well plate;

after 6.7 days, screening monoclonal cells, identifying by using PCR, and screening positive cell monoclonal with accurate deletion;

7. the positive monoclonal cells were transferred to a 24-well plate and expanded.

(II) construction example of screening report vector acNHEJ-USR

2.1 construction of pXL-CMV-Purol (CGAagg)

(1) Design of the complete sgRNA-Cas9 recognition targeting sequence (target site)

Two tandem sequences with a length of 17bp were selected as target sequences of Cas9 in the puromycin resistance gene sequence. Then, three bases and PAM sequences are artificially added to the two target sequences respectively, so as to obtain the following two target sites:

5’-ACGCCGGAGAGCGTCGACGAagg-3’

5’-cctTCGAGCGGGGGCGGTGTTCG-3’

in the target site, the underlined part is a target sequence selected from Puro, the italicized part is three bases added, and the lower case part is a PAM sequence. The two selected target sequences have no homology with species such as human, mice, pigs and the like through comparison, and the added three bases increase the universality of the target sequences.

(2) Using pPuro vector (any one of the commercial vectors for expressing puromycin resistance gene can be used) as a template, designing and synthesizing a pair of primers Puro-F (BamHI) and Purol-R (XbaI), and amplifying a fragment BamHI-Purol (CGAgg) -XbaI (272 bp);

Puro-F(BamHI):5’-CGCggatccATGACCGAGTACAAGCCCACG-3’

PuroL-R(XbaI):5’-TGCtctagaCCTTCGTCGACGCTCTCCGGCGTGG-3’

using Takara PrimSTAR polymerase, the amplification system was as follows (the following applies):

2 × GC buffer: 25 mu L of the solution; dNTPs: 4 mu L of the solution; upstream/downstream primers: 1. mu.L each (concentration 10. mu.M); PrimStaR polymerase: 0.5 mu L; DNA template: 0.5 mu g; water: fill 50 μ L.

Amplification procedure (both apply as follows):

1)98℃，1s；

2) 10s at 98 ℃; 62 ℃ for 5 s; 72 ℃ for 30 s; 40 cycles;

3)72 ℃ for 10 min; preserving at 10 deg.C.

The fragments BamHI-Purog (CGAgg) -XbaI and pXL-BacII (Wu et al, FEBS Letters,2017,591(6):903-913) were each double-digested with BamHI/XbaI (Table 1), and the digested products were recovered and ligated with T4 DNA ligase at 16 ℃ overnight (Table 2). The ligation product was transformed into E.coli competent DH5 alpha (Tiangen Biochemical, product No. CB101), amp resistance was selected, and bacterial monoclonals were picked and cultured in liquid medium at 37 ℃ for 8 hours with shaking.

TABLE 1 digestion reaction System

Note: the enzyme digestion reaction conditions are as follows: digestion at 37 ℃ for 4 hours

(3) Plasmids were extracted from the cultured broth and digested with BamHI/XbaI (Table 1). The electrophoresis bands of the positive clone plasmid after double digestion are 4088bp and 272bp (figure 3), the positive clone plasmid is sequenced and verified to obtain a vector pXL-CMV-Purol (CGAgg).

TABLE 2 ligation reaction System

2.2 construction of pXL-CMV-Purol (CGAagg) - (cctTCG) Puror-T2A-GFP

(1) A vector NHEJ-RPG (Dual-reporter system for effective modification of genetic modified cells) constructed in the early stage of the laboratory is taken as a template, a pair of primers Puror-F (ClaI) and polyA-R (HindIII) are designed and synthesized, and an amplified fragment ClaI-Puror-T2A-GFP-HindIII;

PuroR-F(ClaI):5’-CCCatcgatCCTTCGAGCGGGGGCGGTGTTCGC-3’

polyA-R(HindIII):5’-CCCaagcttTAAGATACATTGATGAGTTTGG-3’

the fragment ClaI-Puror-T2A-GFP-HindIII and the vector pXL-CMV-Purol (CGAgg) were each digested simultaneously with ClaI/HindIII (Table 1), and the digested products were recovered and ligated with T4 DNA ligase at 16 ℃ overnight (Table 2). The ligation products were transformed into E.coli competence, screened for amp resistance, and bacterial monoclonals were picked and cultured with shaking in liquid medium at 37 ℃ for 8 hours.

(2) Plasmids were extracted from the cultured broth and digested with ClaI/HindIII enzymes (Table 1). The electrophoresis bands of the positive plasmid clone after double digestion are 4343bp and 1407bp (FIG. 4). Sequencing the positive clone plasmid, and verifying to obtain a vector pXL-CMV-Purol (CGAgg) - (cctTCG) Puror-T2A-GFP. In the vector, 150bp of unrelated sequence (from pXL-BacII) is arranged between fragments CGAagg and cctTCG introduced into Puro through amplification primers, and CGA and 17bp of target sequence at the 3' end of Puro upstream of the CGAACGCCGGAGAGCGTCGAA 17bp target sequence constituting the 5' end of one sgRNA, sgT1, TCG and Purol downstream thereofAGCGGGGGCGGTGTTCGConstitutes another sgRNA, sgT2, and therefore this vector can also be called pXL-CMV-Purol. sgT1-sgT2. Puror-T2A-GFP.

2.3 construction of pXL-U6-sgT1-U6-sgT2-CMV-Purol. sgT1-sgT2.Puror-T2A-GFP

(1) Two targeting vectors were constructed: pX330-U6-sgT1 and pX330-U6-sgT2

First, two pairs of fitted primers for synthesis of sgrna.t1(sgT1) and sgrna.t2(sgT2) were designed

Puro-sgT1-F(BsaI):5’-CACCACGCCGGAGAGCGTCGACGA-3’

Puro-sgT1-R(BsaI):5’-AAACTCGTCGACGCTCTCCGGCGT-3’

Puro-sgT2-F(BsaI):5’-CACCCGAACACCGCCCCCGCTCGA-3’

Puro-sgT2-R(BsaI):5’-AAACTCGAGCGGGGGCGGTGTTCG-3’

Then, primer fitting products obtained by annealing (the primers are diluted to 10pM, 5 mu L of each suction is uniformly mixed, the mixture is placed in a PCR instrument and denatured for 10min at 95 ℃, the mixture is naturally cooled to room temperature for annealing and fitting to obtain double chains with BsaI cohesive ends), namely sgRNA.T1 and sgRNA.T2, are inserted into a framework vector pX330-U6-Chimeric _ dBsai-CBh-hSpCas9 (Adne dgeplasmid #42230) for constructing a targeting vector, and then pX330-U6-sgT1 and pX330-U6-sgT2 are respectively obtained.

(2) Taking pX330-U6-sgT1 as a template, designing and synthesizing a pair of primers HindIII-U6-F and EcoRV-SpeI-sgT1, and amplifying a fragment HindIII-U6-sgT 1-SpeI-EcoRV;

HindIII-U6-F:5’-ccaagcttGAGGGCCTATTTCCCATGAT-3’

EcoRV-SpeI-sgT1:5’-gggatatcggactagtAGCCATTTGTCTGCAGAATT-3’

the HindIII-U6-sgT1-SpeI-EcoRV and pXL-CMV-PuROL.sgT1-sgT2.PuROR-T2A-GFP vectors were each double digested with HindIII/EcoRV (Table 1), and the digests were recovered and ligated with T4 DNA ligase at 16 ℃ overnight (Table 2). The ligation products were transformed into E.coli competence, screened for amp resistance, and bacterial monoclonals were picked and cultured with shaking in liquid medium at 37 ℃ for 8 hours. Plasmids were extracted from the cultured broth and digested simultaneously with BsaI/EcoRI (Table 1). The electrophoresis bands of the positive plasmid clone after double enzyme digestion are 5256bp, 3228bp and 50 bp. The positive clone plasmid is sequenced and verified to obtain a vector pXL-U6-sgT 1-CMV-Purol.sgT1-sgT2.Puror-T2A-GFP.

(3) Taking pX330-U6-sgT2 as a template, designing and synthesizing a pair of primers SpeI-U6-F and EcoRV-sgT2, and amplifying a segment SpeI-U6-sgT 2-EcoRV;

SpeI-U6-F:5’-ccactagtGAGGGCCTATTTCCCATGAT-3’

EcoRV-sgT2:5’-CCgatatcCATTTGTCTGCAGAATTGGC-3’

the SpeI-U6-sgT2-EcoRV and pXL-U6-sgT1-CMV-PuROL.sgT1-sgT2.PuROR-T2A-GFP vectors were each digested simultaneously with SpeI/EcoRV (Table 1), and the digests were recovered and ligated with T4 DNA ligase at 16 ℃ overnight (see Table 2). The ligation products were transformed into E.coli competence, screened for amp resistance, and bacterial monoclonals were picked and cultured with shaking in liquid medium at 37 ℃ for 8 hours. Plasmids were extracted from the cultured broth and digested simultaneously with HindIII/EcoRV (Table 1). The electrophoresis bands of the positive plasmid clone after double digestion are 6345bp and 871bp (FIG. 5). The positive clone plasmid was sequenced and verified to obtain the vector pXL-U6-sgT1-U6-sgT2-CMV-Purol. sgT1-sgT2. PurorR-T2A-GFP, i.e., acnHEJ-USR (FIG. 6).

(III) enriching precisely deleted cells by using acNHEJ-USR

3.1 the human AAVS1 site was used as the target gene, and the AAVS1 sequence was deleted precisely for long fragments by exact NHEJ (FIG. 7).

1. Construction of CRISPR/Cas9 targeting vector pX330-U6-AAVS1.sgRNA1-spCas9 of AAVS1 gene

(1) The target site of the AAVS1 gene is AAVS1-sg1: CCAGCGAGTGAAGACGGCATggg (the lower case part is the PAM sequence).

(2) Design of target site-associated fitting primers based on AAVS1-sg1

AAVS1-5’target-F:5’-CACCGCCAGCGAGTGAAGACGGCAT-3’

AAVS1-5’target-R:5’-AAACATGCCGTCTTCACTCGCTGGC-3’

Placing 10 mu L (10pM) of each synthesized fitting primer in a PCR instrument, and fitting by primer annealing; fitting procedure: denaturation at 94 ℃ for 10 min; and then the power supply of the PCR instrument is closed, and the PCR instrument is naturally cooled to the normal temperature.

(3) The vector backbone was selected from pX330-U6-Chimeric _ dBsai-CBh-hSpCas9, and the vector backbone was digested with BsaI at 37 ℃ for 4 hours (Table 1), and the product was recovered.

(4) The cleavage products were ligated with T4 DNA ligase at 16 ℃ for 6 hours (Table 2).

(5) Coli competence, amp resistance selection, bacterial plate at 37 ℃ for 12 hours, then single colonies of bacteria were picked up and cultured in liquid medium at 37 ℃ for 6 hours (250 rpm) with shaking.

(6) Plasmids were extracted from the cultured broth and digested simultaneously with BasI/EcoRI (Table 1). The electrophoresis band of the positive clone plasmid after double digestion is 8509bp (FIG. 8). The positive clone plasmid is sequenced and verified to obtain a vector pX330-U6-AAVS1.sgRNA1-spCas9 (pX 330-AAVS1.sg1 for short).

2. Construction of CRISPR/Cas9 targeting vector pX330-U6-AAVS1.sgRNA2-spCas9 of AAVS1 gene

(1) The target site of the AAVS1 gene is AAVS1-sg2: CAGGTAAAACTGACGCACGGagg (the lower case part is the PAM sequence).

(2) Design of target site-associated fitting primers based on AAVS1-sg2

AAVS1-3’target-F:5’-CACCGCAGGTAAAACTGACGCACGG-3’

AAVS1-3’target-R:5’-AAACCCGTGCGTCAGTTTTACCTGC-3’

(3) The specific construction steps of connection, transformation, restriction enzyme digestion identification (figure 9) and the like refer to the construction of the vector pX330-U6-AAVS1.sgRNA1-spCas9, and the vector pX330-U6-AAVS1.sgRNA2-spCas9 (pX 330-AAVS1.sg2 for short) is obtained through sequencing verification.

Transfection treatment packets for HEK293T cells

Unscreened group (No selection): cells co-transfected with paired genomic targeting vectors pX330-GOI-Cas9 (in this case pX330-aavs1.sg1 and pX330-aavs1. sg2);

transient selection group (Transient selection): cells co-transfected with a pair of pX330-GOI-Cas9 vector and pPuro-T2A-eGFP vector (A Universal substrate Reporter for Efficient entity of CRISPR/Cas9-media Homology-Directed Repair in mammalin Cells);

acNHEJ-USR screening group (acNHEJ selection): cells co-transfected with paired pX330-GOI-Cas9 vector and acnHEJ-USR.

Blank cells (no transfection) were Blank.

HEK293T cells were purchased from a cell bank (catalog number: SCSP-502, Shanghai)

4. Three replicates were set for each treatment group, and the cells of the unselected group were harvested in a cell pool 48 hours after transfection. And the instantaneous screening group and the acnHEJ-USR screening group are replaced by DMEM containing 3 mu g/mL puromycin 48 hours after transfection, after 3-5 days of screening, the survival condition of the cells is observed through a microscope, and when no obvious cell death occurs within 24 hours, the cells are collected in a cell mixing pool.

5. Extracting genomic DNA of the cell mixing pool, respectively designing PCR Detection primers Detection-F1 and Detection-R1 for synthesizing target gene loci, and amplifying corresponding sequences (figure 7);

Detection-F1:5’-CTCTGCTGTGTTGCTGCCCAAG-3’

Detection-R1:5’-CACGACCTGGTGAACACCTAGG-3’

after the PCR amplification product is detected by gel electrophoresis, the ImageJ software is used for carrying out gray level analysis on the bands of different processing groups, and the total deletion efficiency of the fragments is calculated by the following formula:

[ deletion band grayscale value/(wild band grayscale value + deletion band grayscale value) ] × 100%.

The results are shown in fig. 10, and compared with the deletion efficiency of 32.01% in the non-screening group (No selection), the deletion efficiency of AAVS1 gene fragment in the transient screening group (56.74%) is improved by 1.77 times; the deletion efficiency (94.17%) of the acNHEJ-USR screening group was increased by 1.66 times and 2.94 times respectively compared to the instantaneous screening group and the non-screening group.

6. The wild type band and the knockout band were then recovered together by gel, and after TA cloning, the picked plasmid monoclonal was subjected to bacterial liquid PCR, and the gene knockout efficiencies of the different treatment groups were further compared by gel electrophoresis (FIG. 11). 96 single clones were picked for each treatment group. Wherein the gene deletion efficiency of the non-screened group was 29/96 (30.21%); the gene deletion efficiency of the transient screen group was 52/96 (54.17%); the gene deletion efficiency of the acnHEJ-USR screening group was 88/96 (91.69%). The gene deletion efficiency of the acNHEJ-USR screening group is 3.04 times and 1.69 times that of the non-screening group and the transient screening group respectively. The extracted knock-out monoclonals were then sequenced and the proportion of precise deletions in all deleted clones was compared based on the sequencing results (FIG. 12). Sequencing results show that the accurate deletion efficiency of the long gene fragment of the acNHEJ-USR screening group is 82.29 percent, 6.6 times of the accurate deletion efficiency (12.50 percent) of the unseen group and 2.3 times of the accurate deletion efficiency (35.42 percent) of the instantaneous screening group. It is noteworthy that the proportion of non-precise deletions in the acNHEJ-USR selection group (9.38%) was only around 50% of the transient selection group (18.75%) or the unscreened group (17.71%).

3.2 Long fragment precise deletion of lncRNA-sscg3623 sequence by precise NHEJ using lncRNA-sscg3623 site as target gene (FIG. 13).

1. Construction of CRISPR/Cas9 targeting vector pX330-U6-lnc3623.sgRNA1-spCas9 of lncRNA-sscg3623

(1) According to online prediction software (http:// criprpr. mit. edu /), the target site sg1: TTTGAAAGTTCCTCGGGCCAggg (the lower case part is a PAM sequence) of the targeted pig lncRNA-sscg3623 gene is predicted.

(2) Design of target site-associated fitted primers based on sg1

L3623-Tar1-F:5’-CACCGTTTGAAAGTTCCTCGGGCCA-3’

L3623-Tar1-R:5’-AAACTGGCCCGAGGAACTTTCAAAC-3’

The vector construction step refers to the construction of the CRISPR/Cas9 targeting vector of the AAVS1 gene described above.

2. Construction of CRISPR/Cas9 targeting vector pX330-U6-lnc3623.sgRNA2-spCas9 of lncRNA-sscg3623

(1) According to online prediction software (http:// criprpr. mit. edu /), the target site sg2: CTTCTTGAGGTCACGCACATggg (the lower case part is a PAM sequence) of the targeted pig lncRNA-sscg3623 gene is predicted.

(2) Design of target site-associated fitted primers based on sg2

L3623-Tar2-F:5’-CACCGCTTCTTGAGGTCACGCACAT-3’

L3623-Tar2-R:5’-AAACATGTGCGTGACCTCAAGAAGC-3’

The vector construction step refers to the construction of the CRISPR/Cas9 targeting vector of the AAVS1 gene described above.

PK15 cell transfection treatment grouping

Unscreened group (No selection): cells co-transfected with pX330-U6-lnc3623.sgRNA1-spCas9 vector and pX330-U6-lnc3623.sgRNA2-spCas9 vector;

acNHEJ-USR screening group (acNHEJ selection): cells co-transfected with pX330-U6-lnc3623.sgRNA1-spCas9 vector and pX330-U6-lnc3623.sgRNA2-spCas9 vector and acNHEJ-USR.

PK15 cells were purchased from ATCC (model: BH0370)

4. 48 hours after transfection, cells were drug-screened by adding puromycin (3. mu.g/mL) to the acnHEJ screening group; cells were harvested 72 hours after transfection in the non-selected group. Test group drug screening 5 days later, cells were collected.

5. Monoclonal cells were plated by limiting dilution. The genomic DNA of the collected cells was extracted by single cloning, and the sequences in the vicinity of the knockout site were amplified (see FIG. 13, F4: 5'-CCCCTCATCACCGGACACAC-3'; R4: 5'-CTTTGTCCTTTTGTCAGAATCCCT-3'). And (4) recovering the PCR product of the knockout homozygote cell after the detection of the amplification product, and sequencing and analyzing the recovered product.

6. As can be seen from the results of sequencing analysis (FIG. 14), 30 cell monoclonals were detected in each of the non-screened group and the acnHEJ-USR screened group, wherein the number of cell monoclonals in which the long allele fragment was deleted precisely in the ahHEJ-USR screened group was 6, 9 cell monoclonals in which the heterozygous cell was deleted, and 15 cell monoclonals in which the allele was not deleted. The efficiency of long fragment deletion was 15/30 (50%), with the allele deletion (deletion homozygote) efficiency being 6/30 (20%). The nonscreening group did not detect the deletion of the allelic growth fragment cell monoclone, deletion of homozygote was 0, and deletion of heterozygous cell monoclone was 3.

7. The PCR products of the long fragment deleted homozygous cell monoclonals were sequenced and statistically analyzed for the proportion of precise deletion of the deleted homozygous cell monoclonals 3/6. Finally, the efficiency of biallelic precise deletion of the cell monoclonals of the acnHEJ-USR group was 3/30 (10%).

In summary, the present invention provides a universal reporter vector that can be used exclusively for enrichment of double sgRNA-Cas 9-mediated precise deletion positive cells based on acNHEJ repair. The report vector has the characteristics of self-cutting and self-repairing, the report vector and a double sgRNA targeting vector targeting a target gene are co-transfected into cells, and then the cells are subjected to drug screening for 5 days, so that accurate deletion cells mediated by acnHEJ can be efficiently enriched, and the report vector can be suitable for accurate deletion of coding genes and non-coding genes, so that the purposes of gene function research and gene deletion individual establishment are achieved. The invention successfully enriches the accurate deletion cell of the long-chain segment of the human gene by utilizing the established report system, and simultaneously carries out the accurate deletion of the long-chain segment of the long-chain non-coding RNA of the pig, thereby verifying that the established report system not only can realize the accurate deletion of the long segment by utilizing the acNHEJ repair mode, but also can improve the accurate deletion efficiency of the gene based on the acNHEJ repair mediated by the double sgRNA-Cas9, therefore, the invention is not only suitable for the accurate deletion research of the mammalian genome, but also can be more widely applied to the gene function research and the development of new animal species.

<110> northwest agriculture and forestry science and technology university

<120> screening report system useful for enriching CRISPR/Cas9-mediated precise NHEJ repair cells

<160>29

<210>1

<211>23

<212>DNA

<213> Artificial Synthesis

<400>1

acgccggaga gcgtcgacga agg 23

<210>2

<211>23

<212>DNA

<213> Artificial Synthesis

<400>2

ccttcgagcg ggggcggtgt tcg 23

<210>3

<211>30

<212>DNA

<213>Puro-F(BamHI)

<400>3

cgcggatcca tgaccgagta caagcccacg 30

<210>4

<211>34

<212>DNA

<213>PuroL-R(XbaI)

<400>4

tgctctagac cttcgtcgac gctctccggc gtgg 34

<210>5

<211>33

<212>DNA

<213>PuroR-F(ClaI)

<400>5

cccatcgatc cttcgagcgg gggcggtgtt cgc 33

<210>6

<211>31

<212>DNA

<213>polyA-R(HindIII)

<400>6

cccaagcttt aagatacatt gatgagtttg g 31

<210>7

<211>24

<212>DNA

<213>Puro-sgT1-F(BsaI)

<400>7

caccacgccg gagagcgtcg acga 24

<210>8

<211>24

<212>DNA

<213>Puro-sgT1-R(BsaI)

<400>8

aaactcgtcg acgctctccg gcgt 24

<210>9

<211>24

<212>DNA

<213>Puro-sgT2-F(BsaI)

<400>9

cacccgaaca ccgcccccgc tcga 24

<210>10

<211>24

<212>DNA

<213>Puro-sgT2-R(BsaI)

<400>10

aaactcgagc gggggcggtg ttcg 24

<210>11

<211>28

<212>DNA

<213>HindIII-U6-F

<400>11

ccaagcttga gggcctattt cccatgat 28

<210>12

<211>36

<212>DNA

<213>EcoRV-SpeI-sgT1

<400>12

gggatatcgg actagtagcc atttgtctgc agaatt 36

<210>13

<211>28

<212>DNA

<213>SpeI-U6-F

<400>13

ccactagtga gggcctattt cccatgat 28

<210>14

<211>28

<212>DNA

<213>EcoRV-sgT2

<400>14

ccgatatcca tttgtctgca gaattggc 28

<210>15

<211>23

<212>DNA

<213>EcoRV-sgT2

<400>15

ccagcgagtg aagacggcat ggg 23

<210>16

<211>23

<212>DNA

<213> target site of AAVS1 Gene AAVS1-sg1

<400>16

ccagcgagtg aagacggcat ggg 23

<210>17

<211>25

<212>DNA

<213>AAVS1-5’target-F

<400>17

caccgccagc gagtgaagac ggcat 25

<210>18

<211>25

<212>DNA

<213>AAVS1-5’target-R

<400>18

aaacatgccg tcttcactcg ctggc 25

<210>19

<211>23

<212>DNA

<213> target site of AAVS1 Gene AAVS1-sg2

<400>19

caggtaaaac tgacgcacgg agg 23

<210>20

<211>25

<212>DNA

<213>AAVS1-3’target-F

<400>20

caccgcaggt aaaactgacg cacgg 25

<210>21

<211>25

<212>DNA

<213>AAVS1-3’target-F

<400>21

aaacccgtgc gtcagtttta cctgc 25

<210>22

<211>22

<212>DNA

<213>Detection-F1

<400>22

ctctgctgtg ttgctgccca ag 22

<210>23

<211>22

<212>DNA

<213>Detection-R1

<400>23

cacgacctgg tgaacaccta gg 22

<210>24

<211>25

<212>DNA

<213>L3623-Tar1-F

<400>24

caccgtttga aagttcctcg ggcca 25

<210>25

<211>25

<212>DNA

<213>L3623-Tar1-R

<400>25

aaactggccc gaggaacttt caaac 25

<210>26

<211>25

<212>DNA

<213>L3623-Tar2-F

<400>26

caccgcttct tgaggtcacg cacat 25

<210>27

<211>25

<212>DNA

<213>L3623-Tar2-R

<400>27

aaacatgtgc gtgacctcaa gaagc 25

<210>28

<211>20

<212>DNA

<213>F4

<400>28

cccctcatca ccggacacac 20

<210>29

<211>24

<212>DNA

<213>R4

<400>29

ctttgtcctt ttgtcagaat ccct 24

Claims (10)

1. An accurate NHEJ repair recombination screening gene characterized by: the double sgRNA target site construction sequence comprises a three-base sequence and two PAM sequences, wherein the two sgRNA target site construction sequences are inserted into a screening/reporter gene sequence partition position, and the three-base sequence and the two PAM sequences are used for forming two sgRNA sequences with gene target sequences located at the upstream and downstream of the partition position and are respectively connected with the corresponding sgRNA sequences.

2. The precise NHEJ repair recombination screening gene of claim 1, wherein: the double sgRNA target site construction sequence also includes unrelated sequences for linking the two PAM sequences.

3. The precise NHEJ repair recombination screening gene of claim 2, wherein: the unrelated sequence is 130-150 bp.

4. An accurate NHEJ repair screening report vector, characterized in that: the method comprises the steps of screening a reporter gene expression cassette and an sgRNA expression cassette, wherein a transcription region of the screening reporter gene expression cassette comprises an accurate NHEJ repair recombination screening gene sequence; the precise NHEJ repair recombination screening gene sequence comprises a double sgRNA target site construction sequence inserted into a drug screening gene sequence partition position in the transcription region, the double sgRNA target site construction sequence comprises a three-base sequence for forming two sgRNA sequences with drug screening gene target sequences positioned at the upstream and downstream of the partition position and two PAM sequences respectively connected with the corresponding sgRNA sequences, and the double sgRNA target sites respectively use sgRNAs transcribed by sgRNA expression cassettes as guide sequences for targeting the precise NHEJ repair recombination screening gene sequence.

5. The precise NHEJ repair screening report vector of claim 4, wherein: the double sgRNA target site construction sequence also comprises an unrelated sequence for connecting two PAM sequences; the accurate NHEJ repair screening report vector carries out accurate NHEJ repair by carrying out CRISPR/Cas9 mediated double sgRNA target site breakage, restores a drug screening gene sequence in a transcription region of the screening report gene expression cassette and expresses corresponding drug resistance.

6. The precise NHEJ repair screening report vector of claim 4, wherein: the transcription region of the screening reporter gene expression cassette also comprises a fluorescent reporter gene sequence, the fluorescent reporter gene sequence and the drug screening gene sequence are co-expressed, and the fluorescent reporter gene sequence is positioned at the downstream of the drug screening gene sequence.

7. The precise NHEJ repair screening reporter vector of claim 4 or 6, wherein: the screening reporter gene expression cassette also includes promoter and termination sequences flanking the transcribed region.

8. A system for screening enriched long-fragment precision deleted cells, comprising: comprises a precise NHEJ repair screening report vector and a targeting vector which is co-transfected with the screening report vector in a target editing cell and is used for precisely deleting long segments among selected sites of a cell genome; the accurate NHEJ repair screening report vector comprises a screening report gene expression cassette and a sgRNA expression cassette, and a transcription region of the screening report gene expression cassette comprises an accurate NHEJ repair recombination screening gene sequence; the precise NHEJ repair recombination screening gene sequence comprises a double sgRNA target site construction sequence which is used for being inserted into a drug screening gene sequence partition position in the transcription region, the double sgRNA target site construction sequence comprises a three-base sequence which is used for forming two sgRNA sequences with drug screening gene target sequences positioned at the upstream and downstream of the partition position and two PAM sequences which are respectively connected with the corresponding sgRNA sequences, and the double sgRNA target sites respectively use sgRNAs transcribed by sgRNA expression cassettes as guide sequences for targeting the precise NHEJ repair recombination screening gene sequence; the length of the long fragment is more than or equal to the double sgRNA target site construction sequence.

9. The system for screening enriched long-fragment precision deleted cells according to claim 8, wherein: the long fragment is 100-1300 bp.

10. Use of the refined NHEJ repair screening reporter vector of claim 4 in enriching for biallelic long segment refined deletion knockout cells.

Images