CN113717981A

CN113717981A - DTX6 mutant gene and application thereof in herbicide resistant diquat

Info

Publication number: CN113717981A
Application number: CN202110888233.XA
Authority: CN
Inventors: 葛晓春; 赵明明; 王文静; 吕泽玉
Original assignee: Fudan University
Current assignee: Fudan University
Priority date: 2021-08-03
Filing date: 2021-08-03
Publication date: 2021-11-30
Anticipated expiration: 2041-08-03
Also published as: CN113717981B

Abstract

The invention discloses aDTX6Mutant genes and application thereof in herbicide resistant diquat.DTX6The mutant gene comprisesDTX6The 311 th glycine of the protein encoded by the gene is changed into aspartic acidDTX6(G311D)And is composed ofDTX6The 311 th glycine of the protein encoded by the gene is changed into glutamic acidDTX6 (G311E)(ii) a The over-expression of the gene can enhance the fast tolerance of a host to the dichlorous weeds in arabidopsis thaliana. In the presence of diquatIs overexpressed compared to a control not transformed with the mutated geneDTX6 (G311D)OrDTX6(G311E)The transgenic lines of (a) were able to survive and grow, and the non-transgenic control plants failed to grow and died. The gene can enhance the capability of plants to resist the stress of herbicide diquat, reduce the yield loss of crops under the treatment of diquat and can be used for cultivating transgenic crops resistant to diquat.

Description

DTX6 mutant gene and application thereof in herbicide resistant diquat

Technical Field

The invention belongs to the technical field of genetic engineering, and particularly relates to arabidopsis thalianaDTX6Mutant genes and uses thereof.

Background

The weeds in the field cause great harm to the growth of crops, and because the weeds grow fast, the weeds compete for nutrition, moisture and sunlight with the crops, the growth vigor of the crops can be reduced, and the yield of the crops is reduced. The traditional artificial weeding consumes a large amount of manpower, and is contrary to the development trend of the reduction of population fertility rate and the large-scale and intensive agriculture in the modern society, so that the traditional weeding mode is abandoned, the herbicide is sprayed by using agricultural machinery, the growth of weeds is inhibited, and the requirements of the large-scale and mechanized agriculture are met.

The herbicide can be used in the whole growth process of crops, only the herbicide needs to be sprayed regularly, the weeds in the field can be killed, and the crops are not affected because of the resistance. The key to developing herbicide-resistant crops is to find suitable herbicide-resistant genes. The preferred selection is those genes which have the ability to resist herbicides but do not affect the normal growth and seed set of plants, and which can be transformed into crops to produce herbicide-resistant crops. At present, almost all soybeans imported in the market of China are herbicide-resistant soybeans, transgenic soybeans account for more than 90% of the soybean market in the world, but the types of herbicide-resistant genes with independent intellectual property rights in China are few, and new herbicide-resistant genes are urgently needed to meet the increasingly expanded breeding requirements.

Diquat (diquat) with molecular formula of C₁₂H₁₂N₂Br₂Molecular weight 344.05, is an extremely widely used broad spectrum contact non-selective herbicide (Haley, 1979). Under the condition of illumination, it can accept the electrons in chloroplast PS I and transfer the electrons to molecular oxygen, so that the in vivo production is causedGenerates active hydrogen peroxide, causing severe oxidative stress (Bonneh-Barkay et al, 2005). The diquat is widely applied to orchards, tea gardens and field weeding of other crops, and greatly promotes the development of the farming industry; it can also be used as desiccant for seed plants; the compound herbicide can also be used as a seed-withering agent for potatoes, cotton, soybeans, corns, sorghum, flax and sunflowers, and when the plant is close to maturity, the residual green parts and weeds can be quickly withered by spraying the diquat, so that the plant is harvested in advance and the seed loss is less.

The diquat and the once widely used herbicide paraquat belong to the same pyridine herbicides, and are easy to hydrolyze and positively charge under the condition of neutral pH. The toxicity of the diquat to human bodies is lower than that of the paraquat, the weeding capability is almost the same, the diquat becomes a herbicide which is hopeful to replace the paraquat under the condition that the paraquat is forbidden, and the production of the diquat is expanded in many countries at present so as to replace the market blank left by the paraquat. The diquat, the paraquat, the glyphosate and the glufosinate are called as a tetragenocidal herbicide, the action of the tetragenocidal herbicide is particularly quick, the tetragenocidal herbicide mainly kills green parts of plants, the plants generate very obvious victims within 1-2 hours after stem and leaf treatment, but the tetragenocidal herbicide can be adsorbed by soil colloid to be passivated after contacting with soil, and has no residual activity in the soil, so the tetragenocidal herbicide is safe to the environment and cannot influence the planting of next batch of plants.

MATE (matrix and toxin compound exclusion) proteins are widely present in prokaryotes and eukaryotes and can be classified into NorM-like, DinF (DNA damage inducing protein F) like, and eukaryotic MATE (Brown et al, 1999; Omote et al, 2006). They transport mainly different kinds of endogenous and exogenous molecules in various organisms (Omote et al, 2006). In some plants, the plant has the transport functions of metal ions, nicotine, secondary metabolites and the like (Magalhaes et al, 2007; Debeaujon et al, 2001; Zhao et al, 2011), but different MATE protein substrates have different specificities, and the substrates of the MATE proteins are often confirmed by genetic screening and phenotypic identification.

The inventor screens arabidopsis thaliana against BaicaoWhen the mutant is withered, a mutant is foundpar3(paraquat resistance 3) Has strong resistance to paraquat, and further research shows that the paraquat also has strong resistance to diquat. The mutant gene was located and found to be due to Arabidopsis thalianaDTX6Caused by gene mutation. The protein encoded by the gene belongs to members of MATE family, and the protein is mainly positioned on various organelle membranes or plasma membranes and plays a role of transporting substrates, but the substrates of DTX6 in vivo are not known at present. When the 311 th glycine in the DTX6 molecule is mutated into a negatively charged acidic amino acid, the resistance of arabidopsis thaliana to paraquat and diquat can be greatly enhanced. DTX6 is located on vacuolar membrane and cell membrane, consists of 483 amino acids, has 12 transmembrane domains, and has the mutant protein DTX6(G311D) with unchanged subcellular location, but enhanced ability to transport herbicide into vacuole or out of cell, thereby leading to strong herbicide resistance of plants.

Disclosure of Invention

The invention aims to provide a membrane protein gene for modifying the resistance of plants or other species to aquacideDTX6(G311D)AndDTX6(G311E)the gene has the capability of enhancing the activity of the host against diquat. The gene is transferred into plants by a transgenic means, and an overexpression strain is screened, so that species with enhanced resistance to aquacide can be obtained; through gene editing meansDTX6Or the 311 th amino acid of the similar gene is edited into D or E, so that the resistance of plants to the aquacide can be enhanced.

DTX6(G311D)Is thatDTX6The 311 th glycine of the protein encoded by the gene is changed into aspartic acid, and the mutated protein is marked as DTX6 (G311D);DTX6(G311E)is thatDTX6The 311 th glycine of the protein encoded by the gene was changed to glutamic acid, and the mutated protein was designated DTX6 (G311E).

The present invention first provides Arabidopsis thalianaDTX6(G311D)The nucleotide sequence of the gene is shown in SEQ ID NO. 1. The cDNA total length is 1661bp, the open reading frame is 1452bp (black bold mark),DTX6(G311D)the DNA sequence is wild typeDTX6CDS region 932-9 of the geneThe 32 codon was changed to a codon encoding aspartic acid (marked in black font), resulting in a mutation of the protein. The DTX6(G311D) protein contains 483 amino acids in total, as shown in SEQ ID NO. 2.

The invention also provides a method for producing a transgenic plant from Arabidopsis thaliana wild type and Arabidopsis thaliana wild type respectivelyDTX6The primer sequence for amplifying CDS full length of wild type and mutant gene in the mutant is specifically as follows:

upstream primer (A)KpnI）：CGGGGTACCATGGAAGATCCACTTTTATTGGG（SEQ ID NO.3）

Downstream primer (a)BamHI）：CGCGGATCCTCAAGCAAGTCCATTGCCAA（SEQ ID NO.4）

The invention also provides a transgenic plant containing the above Arabidopsis thalianaDTX6(G311D) OrDTX6(G311E) A vector for the gene. Namely use ofDTX6(G311D) OrDTX6(G311E) The gene is a transgenic carrier constructed by the anti-diquat function, and particularly, after the mutant gene is connected into a transgenic carrier, such as a 35S promoter of a plant transgenic carrier, antibiotics are replaced to be used as a screening marker of a transgenic plant, a transgenic line obtains the resistance to the diquat, and the transgenic line can be screened out on a flat plate containing the diquat.

The invention also provides a composition containing the aboveDTX6(G311D)OrDTX6(G311E)A host of the gene vector. Preferably, the host is a plant.

The invention also provides the aboveDTX6(G311D)OrDTX6(G311E)The application of the gene in enhancing the activity of the host against the aquacide comprises the following specific steps:

(1) subjecting Arabidopsis thaliana toDTX6(G311D)OrDTX6(G311E)The full-length CDS of the gene is respectively connected into plant over-expression vectors to obtain the gene containingDTX6A plant overexpression vector of a mutant gene; such as pCAM-N-eYFP;

(2) will respectively containDTX6(G311D)OrDTX6(G311E)The plant over-expression vector of the mutant gene is transferred into agrobacterium GV3101, the agrobacterium identified as positive is used for infecting plants, and a transgenic strain for expressing the mutant gene is obtained through transgenic experiments such as seed collection, hygromycin screening and the like;

(3) expressing the identified expressionDTX6(G311D)OrDTX6(G311E)The seeds of the transgenic strains of the genes are sown on a culture medium containing the diquat, and the transgenic strains are found to have obvious resistance to the diquat, so that the plants grow normally, while the contrast can not grow.

The invention is as describedDTX6(G311D)Genes andDTX6(G311E)genes, in addition to being useful for breeding paraquat resistant crops (a herbicide resistant gene)PAR3(G311E)The application of (1) is as follows, and the patent number is ZL 201710330534.4; application date: 2017.05.11, respectively; and (3) authorization day: 2021.04.30), the invention can be further applied to the cultivation of transgenic plants with resistance to the function of diquatDTX6(G311D)AndDTX6(G311E)the gene function, transferring them into plant by means of transgenic method to culture plant resisting dichlord. Or by gene editing meansDTX6Or the 311 th amino acid of the similar gene is edited into D or E, so that the resistance of plants to the aquacide can be enhanced.

The present application is primarily directed toDTX6(G311D)AndDTX6(G311E)the application of the two mutant genes in cultivating plants resistant to diquat is provided. Host plants include mainly commercial crops such as tobacco, soybean, rice, corn, and the like.

The invention has the following advantages and meanings:

DTX6(G311D)andDTX6(G311E)the gene and the coding protein thereof have obvious effect on improving the tolerance of plants to diquat, have strong application value and can be used for cultivating herbicide-resistant crops.

Drawings

FIG. 1 is a drawing ofDTX6(G311D)The mutant gene overexpression strain has a paraquat resistant phenotype.

FIG. 2 isDTX6(G311D)、DTX6(G311E)Mutant gene overexpression strains andpar3the point mutants all had a significant resistance to the diquat phenotype.

FIG. 3 is a drawing showingDTX6Charge property of the 311 th amino acid andDTX6functional relevance of gene resistance to diquat.

FIG. 4 is a drawing showingDTX5/6The double mutant had a phenotype slightly more sensitive to diquat.

Fig. 5 shows DTX6 in an inner membrane transport system.

FIG. 6 shows that the DTX6(G311E) protein has a stronger substrate binding affinity than the wild-type protein.

Detailed Description

The invention will be further elucidated with reference to the following specific examples. It should be understood that these examples are for illustrative purposes only and are not intended to limit the scope of the present invention. The experimental procedures for which specific conditions are not specified in the examples below are carried out according to conventional conditions, for example according to the molecular cloning handbook of Sambrook et al or according to the conditions recommended by the manufacturer.

Example 1, obtainingDTX6Of genesG311E，G311D，G311R，G311KPoint mutation of gene and construction of over-expressed transgenic line

Due to prior discoverypar3In order to understand whether the charge property of the amino acid at the 311 position is related to the herbicide-resistant phenotype, the mutation of the amino acid at the 311 position into amino acids with different charge properties, such as negatively charged aspartic acid (D) and positively charged arginine (R) and lysine (K), is used for comparing and researching the herbicide-resistant capability of the amino acids.

1、G311E Cloning of CDS fragment of Point mutation Gene:

using Arabidopsis thalianapar3The young leaf of the point mutant (paraquat resistant mutant) is used as material, RNA is extracted by Trizol method (see the specification of Trizol of TaKaRa), DNA is removed after DNaseI treatment (see the specification of DNase I of TaKaRa), and cDNA is reverse transcribed (see PrimeScript of TaKaRa)^TMInstructions for Reverse Transcriptase). According to what is provided on the TAIR (www.arabidopsis.org) websiteDTX6Sequence information of Gene, designDTX6AndG311Ethe amplification primers SEQ ID NO.3 and SEQ ID NO.4 adopt an RT-PCR method, and CDS full-length cloning is carried out by taking cDNA obtained by reverse transcription as a template. Using the obtainedDTX6Wild type displayed on websiteDTX6The gene sequences have a difference of one base,G311Ethe length of the full-length coding region is 1452bp, and the sequence is as shown in SEQ ID NO.1Wherein the mutated gene locus is identified by a red large font. Wild typeDTX6The 931-and 933-position of the gene encodes glycine, and the 3 bases "GGG"mutation of one or two bases can be madeG311D，G311E，G311KAndG311Ra mutant gene. In particular toGGGTo GAC, corresponding to G311D;GGGto GAG, corresponding to G311E;GGGto AAG, corresponding to G311K;GGGbecomes Cgg, corresponding to G311R. The coding region of the gene is indicated in bold font in the sequence, and the start and stop codons are underlined. The mutation sites, i.e.positions 931 and 933 after the start code have been marked in bold.

2. Wild typeDTX6The gene(s) is (are),G311D，G311RandG311Kobtaining of Point mutant Gene

G311D，G311RAndG311Kthe site mutation is in the wild typeDTX6Based on the cDNA sequence of the gene, point mutations were constructed using the overlap PCR method (Ho et al, 1989).

Firstly, young leaves of wild Col-0 are taken as materials, a coding region segment containing a complete open reading frame is obtained according to the RT-PCR method mentioned in 1, and the coding region segment is obtained after sequencingDTX6The cDNA of the wild type gene has the length of 1452bp, codes 483 amino acid residues, has the molecular weight of 51932.5 daltons, and has the isoelectric point (pI) of 7.5987.

G311DIs composed ofDTX6The wild type gene is point mutated. Using an overlapping PCR method to cloneDTX6Plasmid of cDNA as template, constructionG311DThe mutant gene primers SEQ ID NO.5 and SEQ ID NO.6 mutate the encoded Gly at position 311 to Asp. The amino acid sequence of the G311D mutant protein is shown in SEQ ID NO.2, and the subscript site is a mutation site; it is predicted to be a 12-transmembrane protein.

Constructed according to the same method as described aboveG311RAndG311Kmutant Gene constructionG311KThe primers are SEQ ID NO.7 and NO.8, and the constructionG311RThe primers of (1) are SEQ ID NO.9 and NO. 10. After sequencing to confirm that the gene order was consistent with that expected, the wild type was mapped using KpnI/BamHI sitesDTX6And mutant genesG311E、G311D、G311RAndG311Kthe open reading frame is cloned into a pCAMBIA1301-eYFP-N vector, so that the N end of each gene is provided with an eYFP label, and then the vector is transferred into agrobacterium GV3101 for Arabidopsis transformation according to the following method. At least 60 positive seedlings were obtained from each transgenic line and phenotypic analysis was performed using 3 representative lines with different expression levels.

3. Agrobacterium-mediated arabidopsis transgenesis:

A. planting Columbia-0 ecotype arabidopsis

The arabidopsis culture soil comprises the following components: the vermiculite/black soil/perlite was 9/3/1.

Filling soil into pots, pouring nutrient solution into the bottom of the pot and fully soaking, dibbling Col-0 seeds in the soil, planting 4 arabidopsis thaliana plants in each small pot, covering a preservative film, treating at low temperature of 4 ℃ to break dormancy, and transferring into a long-day greenhouse (at the temperature of 22 +/-2) ℃ for culture after 2-3 days. And (5) keeping the soil in a semi-dry and semi-wet state. The nutrient solution is poured once again before flowering.

B. Transformation of Agrobacterium

GV3101 competent cells were removed from the-70 ℃ freezer and thawed on ice, 5. mu.l of vector plasmid was added to the competent cells, and the tips were gently mixed. Standing on ice for 5 min, freezing in liquid nitrogen for 5 min, heat-shocking at 37 deg.C for 5 min, and adding 1 ml DYT medium. Shaking and culturing at 28 deg.C and 100 r/min for 4 h. 5000 decoction at room temperature gCentrifuging for 2 min, reserving about 100 μ l of supernatant, blowing the suspended thallus with a gun head, and coating on a corresponding solid screening culture medium, wherein the resistance of GV3101 is gentamicin and rifampicin, and the resistance of pCAM-N-eYFP plasmid is kanamycin. And (3) carrying out inverted culture at 28 ℃ for 36-48 h, and selecting a plurality of monoclonals to carry out colony PCR (polymerase chain reaction) to identify positive colonies.

C. Floral dip method for transforming arabidopsis

The day before the transgene, plant pods and open flowers were cut. Inoculating the agrobacterium tumefaciens single colony transformed with the corresponding plasmid into 3 ml of DYT liquid culture medium with corresponding resistance, and performing shaking culture at 28 ℃ and 220 r/min overnight. Transferring the bacterial liquid 1:50 into 100 ml liquid culture medium containing same resistance DYT, and continuously culturing to OD₆₀₀1.0 to 1.5. 5000 decoction at room temperaturegCentrifuging for 15 min to collect thallus, and resuspending Arabidopsis thaliana transformation solutionTo OD₆₀₀= 0.8; and soaking the inflorescence of the plant in the transformation solution for 5-10 min. The transformed plants were treated for 24 h in the dark and cultured until seeds were harvested.

4. Screening of transgenic Arabidopsis thaliana

Harvesting mature T₀And (3) sowing the seeds on 1/2MS solid culture medium containing hygromycin resistance, carrying out light-shielding treatment for 2-3 days at 4 ℃, and transferring into an illumination incubator. Selecting a resistant plate to germinate and grow a green cotyledon and a positive seedling with a longer root, transplanting the positive seedling into soil, collecting leaves, identifying an over-expression strain through a qRT-PCR experiment (the sequences of qRT-PCR primers are SEQ ID NO.11 and NO. 12), then harvesting transgenic seeds of the over-expression strain T1, and selecting 3 strains with representative expression level from the T1 generation for later experiments.

In the case of the example 2, the following examples are given,DTX6(G311D)paraquat resistant phenotypic observations of overexpressing transgenic lines

Will be provided with35S::eYFPEmpty vector transgenic lines (EV) and 335S::eYFP-DTX6(G311D)The seeds of the positive strain are put into a clean sterilized centrifugal tube, 70% ethanol is added for rotating sterilization for 10 min, then absolute ethanol containing 0.01% Triton X-100 is used for replacing, after oscillation for a plurality of times, the seeds are placed on sterilized clean filter paper, and after ethanol is volatilized, the seeds are respectively dibbled on normal (CK) and paraquat culture medium containing 0.8 mu mol/L. Shading at 4 deg.C for 2-3 days, transferring to long-day artificial box (22 + -2) deg.C, culturing, and culturing under L/D light intensity of 150 μmol/m²s, humidity 50%, phenotype was observed after 10 days, and fresh weight was counted and found to be overexpressed No.1 on normal mediumDTX6(G311D) The fresh weight of the positive strain is slightly larger than that of the empty vector control strain for unknown reasons, and the fresh weights of other strains have no obvious difference; however, on the 0.8. mu. mol/L paraquat plate, the fresh weights of 3 seedlings of overexpression transgenic lines are all significantly greater than the fresh weight of the wild type, as shown in FIG. 1; wherein (A) and (B) are empty vector control (EV) and 3G311DPhenotype of the over-expressed strains after 10 days of growth on 1/2MS plates containing 0 (A) and 0.8. mu. mol/L paraquat (B); (C)G311Din overexpression linesG311DThe expression level of (a). Wild type gene in empty vectorDTX6Is set to 1; (D) in thatFresh weights of plants grown on 1/2MS plates containing 0 (CK) and 0.8. mu. mol/L paraquat were compared. Each experiment was repeated three times, and values shown are mean ± standard deviation (n = 24). Statistical analysis was performed using Two-way ANOVA, with different letters representing significant differences. Scale =0.5 cm. The results show thatG311DThe mutant gene has stronger anti-paraquat capability and can resist the action of 0.8 mu mol/L paraquat.

Example 3 overexpressionDTX6(G311D)AndDTX6(G311E)the transgenic plants are also resistant to diquat

Preliminary experiments have found thatDTX6(G311E)The mutant gene has resistance to paraquat, and since diquat and paraquat belong to the same pyridine herbicides and are positively charged herbicides, whether the mutant gene also has the resistance to diquat is guessed.

Control (EV) with empty vector was transferred according to the method of example 2,par3the mutant is a mutant of a microorganism,DTX6(G311D-8) andDTX6(G311E-11)two lines with similar expression levels in the over-expression line were spotted on normal (CK) and diquat plates containing 0.2 and 0.8. mu. mol/L, respectively, grown under the same conditions as in example 2 for 10 days, the phenotypes were observed, and fresh weights were counted, and it was found that on normal medium, their fresh weights were relatively similar, but on the diquat-containing plates, their fresh weights were much larger than those of the control lines, and a remarkable diquat-resistant phenotype was exhibited, as shown in FIG. 2, in which (A) the empty vector control lines (EV) and (B) the control lines (B) were all empty, and,par3Point mutants andDTX6two point mutation genes of geneG311DAndG311Ethe growth phenotype of the over-expressed strain of (2) on 1/2MS plates with 0.2 and 0.8. mu. mol/L diquat; (B) fresh weight statistical analysis of individual lines. The experiment was repeated three times and the values shown are mean ± standard deviation (n = 24). Statistical analysis was performed using Two-way ANOVA, with different letters representing significant differences. Scale =0.5 cm.

The results show that, on a diquat plate containing 0.2. mu. mol/L,par3the mutant is a mutant of a microorganism,DTX6(G311D-8) andDTX6 (G311E-11)even better than normal plates, but at this time the empty vector-transferred control line had not been viableLength; on a 0.8 μmol/L diquat plate,par3mutants andDTX6(G311E-11)the transgenic line still shows stronger resistance phenotype, the growth state is normal, which shows thatG311E vs G311DHas stronger resistance to dichlord, and can resist dichlord of more than 0.8 mu mol/L.

Description of the present exampleG311EAndG311Dthe mutant gene not only has the ability of resisting paraquat, but also has the ability of resisting dichlord, thereby expanding the application range of the mutant gene in constructing herbicide-resistant crops.

In the case of the example 4, the following examples are given,DTX6the resistance of the gene to diquat phenotype is mainly related to the charge property of the 311 th amino acid

The structure of the MATE protein suggests that the charge properties near the substrate binding site of such transporters may influence the binding of the substrate. Approximating expression levels35S::eYFP-DTX6（W-7），35S::eYFP-DTX6（G311E-11）、35S::eYFP- DTX6（G311D-8）、35S::eYFP-DTX6（G311R-10）And35S::eYFP-DTX6（G311K-4）the transgenic line of (a), andpar3mutants, the empty vector control (EV) lines and wild type Col-0 spots were spotted on normal and diquat-containing plates and observed for differences in their diquat resistance.

The results are shown in FIG. 3, in which (A) - (C) are empty vector control (EV), wild type (Col-0),par3point mutant, and over-expression strain phenotype of mutant gene with different charge property of 311 th amino acid of DTX 6. (A) A culture medium without diquat; (B) a culture medium containing 0.2 mu mol/L of diquat; (C) a culture medium containing 0.8 mu mol/L of diquat; (D) the root length of each strain grown on diquat medium with different concentrations was compared. W-7 meansDTX6Overexpression strains of wild-type genes; G311D, G311E refers to an overexpression strain in which G311 is changed into aspartic acid and glutamic acid; G311K, G311R refers to the G311 being changed to an over-expressed strain of lysine and arginine. Plants were grown for 10 days after germination on 1/2MS medium with or without diquat and then photographed and counted for root length. The experiment was repeated three times and showed values as mean ± standard deviation (n = 24). Statistical analysis was performed using Two-way ANOVA, with different letters representing significanceA difference. Scale =0.5 cm.

As can be seen from the figure, under normal growth conditions, there was no significant difference in growth between these lines, but on 0.2. mu. mol/L diquat plates,G311E-11andG311D-8the growth state of the transgenic line is normal and obviously better than that of the transgenic wild typeDTX6Strain W-7 of the gene, and wild type, empty vector control, andG311R-10and G311K-4 transgenic line can not grow; on a 0.8 μmol/L diquat plate,G311D-8the transgenic lines began to fail to grow normally, wild type, empty vector control, andG311R-10andG311K-4none of the transgenic lines even germinated.

This result shows that it is possible to identify,DTX6the gene has weaker activity of resisting dichlorvos (0.2 mu mol/L of dichlorvos can be resisted by overexpression), and the 311 th glycine of DTX6 is mutated into negatively charged amino acid (such as glutamic acid and aspartic acid), so that the resistance of a transgenic strain of the overexpressed mutant gene to the dichlorvos is enhanced, and the transgenic strain can be highly resistant to the dichlorvos stress, whereinG311EThe resistance to mutation is stronger than that ofG311D(ii) a If the 311 th amino acid is mutated to a positively charged amino acid (such as arginine and lysine), the transgenic line has no obvious phenotype on diquat, indicating that the 311 th positively charged amino acid weakensDTX6Resistance ability of wild-type gene. These results indicate that the charge properties of amino acid 311 do determine the ability of DTX6 to detoxify dichlord quickly.

In the case of the example 5, the following examples were conducted,dtx5、dtx6single mutant, double mutant construction and observation of resistance to aquacide phenotype

The Arabidopsis MATE protein family has 58 members, the branch of DTX6 has 6 members, wherein, the DTX5 has the highest homology with the DTX6, the corresponding gene number is AT2G04090, the amino acid sequence consistency of the two reaches 91.3 percent, and the possibility of functional redundancy is very high, thus the method is exploredDTX6When the function in the body is necessary, the body will beDTX5Knock out together, so we are inDTX5AndDTX6target sites on the second exon where the gene sequences are highly coincident are selected to construct the CRISPR-Cas9 vector in order to target both genes simultaneously. The primers for constructing gRNA were designed asSEQ ID NO.13 and SEQ ID NO. 14. Constructing the sequence of gRNA into a transgenic vector with fluorescent label, and then transforming Arabidopsis thaliana by agrobacterium to obtain T₀Seed generation; primarily screening fluorescent seeds by a fluorescence microscope, screening by hygromycin to obtain T1 generation positive strains, extracting the genome DNA of the mutant, amplifying target site accessory sequences (SEQ ID NO.15, SEQ ID NO.16 and SEQ ID NO. 17) by using a specific primer, wherein the SEQ ID NO.15 isDTX5AndDTX6a common N-terminal primer) that is aligned to the wild-type gene sequence; a double knockout mutant with a T inserted in both genes was obtained and nameddm-5The results of the mutant sequence alignment and the deduced amino acid sequence are shown in (A) and (B) in FIG. 4, wherein FIG. 4(A) is constructed according to the conserved region by using CRISPR-Cas9 technologydtx5, dtx6Anddtx5 dtx6 (dm-5)double mutants.dm-5In the mutant, two genes are inserted with one base to cause frame shift mutation; FIG. 4(B) schematic diagram of the primary structure of the mutein. The mutation causes premature termination of the protein, the blue box represents the same amino acid sequence as the wild-type protein, while the red box represents an amino acid sequence different from the wild-type, and the truncated protein retains only 3 intact transmembrane helices. At the same time, the CRISPR is obtained by screening after the CRISPR knockoutDTX5AndDTX6respective single mutantsdtx5Anddtx6. The Cas9-free strain was bred in the obtained mutant selection T2 generation for subsequent experiments.

Will be provided withdtx5Anddtx6，dm-5and wild type Col-0 were spotted on normal medium and plates containing 0.1 and 0.15. mu. mol/L diquat, and as a result, double mutants were founddm-5All show a slightly weaker phenotype against dichlord than the wild type, anddtx5ratio ofdtx6The phenotype of (D) appeared more pronounced, see FIGS. 4(C), (D), where FIG. 4(C) is on a plate containing 0.1 and 0.15. mu. mol/L diquatdtx5, dtx6Single and double mutantsdm-5(ii) a growth phenotype; FIG. 4(D) is a comparison of root length under different growth conditions for each strain. Plants were grown for 10 days after germination on 1/2MS medium with or without diquat and then photographed and counted for root length. Experiment is heavyThree times, the values are shown as mean. + -. standard deviation (n.gtoreq.20). Statistical analysis was performed using Two-way ANOVA, with different letters representing significant differences. Scale =0.5 cm.

This result indicates that the DTX5/6 protein has indeed the function of resisting herbicides in vivo, and the DTX5 function may be stronger than that of DTX 6.

Example 6 DTX6 was located in the intimal transport system from vacuolar membrane to plasma membrane

The subcellular localization of the DTX6 protein is important for explaining its function. The invention respectively observes the positioning of DTX6 in cells through transient transgenic experiments of arabidopsis protoplasts and stable transformation strains of arabidopsis, and simultaneously adopts certain known organelle markers for co-positioning so as to judge which organelle the signal appears in.

The preparation method of the Arabidopsis thaliana rosette leaf protoplast refers to an article published by Jen Sheen laboratory in 2007 (Yoo et al, 2007), and the protoplast transformation process is as follows:

(1) uniformly mixing the constructed overexpression vector and the organelle marker vector in a ratio of 1:1, adding a proper amount of arabidopsis protoplast and PEG4000 with a final concentration of 33%, uniformly mixing, and incubating at room temperature for 10-15 min;

(2) adding W5 solution (2 mmol/L MES, 5 mmol/L KCl, 125 mmol/L CaCl)₂154 mmol/L NaCl, pH 5.7) to terminate the reaction;

(3) centrifuging for 2 min at 100 g, removing the supernatant, and adding a small amount of W5 solution to resuspend the protoplast;

(4) transferring the protoplast to a culture dish containing a W5 solution for overnight culture;

(5) the next day, protoplasts were harvested by centrifugation and observed for fluorescence signal after resuspension with a small amount of W5 solution.

In preliminary studies with DTX6, we found some punctate signals from the golgi apparatus (Lv et al, 2020), suggesting that the protein may be located in the endomembrane trafficking system associated with the golgi apparatus, but that the golgi apparatus may be divided into cis-golgi and trans-golgi apparatus, respectively associated with endocytosis, secretion or trafficking to the vacuole. We combined 35S eGFP-DTX6 with trans-Golgi/early endosomeThe somatic (TGN/EE) marker (mCherry-SYP 61) and late endosome/vacuolar precursor (LE/PVC) marker (mCherry-SYP 21) were co-transformed into Arabidopsis protoplasts for further investigation of subcellular location. Partial or complete co-localization of DTX6-eGFP with TGN/EE and LE/PVC markers could be observed in protoplasts, see FIG. 5 (A) results for co-localization of DTX6 and different organelle markers in Arabidopsis protoplasts. Mchierry-SYP 61, trans-Golgi/early endosome (TGN/EE) marker; mcherry-SYP21, late endosome/vacuole precursor (LE/PVC) localization marker. Scale =10 μm. The results showed that in vivo the DTX6 protein reached its final position by the Golgi sorting system. Interestingly, when using35S:: eYFP-DTX6When roots of transgenic lines were stabilized to observe the location of expression of DTX6, the fluorescence signal was found to occur mainly in the vacuolar membrane, plasma membrane and punctate organelles, see fig. 5 (B), where FM4-64 is a plasma membrane and intracellular membrane indicator dye. Scale =10 μm.

In summary, DTX6 was localized to the intimal transport pathway from the golgi apparatus to the vacuole and plasma membrane. In transient expression systems, it may not reach the final destination site and become trapped in the middle, including TGN/EE and LE/PVC, for some unknown reason.

Example 7 high-level structural modeling of DTX6 protein and calculation of molecular docking binding Capacity to substrate

According to the amino acid hydropathic prediction, the DTX6 protein is a membrane protein with 12 transmembrane domains, and the mutation site of DTX6 occurs at the end of the eighth transmembrane domain (shown by an arrow in FIG. 6 (A)).

Based on an isomorphic modeling method, the invention adopts online structure prediction software SWISS-MODEL (https:// swissmodel.expasy.org /) (Waterhouse et al, 2018) to predict the tertiary structures of DTX6 and G311E mutant proteins, and the selected template is CasMATE, the crystal structure of which is analyzed (Tanaka et al, 2017). The structural file of paraquat is then downloaded from PubChem (https:// PubChem. ncbi. nlm. nih. gov. /). After obtaining the structure of both molecules, the open source program AutoDock Vina was used to simulate docking (Trott and Olson, 2010). Paraquat contains 10 aromatic carbon atoms that are not capable of rotating bonds and is therefore considered to be rigid. Since the 311 th amino acid in DTX6 determines herbicide resistance, a grid box (grid box) was placed on the Gly311 in the DTX6 protein and the alpha carbon of Glu311 in the DTX6(G311E) mutein at a size of 40 ∗ 40 ∗ 40 angstroms at the time of modeling, and the docking at this position was mainly observed.

Docking was repeated 5 times for each protein with the substrate using the same parameters, each time yielding 10 binding patterns with different binding affinities. The mean value of the most favorable binding energies (MEB) and the mean values of the first three binding energies of the most favorable pattern clusters at each Time (TEB) were used to evaluate the binding affinity of the protein to the paraquat molecule.

The results show that DTX6(G311E) binds to the paraquat substrate more tightly than DTX6, as seen by the distance between the 311 residues and the substrate, see fig. 6 (B) (C), which are molecular docking mimics (molecular docking) of the binding of the DTX6 and DTX6(G311E) proteins to paraquat, respectively. Showing the structure near the substrate binding pocket at position 311. DTX6 protein is represented by a light gray colored band; DTX6(G311E) protein is represented by a light green colored band; gly311 and the mutant amino acid Glu311 in the protein are shown in yellow, respectively; the paraquat molecule is shown in cyan, with the blue portion representing positively charged N +; extracting the paraquat structure from PubChem; the DTX6 and DTX6(G311E) structures were constructed using SWISS-MODEL, respectively, according to the homology modeling method using the MATE protein CasMATE, which has solved the structure, as a template in the database. It is shown that in the DTX6(G311E) protein, residue 311 is located at the entrance of the substrate pocket, the γ carboxyl group of Glu311 extends towards the paraquat molecule, forming a more stable binding conformation, and DTX6(G311E) is closer to the substrate paraquat than the wild type DTX6 protein.

FIG. 6(D) is a calculation of the gas charge (Gasteiger charge) of the mutant protein. The Gasteiger charge for DTX6 was 0.9543, while the Gasteiger charge for DTX6(G311E) and DTX6(G311D) decreased to negative values and the Gasteiger charge for G311R and G311K increased further. The local electronegativity of the G311E and G311D muteins may contribute to the attraction of positively charged paraquat and diquat, while the increase in the electropositivity of G311R and G311K leads to an increase in the charge repulsion between the proteins and the positively charged paraquat and diquat substrate molecules, thereby reducing the binding capacity. To confirm this, we calculated the binding affinity between the protein and the substrate, and the results are shown in FIG. 6 (E). Molecules of each protein to the substrate were docked 5 times with the same parameters. The mean value of the most favorable binding pattern (MEB) and the mean value of the binding energies of the first three positions of the most favorable binding pattern (TBE) at each time were used to evaluate the binding affinity of the protein to the paraquat molecule. The results do show that both the binding affinity (MEB and TEB values) of DTX6(G311E) to paraquat is significantly higher than that of DTX 6.

In conclusion, the present invention demonstrates Arabidopsis thalianaDTX6Mutant gene of (2)DTX6(G311D)AndDTX6(G311E)the function of the herbicide resistant diquat is realized, so that the herbicide resistant diquat can be used for constructing herbicide resistant transgenic crops.

Sequence listing

<110> university of Compound Dan

<120> DTX6 mutant gene and application thereof in herbicide resistant diquat

<160> 17

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1661

<212> DNA

<213> DTX6(G311D)

<400> 1

gaagtcgtgc attctcatct cacacgttcc aaggtcaaga aaggatcgtt gacaagaact 60

aaagatctcc aagaagataa tggaagatcc acttttattg ggagacaatc agataatcac 120

cggaagtctt aagccgacgc cgacatggag gatgaatttc acggcggagc tcaagaacct 180

cagccgcatg gcgctgccta tggccaccgt gactgttgct caatatctat tacccgttat 240

ctcagtcatg gtcgccggcc accgcagcga actccagctc tcaggcgttg ctcttgccac 300

ttcttttaca aacgtatccg gcttcagtgt catgtttggt ttagcgggtg cacttgaaac 360

tctatgtggc caagcttatg gagcaaaaca atacgcgaaa atcggaactt acactttctc 420

tgcaatagtc tcaaacgtac ctatagttgt tctcatatcg attctctggt tttacatgga 480

caaactcttt gtttcacttg gacaagatcc tgacatctcc aaggtagctg gttcttacgc 540

ggtttgtctt ataccggcat tgttagctca agcggtgcaa caacctttga ctcggtttct 600

ccagactcag ggtttggttc ttcctcttct ctactgtgcc ataaccaccc ttttgttcca 660

tataccagtt tgtttgattc tggtttacgc gtttggtctt ggaagcaatg gagccgcctt 720

ggctattggt ttgtcttact ggtttaacgt cttgattctt gctttatatg tgagattttc 780

aagttcttgc gagaagactc gcggctttgt gtctgatgat ttcgtgttga gtgtcaagca 840

gttttttcag tatggaatac cttcggcagc aatgacaacc atagagtggt cattgtttga 900

gttccttata ttatcttcag gactcctccc aaacccgaaa ctcgagacct ctgttctttc 960

catttgtctt acaacctcat ctctccacta tgtcattcca atgggtattg gggcggctgg 1020

aagtatacgg gtttcaaacg aattgggagc gggtaatccc gaggttgcga ggctggcagt 1080

gtttgccggt atattccttt ggttcctaga ggctaccatt tgtagcacac ttctcttcat 1140

ttgtagagat atcttcggct acgcctttag caatagcaaa gaagttgtgg actatgtcac 1200

agagctatct cctttgcttt gtatctcatt tttggttgat ggattttctg cagtgcttgg 1260

tggggttgct aggggaagtg gatggcaaca tattggagct tgggcaaatg tggtggctta 1320

ctatctccta ggagctccgg ttggactttt cttaggattt tggtgtcaca tgaatggtaa 1380

agggctatgg atcggtgtgg tggttgggtc tacggcgcaa ggaatcatac tagctatagt 1440

cactgcttgc atgagttgga acgagcaggc tgccaaggca agacagagaa tagttgtaag 1500

aacttcttca tttggcaatg gacttgcttg aagggttctt tattcccatt tttgagacat 1560

tataatctaa gtcacattat aatctttttt cttcaatttt ggcattgata caatagagtt 1620

gtttataaaa aaatatgata aaattttaaa cttaactagt a 1661

<210> 2

<211> 483

<212> PRT

<213> DTX6(G311D)

<400> 2

Met Glu Asp Pro Leu Leu Leu Gly Asp Asn Gln Ile Ile Thr Gly Ser

1 5 10 15

Leu Lys Pro Thr Pro Thr Trp Arg Met Asn Phe Thr Ala Glu Leu Lys

20 25 30

Asn Leu Ser Arg Met Ala Leu Pro Met Ala Thr Val Thr Val Ala Gln

35 40 45

Tyr Leu Leu Pro Val Ile Ser Val Met Val Ala Gly His Arg Ser Glu

50 55 60

Leu Gln Leu Ser Gly Val Ala Leu Ala Thr Ser Phe Thr Asn Val Ser

65 70 75 80

Gly Phe Ser Val Met Phe Gly Leu Ala Gly Ala Leu Glu Thr Leu Cys

85 90 95

Gly Gln Ala Tyr Gly Ala Lys Gln Tyr Ala Lys Ile Gly Thr Tyr Thr

100 105 110

Phe Ser Ala Ile Val Ser Asn Val Pro Ile Val Val Leu Ile Ser Ile

115 120 125

Leu Trp Phe Tyr Met Asp Lys Leu Phe Val Ser Leu Gly Gln Asp Pro

130 135 140

Asp Ile Ser Lys Val Ala Gly Ser Tyr Ala Val Cys Leu Ile Pro Ala

145 150 155 160

Leu Leu Ala Gln Ala Val Gln Gln Pro Leu Thr Arg Phe Leu Gln Thr

165 170 175

Gln Gly Leu Val Leu Pro Leu Leu Tyr Cys Ala Ile Thr Thr Leu Leu

180 185 190

Phe His Ile Pro Val Cys Leu Ile Leu Val Tyr Ala Phe Gly Leu Gly

195 200 205

Ser Asn Gly Ala Ala Leu Ala Ile Gly Leu Ser Tyr Trp Phe Asn Val

210 215 220

Leu Ile Leu Ala Leu Tyr Val Arg Phe Ser Ser Ser Cys Glu Lys Thr

225 230 235 240

Arg Gly Phe Val Ser Asp Asp Phe Val Leu Ser Val Lys Gln Phe Phe

245 250 255

Gln Tyr Gly Ile Pro Ser Ala Ala Met Thr Thr Ile Glu Trp Ser Leu

260 265 270

Phe Glu Phe Leu Ile Leu Ser Ser Gly Leu Leu Pro Asn Pro Lys Leu

275 280 285

Glu Thr Ser Val Leu Ser Ile Cys Leu Thr Thr Ser Ser Leu His Tyr

290 295 300

Val Ile Pro Met Gly Ile Asp Ala Ala Gly Ser Ile Arg Val Ser Asn

305 310 315 320

Glu Leu Gly Ala Gly Asn Pro Glu Val Ala Arg Leu Ala Val Phe Ala

325 330 335

Gly Ile Phe Leu Trp Phe Leu Glu Ala Thr Ile Cys Ser Thr Leu Leu

340 345 350

Phe Ile Cys Arg Asp Ile Phe Gly Tyr Ala Phe Ser Asn Ser Lys Glu

355 360 365

Val Val Asp Tyr Val Thr Glu Leu Ser Pro Leu Leu Cys Ile Ser Phe

370 375 380

Leu Val Asp Gly Phe Ser Ala Val Leu Gly Gly Val Ala Arg Gly Ser

385 390 395 400

Gly Trp Gln His Ile Gly Ala Trp Ala Asn Val Val Ala Tyr Tyr Leu

405 410 415

Leu Gly Ala Pro Val Gly Leu Phe Leu Gly Phe Trp Cys His Met Asn

420 425 430

Gly Lys Gly Leu Trp Ile Gly Val Val Val Gly Ser Thr Ala Gln Gly

435 440 445

Ile Ile Leu Ala Ile Val Thr Ala Cys Met Ser Trp Asn Glu Gln Ala

450 455 460

Ala Lys Ala Arg Gln Arg Ile Val Val Arg Thr Ser Ser Phe Gly Asn

465 470 475 480

Gly Leu Ala

<210> 3

<211> 32

<212> DNA

<213> KpnI

<400> 3

cggggtacca tggaagatcc acttttattg gg 32

<210> 4

<211> 29

<212> DNA

<213> BamHI

<400> 4

cgcggatcct caagcaagtc cattgccaa 29

<210> 5

<211> 40

<212> DNA

<213> G311D

<400> 5

ccagccgcgt caatacccat tggaatgaca tagtggagag 40

<210> 6

<211> 40

<212> DNA

<213> G311D

<400> 6

ggtattgacg cggctggaag tatacgggtt tcaaacgaat 40

<210> 7

<211> 40

<212> DNA

<213> G311K

<400> 7

ccagccgcct taatacccat tggaatgaca tagtggagag 40

<210> 8

<211> 40

<212> DNA

<213> G311K

<400> 8

tgggtattaa ggcggctgga agtatacggg tttcaaacga 40

<210> 9

<211> 40

<212> DNA

<213> G311R

<400> 9

ccagccgccc gaatacccat tggaatgaca tagtggagag 40

<210> 10

<211> 40

<212> DNA

<213> G311R

<400> 10

tgggtattcg ggcggctgga agtatacggg tttcaaacga 40

<210> 11

<211> 22

<212> DNA

<213> qRT-PCR

<400> 11

gcaaatgtgg tggcttacta tc 22

<210> 12

<211> 21

<212> DNA

<213> qRT-PCR

<400> 12

caccgatcca tagcccttta c 21

<210> 13

<211> 59

<212> DNA

<213> gRNA

<400> 13

gaatggtctc tattgaaggt agctggttct tacggtttta gagctagaaa tagcaagtt 59

<210> 14

<211> 58

<212> DNA

<213> gRNA

<400> 14

attattggtc tctaaactaa gacaaaccaa tagccacaat ctcttagtcg actctacc 58

<210> 15

<211> 23

<212> DNA

<213> artificial

<400> 15

atcggaactt acactttctc tgc 23

<210> 16

<211> 26

<212> DNA

<213> artificial

<400> 16

gacaagtcct catgatacta gatatg 26

<210> 17

<211> 26

<212> DNA

<213> artificial

<400> 17

cagtaaagcg taacaattct gtctat 26

Claims

1. Arabidopsis thalianaDTX6(G311D)The nucleotide sequence of the gene is shown as SEQ ID NO.1, the cDNA full length is 1661bp, the open reading frame is 1452bp,DTX6(G311D)is wild typeDTX6The 311 th glycine of the gene coding protein is mutated into aspartic acid.

2.DTX6(G311D)Genes orDTX6(G311E)Use of a gene for enhancing resistance of a host to diquat, wherein said gene isDTX6(G311D)Is formed byDTX6The 311 th glycine of the protein coded by the gene is changed into aspartic acid; the above-mentionedDTX6(G311E)Is formed byDTX6The 311 th glycine of protein coded by the gene is converted into glutamic acid, and the application comprises the following specific steps:

(1) subjecting Arabidopsis thaliana toDTX6(G311D)Genes orDTX6(G311E)The full-length CDS is connected into a plant over-expression vector to obtain a gene product containingDTX6(G311D)OrDTX6(G311E)A plant overexpression vector of the gene;

(2) will containDTX6(G311D)OrDTX6(G311E)The plant over-expression vector of the gene is transferred into agrobacterium GV3101, the agrobacterium identified as positive is used for infecting plant, and the expression is obtained through transgenic experiments of seed collection, hygromycin screening and the likeDTX6 (G311D)AndDTX6(G311E)the transgenic line of (4);

(3) expressing the identified expressionDTX6(G311D)OrDTX6(G311E)The seeds of the transgenic strain are sown on a culture medium containing the diquat, the transgenic strain has obvious resistance to the diquat, and the plant grows normally.

3. ByDTX6(G311D)OrDTX6(G311E)The gene constructed transgenic carrier is to connect the mutant gene into transgenic carrier to replace antibiotic as screening marker of transgenic plant to make transgenic plant obtain pairThe resistance of the diquat is screened out on a flat plate containing the diquat; wherein, theDTX6(G311D)Is formed byDTX6The 311 th glycine of the protein coded by the gene is changed into aspartic acid; the above-mentionedDTX6(G311E)Is formed byDTX6The 311 th glycine of the protein encoded by the gene is converted into glutamic acid.

4.DTX6(G311D)OrDTX6(G311E)The application of the gene in culturing the transgenic plant with the function of resisting the aquacide is based onDTX6(G311D)OrDTX6(G311E)The function of the gene is to be expressed by transgenic meansDTX6(G311D)OrDTX6(G311E)Transferring into plants; or of an existing plantDTX6The amino acid at the corresponding 311 position of the analogous gene is edited to be D or E; wherein, theDTX6(G311D)Is formed byDTX6The 311 th glycine of the protein coded by the gene is changed into aspartic acid; the above-mentionedDTX6(G311E)Is formed byDTX6The 311 th glycine of the protein encoded by the gene is converted into glutamic acid.

5. The use according to claim 4, wherein the plant is a crop, including soybean, rice, corn, wheat or vegetables.