CN113699086A - Recombinant bacterium for producing sulforecombinant hirudin and preparation method and application thereof - Google Patents

Recombinant bacterium for producing sulforecombinant hirudin and preparation method and application thereof Download PDF

Info

Publication number
CN113699086A
CN113699086A CN202010444223.2A CN202010444223A CN113699086A CN 113699086 A CN113699086 A CN 113699086A CN 202010444223 A CN202010444223 A CN 202010444223A CN 113699086 A CN113699086 A CN 113699086A
Authority
CN
China
Prior art keywords
hirudin
gene
nucleotide sequence
recombinant
vector
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN202010444223.2A
Other languages
Chinese (zh)
Other versions
CN113699086B (en
Inventor
孙粤
包子娴
年锐
莱东
咸漠
刘文帅
樊喜英
陈泉
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Shandong energy research institute
Original Assignee
Qingdao Institute of Bioenergy and Bioprocess Technology of CAS
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Qingdao Institute of Bioenergy and Bioprocess Technology of CAS filed Critical Qingdao Institute of Bioenergy and Bioprocess Technology of CAS
Priority to CN202010444223.2A priority Critical patent/CN113699086B/en
Publication of CN113699086A publication Critical patent/CN113699086A/en
Application granted granted Critical
Publication of CN113699086B publication Critical patent/CN113699086B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/81—Protease inhibitors
    • C07K14/815—Protease inhibitors from leeches, e.g. hirudin, eglin
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/70—Vectors or expression systems specially adapted for E. coli
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/13—Transferases (2.) transferring sulfur containing groups (2.8)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P21/00—Preparation of peptides or proteins
    • C12P21/02—Preparation of peptides or proteins having a known sequence of two or more amino acids, e.g. glutathione
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y208/00—Transferases transferring sulfur-containing groups (2.8)
    • C12Y208/02—Sulfotransferases (2.8.2)
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/01—Fusion polypeptide containing a localisation/targetting motif
    • C07K2319/036—Fusion polypeptide containing a localisation/targetting motif targeting to the medium outside of the cell, e.g. type III secretion

Landscapes

  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Biomedical Technology (AREA)
  • Biophysics (AREA)
  • Medicinal Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

A recombinant bacterium for producing sulforecombinant hirudin and a preparation method and application thereof belong to the technical field of genetic engineering. In order to improve the synthetic yield of the sulforecombinant hirudin and reduce the production cost, the invention provides a recombinant bacterium for producing the sulforecombinant hirudin, wherein the recombinant bacterium overexpresses a sulfolyase gene and a hirudin gene, and a starting strain is escherichia coli; the nucleotide sequence of the hirudin gene is one of SEQ ID No.1-SEQ ID No.3, and the nucleotide sequence of the sulfonase gene is shown in SEQ ID No. 4. The invention obviously improves the activity of the recombinant hirudin, realizes the one-step purification method of the hirudin, can obtain the recombinant hirudin product with higher purity at one time, and greatly reduces the pressure of subsequent purification.

Description

Recombinant bacterium for producing sulforecombinant hirudin and preparation method and application thereof
Technical Field
The invention particularly relates to a recombinant bacterium for producing sulforecombinant hirudin and a preparation method and application thereof, belonging to the technical field of genetic engineering.
Background
Hirudin secreted by the salivary glands of the leech is known to be the most effective natural thrombin inhibitor. As a direct inhibitor of thrombin, hirudin is very different from heparin currently used in clinical practice in the principle of thrombin inhibition. Heparin inhibits the activity of thrombin by catalyzing other anticoagulants (e.g., antithrombin III or heparin cofactor II), and is an indirect anticoagulant that cannot exert its anticoagulant activity alone. The hirudin is directly combined with the active site of thrombin through a special structure, so that the enzyme activity of the hirudin is irreversibly lost. Compared with heparin, hirudin has higher anticoagulation activity, stronger specificity and stability, does not cause side effects such as bleeding and the like, can resist the action of digestive system enzymes, can be orally taken, has wider application range, and has better curative effect on diseases such as disseminated intravascular coagulation and the like. These characteristics endow hirudin with great application prospect and benefit in treating apoplexy, thrombus and other diseases.
The low natural hirudin yield and high extraction cost severely limit the application of the hirudin in the medical field. In the face of this problem, the expression and production of replaceable recombinant hirudins by bioengineered hosts has become the most promising approach. Coli or yeast were used in several groups to successfully express recombinant hirudin products with higher activity. The recombinant hirudin product, namely the recombinant Lepirudin, developed by Bayer in Germany in about 2000, was approved by the FDA and marketed in the United states, which marked the great potential for the use of recombinant hirudins.
The natural hirudin is a short peptide consisting of 63-65 amino acids, the N end of the natural hirudin contains a functional structural domain formed by three disulfide bonds, and the 63 rd tyrosine at the C end is modified by sulfonating enzyme in a cell Golgi body to form a sulfolated tyrosine. These features are crucial for the activity of hirudin. However, due to the lack of functional sulfonating enzyme, most bioengineered hosts cannot complete the posttranslational modification reaction of hirudin, which leads to a significant reduction in the activity of the recombinant hirudin lacking sulfonation compared to native hirudin. Some studies have shown that the product can be sulfonated through in vitro enzymatic reaction, but this greatly increases the production cost and difficulty, increases the pressure of downstream purification, and makes it difficult to realize large-scale production.
Disclosure of Invention
In order to improve the synthetic yield of the sulforecombinant hirudin and reduce the production cost, the invention provides a recombinant bacterium for producing the sulforecombinant hirudin, wherein the recombinant bacterium overexpresses a sulfolyase gene and a hirudin gene, and a starting strain is escherichia coli; the nucleotide sequence of the hirudin gene is one of SEQ ID No.1-SEQ ID No.3, and the nucleotide sequence of the sulfonase gene is shown in SEQ ID No. 4.
The invention also provides a preparation method of the recombinant bacterium, which comprises the following specific steps:
1) constructing a hirudin gene expression vector: adding a nucleotide sequence for coding a periplasmic secretion peptide to the 5' end of the hirudin gene to obtain a hirudin gene with the periplasmic secretion peptide, and then connecting the hirudin gene with a plasmid vector to obtain an expression vector for expressing hirudin;
2) constructing a sulfoenzyme gene auxiliary vector: adding a nucleotide sequence for coding periplasmic secretion peptide at the 5' end of the sulfotransferase gene to obtain the sulfotransferase gene with the periplasmic secretion peptide, and then connecting the sulfotransferase gene with a plasmid vector to obtain an auxiliary vector for expressing the sulfotransferase; the nucleotide sequences of the periplasmic secretion peptide coding in the steps 1) and 2) are shown as SEQ ID No. 5;
3) and (3) transformation: co-transforming the expression vector obtained in the step 1) and the auxiliary vector obtained in the step 2) to escherichia coli to obtain a recombinant bacterium.
Further defining, the plasmid vector in the step 1) is pet-22b vector; the plasmid vector in the step 2) is pACYC-DUET1 vector.
Further defining, the hirudin gene with periplasmic secretion peptide of step 1) and primers used for amplification are F1 and R1; the nucleotide sequence of F1 is: ATACATATGAAGTATCTGTTACCTACCGC, wherein the nucleotide sequence of R1 is: GGTGCTCGAGTCATTGCAGATAGTAGTACGGA are provided.
Further limiting, in the step 2), primers for amplification of the sulfoase gene with the periplasmic secretion peptide are F2 and R2, the nucleotide sequence of F2 is TATACATATGAAATATCTGCTGCCTACC, and the nucleotide sequence of R2 is AGACTCGAGTCATCAGCAGCTAATGGT.
The invention also provides application of the recombinant bacterium in producing the sulforecombinant hirudin.
Further defined, the method for producing a sulpholated recombinant hirudin is as follows:
1) adding the constructed recombinant bacteria into a test tube of an LB (lysogeny broth) culture medium containing kanamycin and chloramphenicol, and carrying out shake culture at 37 ℃ at the rotating speed of 100-250rpm for 6-16 h; after the culture, transferring the bacterial liquid in the test tube into a shake flask, and performing shake culture at 37 ℃ and 100-250rpm until the bacterial liquid is OD600 0.4～1.0；
2) Then adding IPTG and 4-nitrophenyl sulfate into the obtained bacterial liquid, wherein the final concentrations are 1mM and 0.01 mu M respectively, and culturing for 4-6 h at 37 ℃; centrifuging or filtering the obtained bacterial liquid, and collecting bacterial precipitation; adding periplasmic protein extracting solution into the obtained precipitate, extracting to obtain protein solution, and purifying to obtain the sulforecombinant hirudin.
Further defined, the formula of the periplasmic protein extracting solution is as follows: sucrose 171.15g/L, EDTA0.19g/L, and water as the rest, and the solution is brought to pH 8.0 with Tris-base powder.
Further limiting, the purification means that the obtained protein solution is dialyzed for 48h to 96h, distilled water is used as dialysate in the dialysis process, precipitates are removed by centrifugation after the dialysis is finished, and the obtained supernatant solution is freeze-dried.
Further limiting, the freeze-drying condition is that the temperature is-20 to-80 ℃ and the time is 24 to 72 hours.
Advantageous effects
The invention designs a production method of sulforecombinant hirudin for realizing direct expression of recombinant hirudin. In view of the special disulfide bond structure of hirudin, a periplasmic space signal peptide is added at the N-terminal of hirudin, and the hirudin is expressed in the periplasm to promote the correct formation of the disulfide bond of the hirudin. Meanwhile, by simultaneously expressing a sulfotransferase (Arylsulfate sulfotransferase) which is derived from eubacteria (Eubacterium) and takes an aromatic compound as a substrate, a method for co-expressing the sulfotransferase is adopted. By adding the periplasmic secretion peptide at the N ends of hirudin and the sulfonating enzyme, coexistence of two proteins in a periplasmic space is realized, and by adding sulfate containing an aromatic ring in a culture medium as a sulfonating substrate, the sulfonating enzyme can play a role in the periplasmic space of escherichia coli and realize the sulfonating reaction of the recombinant hirudin, so that the activity of the recombinant hirudin is remarkably improved. And at the same time, based on the properties of hirudin. Meanwhile, the method realizes the one-step purification method of hirudin by utilizing the periplasmic protein extraction and acid precipitation method, can obtain a recombinant hirudin product with higher purity at one time, and greatly reduces the pressure of subsequent purification.
Drawings
FIG. 1 shows the results of electrophoresis of recombinant hirudin and sulfohirudin, wherein M, protein Marker, is 180, 135, 100, 75, 63, 48, 35, 25, 17, 11kDa from top to bottom; CT, uninduced broth sample (comparative example 2); h, post-induction bacterial liquid sample (comparative example 1); h + S, co-expressing a bacterial liquid sample after induction of the sulfonating enzyme;
FIG. 2 shows the electrophoresis result of the purified recombinant hirudin, wherein M, protein Marker, is 180 kDa, 135 kDa, 100 kDa, 75 kDa, 63 kDa, 48 kDa, 35 kDa, 25 kDa, 17 kDa, and 11kDa, respectively; CT, uninduced broth sample (comparative example 2); h, post-induction bacterial liquid sample (comparative example 1); p, sulfohirudin sample after purification;
FIG. 3 is a graph of the anticoagulant difference of two hirudins against rabbit serum, H, sample of post-induction bacteria (comparative example 1); h + S, co-expressing the bacterial liquid sample after induction of the sulfonatase, wherein the ordinate is the ratio change of the anticoagulation effect of the bacterial liquid sample after induction;
FIG. 4 is a graph of the anticoagulant difference of two hirudins against sheep serum, H, sample of induced bacteria (comparative example 1); h + S, co-expressing the bacterial liquid sample after induction of the sulfonating enzyme, and the ordinate is the ratio change of the anticoagulation effect of the bacterial liquid sample after induction.
Detailed Description
The present invention will be further described with reference to the following specific examples, but the present invention is not limited to these examples.
The experimental reagents, instruments and equipment used in the present invention can be purchased commercially, and those skilled in the art will understand that the target gene cloning, strain transformation and the like mentioned in the present invention are performed according to standard molecular cloning techniques or with reference to the corresponding reagent product kit instructions, unless otherwise specified.
Example 1 preparation of recombinant bacteria for the production of sulforecombinant hirudin.
The recombinant strain prepared by the embodiment overexpresses a sulfonase gene and a hirudin gene, wherein the nucleotide sequence of the hirudin gene is shown in SEQ ID No.1, the nucleotide sequence of the sulfonase gene is shown in SEQ ID No.4, and the starting strain is escherichia coli. The construction method comprises the following steps:
1) constructing a hirudin gene expression vector: adding a nucleotide sequence for coding a periplasmic secretion peptide to the 5' end of the hirudin gene to obtain a hirudin gene with the periplasmic secretion peptide, and then connecting the hirudin gene with a plasmid vector to obtain an expression vector for expressing hirudin; the specific method comprises the following steps:
the nucleotide sequence encoding the periplasmic secretion peptide shown in SEQ ID No.5 was added to the 5' end of the hirudin gene shown in SEQ ID No.1 and the resulting sequence was submitted to the Gene synthesizer for sequence synthesis.
By using primers F1 and R1, the nucleotide sequence of F1 is as follows: ATACATATGAAGTATCTGTTACCTACCGC, wherein the nucleotide sequence of R1 is: GGTGCTCGAGTCATTGCAGATAGTAGTACGGA, respectively; amplifying a hirudin gene with periplasmic secretory peptide nucleotide by taking the synthesized sequence as a template, recovering a PCR product, carrying out enzyme digestion on the amplification product by using Nde I and Xho I restriction enzymes, and connecting the product with a pet-22b vector digested by the same restriction enzymes.
The enzyme cutting system is as follows: nde I1. mu.l, Xho I1. mu.l, vector or PCR amplification product 2ug, digestion buffer (10X) 2. mu.l, make up distilled water to a total volume of 20. mu.l, and digest for 4h at 37 ℃.
The connecting system is as follows: 7 mul of amplified product after enzyme digestion, 1 mul of carrier after enzyme digestion, 2 mul of connecting liquid (10X), and T4Ligase 1. mu.l, distilled water was supplemented to a total volume of 20. mu.l, and ligation was carried out at 16 ℃ for 12 hours, thereby obtaining a hirudin expression vector.
2) Constructing a sulfoenzyme gene auxiliary vector: adding a nucleotide sequence for coding periplasmic secretion peptide at the 5' end of the sulfotransferase gene to obtain the sulfotransferase gene with the periplasmic secretion peptide, and then connecting the sulfotransferase gene with a plasmid vector to obtain an auxiliary vector for expressing the sulfotransferase; the specific method comprises the following steps:
adding the nucleotide sequence of the coding periplasmic secretion peptide shown in SEQ ID No.5 to the 5' end of the sulfotransferase gene shown in SEQ ID No.4, and delivering the obtained sequence to a gene synthesis company for sequence synthesis.
By using primers F2 and R2, the nucleotide sequence of F2 is TATACATATGAAATATCTGCTGCCTACC, and the nucleotide sequence of R2 is AGACTCGAGTCATCAGCAGCTAATGGT; and (3) amplifying the sulfoenzyme gene with periplasmic secretory peptide nucleotide by taking the synthesized sequence as a template, carrying out enzyme digestion on the amplified fragment by using Nde I and Xho I restriction enzymes, and connecting with a pACYC-DUET1 vector subjected to enzyme digestion by using the same restriction enzymes.
The enzyme cutting system is as follows: nde I1. mu.l, Xho I1. mu.l, vector or amplification 2ug, digestion buffer (10X) 2. mu.l, total volume 20. mu.l supplemented with distilled water, digestion at 37 ℃ for 4 h.
The connecting system is as follows: 7 mul of amplified product after enzyme digestion, 1 mul of carrier after enzyme digestion, 2 mul of connecting liquid (10X), and T4Ligase 1. mu.l, distilled water supplemented to a total volume of 20. mu.l, ligation at 16 ℃ for 12 h. Obtaining the auxiliary vector for expressing the sulfonating enzyme.
3) And (3) transformation: co-transforming the hirudin expression vector obtained in the step 1) and the auxiliary vector for expressing the sulfonatase obtained in the step 2) into an escherichia coli BL21(DE3) strain, and coating the strain on a plate containing kanamycin and chloramphenicol; and selecting a single clone from the obtained plate, and identifying to obtain the positive recombinant bacteria.
Example 2. example 1 was repeated, with the difference from example 1 that the nucleotide sequence of the hirudin gene in this example is shown in SEQ ID No.2, in which case the base G at position 181 of the hirudin gene was replaced by the base T and the base A at position 183 by the base C, in comparison with example 1. The rest of the procedure was referred to example 1.
Example 3. example 1 was repeated, with the difference that in this example the hirudin gene, the nucleotide sequence of which is shown in SEQ ID No.3, was replaced by the base T at position 181, the base C at position 183, the base T at position 184 and the base C at position 186, respectively, compared to example 1. The rest of the procedure was referred to example 1.
Example 4. production of sulfoated recombinant hirudin.
1) The recombinant bacteria constructed in example 1 were spread on a plate containing double antibiotics (kanamycin and chloramphenicol); after culturing, selecting a monoclonal, transferring the monoclonal into a test tube containing LB culture medium added with double antibiotics (kanamycin and chloramphenicol) in advance, and carrying out shake culture at 37 ℃, wherein the rotating speed is kept at 250rpm, and the time is controlled at 6 h; transferring the cultured bacterial solution to LB culture medium containing antibiotics (kanamycin and chloramphenicol), performing shake culture at 37 deg.C, maintaining the rotation speed at 250rpm, and adjusting to OD6000.4；
2) Adding IPTG and a sulfate substrate 4-nitrophenyl sulfate into the bacterial liquid obtained in the step 1), wherein the final concentrations are 1mM and 0.01 mu M respectively, and culturing for 4h at 37 ℃; collecting the obtained bacterial liquid, centrifuging or filtering, removing supernatant and collecting bacterial precipitates; adding periplasmic protein extract (sucrose 171.15g/L, EDTA0.19g/L, and Tris-base powder to pH 8.0), slowly stirring at 4 deg.C, centrifuging or filtering to collect supernatant; slowly adding glacial acetic acid solution into the supernatant until the pH value is 3.0, standing at 4 ℃ for 30min, and centrifuging to collect the supernatant; dialyzing the obtained protein solution for 48-96 h, taking distilled water as dialysate in the dialysis process, centrifuging to remove precipitate after dialysis, and lyophilizing the obtained supernatant solution (at-80 deg.C for 72h) to obtain the sulforecombinant hirudin.
In the embodiment, the yield of hirudin can reach 97.5mg/L in the shake flask level, and the anticoagulation effect can be improved by more than 2 times (fig. 3-4).
Example 5 production of sulfoated recombinant hirudin.
1) The recombinant bacteria constructed in example 2 were spread on a plate containing double antibiotics (kanamycin and chloramphenicol); the rest of the procedure described with reference to example 4.
The yield of the sulforecombinant hirudin produced by the embodiment can reach 96.8 percent in the shaking stage, and the anticoagulation effect can be improved by more than 2 times (not shown in the figure).
Example 6 production of sulfoated recombinant hirudin.
1) The recombinant bacteria constructed in example 3 were spread on plates containing the double antibiotics (kanamycin and chloramphenicol); the rest of the procedure described with reference to example 4.
The yield of the sulforecombinant hirudin produced by the embodiment can reach 97.3 percent in the shaking stage, and the anticoagulation effect can be improved by more than 2 times (not shown in the figure).
Example 7 production of sulfoated recombinant hirudin.
1) The recombinant bacteria constructed in example 1 were spread on a plate containing double antibiotics (kanamycin and chloramphenicol); after culturing, selecting a monoclonal, transferring the monoclonal into a test tube containing LB culture medium added with double antibiotics (kanamycin and chloramphenicol) in advance, and carrying out shake culture at 37 ℃, wherein the rotating speed is kept at 100rpm, and the time is controlled at 16 h; after cultivationThe resulting bacterial solution was transferred to LB medium supplemented with antibiotics (kanamycin and chloramphenicol) in advance, and the rotation speed was maintained at 100rpm in 37 ℃ shaking culture until OD600 1；
2) Adding IPTG and a sulfate substrate 4-nitrophenyl sulfate into the bacterial liquid obtained in the step 1), wherein the final concentrations are 1mM and 0.01 mu M respectively, and culturing for 6h at 37 ℃; collecting the obtained bacterial liquid, centrifuging or filtering, removing supernatant and collecting bacterial precipitates; adding periplasmic protein extract (sucrose 171.15g/L, EDTA0.19g/L, and Tris-base powder to pH 8.0), slowly stirring at 4 deg.C, centrifuging or filtering to collect supernatant; slowly adding glacial acetic acid solution into the supernatant until the pH value is 3.0, standing at 4 ℃ for 30min, and centrifuging to collect the supernatant; dialyzing the obtained protein solution for 48-96 h, taking distilled water as dialysate in the dialysis process, centrifuging to remove precipitate after dialysis, and lyophilizing the obtained supernatant solution at (-20 deg.C, 24h) to obtain the sulforecombinant hirudin.
The yield of the hirudin produced by the embodiment can reach 97.1mg/L in the shake flask level, and the anticoagulation effect can be improved by more than 2 times (not shown in the figure).
Comparative example 1. construction of recombinant bacterium described with reference to example 1, in contrast to example 1, in this comparative example only the hirudin expression vector was transformed into E.coli BL21(DE3) strain to obtain a recombinant bacterium which does not express the sulfonyase, and then hirudin production was carried out with reference to the method described in example 4.
Comparative example 2, which is different from example 1 in that only the hirudin expression vector was transformed into E.coli BL21(DE3) strain to obtain a recombinant bacterium that does not express the sulfonatose, and then hirudin production was performed according to the method described in example 4, and IPTG and the sulfate substrate 4-nitrophenyl sulfate were not added to the system in the production of hirudin, is different from example 4.
SEQUENCE LISTING
<110> institute of bioenergy and Process in Qingdao, China academy of sciences
<120> recombinant bacterium for producing sulforecombinant hirudin, preparation method and application thereof
<130>
<160> 9
<170> PatentIn version 3.5
<210> 1
<211> 204
<212> DNA
<213> hirudin gene
<400> 1
gtggtgtata ccgattgcac cgaaagcggc caaaacctgt gtctgtgcga aggcagcaat 60
gtttgtggcc agggcaacaa atgcattctg ggcagcgatg gcgaaaaaaa ccagtgcgtg 120
accggtgaag gtacccctaa accgcagagc cataacgatg gcgactttga agaaattccg 180
gaagaatatc tgcaataact cgag 204
<210> 2
<211> 204
<212> DNA
<213> hirudin gene
<400> 2
gtggtgtata ccgattgcac cgaaagcggc caaaacctgt gtctgtgcga aggcagcaat 60
gtttgtggcc agggcaacaa atgcattctg ggcagcgatg gcgaaaaaaa ccagtgcgtg 120
accggtgaag gtacccctaa accgcagagc cataacgatg gcgactttga agaaattccg 180
tacgaatatc tgcaataact cgag 204
<210> 3
<211> 204
<212> DNA
<213> hirudin gene
<400> 3
gtggtgtata ccgattgcac cgaaagcggc caaaacctgt gtctgtgcga aggcagcaat 60
gtttgtggcc agggcaacaa atgcattctg ggcagcgatg gcgaaaaaaa ccagtgcgtg 120
accggtgaag gtacccctaa accgcagagc cataacgatg gcgactttga agaaattccg 180
tactactatc tgcaataact cgag 204
<210> 4
<211> 1821
<212> DNA
<213> Sulphonylase gene
<400> 4
gaagcggaac aggcgatgct ggcgaaattt gaagcgggca actataccat tgcgaacccg 60
ctggtgacct ataacgcgta tctggtgaac ccgttatcag cggtggtgtg ctttaacacc 120
gaaaaagaaa ccgcggtgac cgttaccgtg ttaggcaaaa ccccgcaggg caacattagc 180
catacctttc cgaaagcgaa aaaacatgtg ctgccgattg tgggcctgta tagcgattat 240
cagaaccgca ttgaaattcg cgcgtatcgc ggcgaaagca acattattac cattgatgtg 300
ccggatgtgt ttgatggcaa ggaagtgatt tatagcatgg ataccacccc ggaatatctg 360
caggataaca ttattctggt gagcccggcg ggtgaagatt tagcggtggg ctttgattat 420
gcgggcgatg cgcgttggca catgactgtg ccgtgcgtgt ttgatgtgaa acgcctgaaa 480
aacggcaacc tgattatggg cagccatcgc gtgattcaga tgccgtatta tatgagcggc 540
ctgtatgaaa ttagcccgtg cggcaagatt tataaagaat ttcgcctgcc gggcggctat 600
catcatgatg aattcgagat ggaagatggc aacctgctga gcctgaccga tgatctgacc 660
agcgaaaccg tggaagatat gtgcgtgctg attgatcgca acaccggcga aattctgaaa 720
acctgggact ataagaaatt cctggacccg aaaaccgtta gccgtagcgg tagctggagc 780
gatcatgatt ggtttcataa caacgcggtg tggtatgata aaaacaccaa cagcctgacc 840
tttagcggcc gccatattga tagcattgtg aacatcgatt atgaaaccgg cgatctgaac 900
tggattattg gcgatccgga aggctggccg gaagaaatgc agaagtactt cttcaaaccg 960
gtgggcaaca actttggctg gcagtatgaa cagcatgcgt gcgtgattac ccctgatggc 1020
gatgtgatgt gctttgacaa ccatcattac ggcagcaaaa acaaggaaaa ctatctggcg 1080
gcgaaagata actatagccg cggcgtgcgc tataaaatta acaccgacga catgaccatt 1140
gaacaggtgt ggcagtatgg caaagatcgc ggcgcggaat tttttagccc gtacatttgc 1200
aacgtgcagt attataacga aggccactat atggtgcata gcggcggcat tgcgtatgat 1260
agcgaaggca acccgtcaga agcgttaggc gcgtttgcga aagatcaagg cggccgcctg 1320
gaatcaatta ccgtggaaat ctgcgataac aaaaagatgc tggatctgca tgtgccgggc 1380
aactattatc gcggcgaaaa gctgaaactg tatagcgatg gcattaacct ggaactgggc 1440
aaaggccaga ttctgggcga aatgggcgtg accaaagaat ttgataccga gattccgtta 1500
gatccgagcg gcgaaatgtt accggaaagc tgcaacgcgc gcattgaaga tgaaattgac 1560
cgcttcacct tttttagccg ctttgaaaaa ggccagctgg tgatgttact gctggaacag 1620
ggcgaagaag tgcatcgcta ttttattagc accaccgcgg ttccgttttt agcgatgtgc 1680
tgcggcacct ttctggatag cgatgatcgc aacacccgca ccaacattaa caaagcgggc 1740
ctgaaaggca cctatgatgt gcgcgtgatc attgatgaca agaagtatga aaccggcgtg 1800
accattagct gctgactcga g 1821
<210> 5
<211> 69
<212> DNA
<213> periplasmic secretion peptide
<400> 5
catatgaagt atctgttacc taccgcggcg gcgggtttat tattactggc ggcgcaacct 60
gcaatggcg 69
<210> 6
<211> 29
<212> DNA
<213> F1
<400> 6
atacatatga agtatctgtt acctaccgc 29
<210> 7
<211> 32
<212> DNA
<213> R1
<400> 7
ggtgctcgag tcattgcaga tagtagtacg ga 32
<210> 8
<211> 28
<212> DNA
<213> F2
<400> 8
tatacatatg aaatatctgc tgcctacc 28
<210> 9
<211> 27
<212> DNA
<213> R2
<400> 9
agactcgagt catcagcagc taatggt 27

Claims (10)

1. A recombinant bacterium for producing sulforecombinant hirudin is characterized in that the recombinant bacterium overexpresses a sulfohydrolase gene and a hirudin gene, and the starting strain is escherichia coli; the nucleotide sequence of the hirudin gene is one of SEQ ID No.1-SEQ ID No.3, and the nucleotide sequence of the sulfonase gene is shown in SEQ ID No. 4.
2. The preparation method of the recombinant bacterium of claim 1, which is characterized by comprising the following steps:
1) constructing a hirudin gene expression vector: adding a nucleotide sequence for coding a periplasmic secretion peptide to the 5' end of the hirudin gene to obtain a hirudin gene with the periplasmic secretion peptide, and then connecting the hirudin gene with a plasmid vector to obtain an expression vector for expressing hirudin;
2) constructing a sulfoenzyme gene auxiliary vector: adding a nucleotide sequence for coding periplasmic secretion peptide at the 5' end of the sulfotransferase gene to obtain the sulfotransferase gene with the periplasmic secretion peptide, and then connecting the sulfotransferase gene with a plasmid vector to obtain an auxiliary vector for expressing the sulfotransferase; the nucleotide sequences of the periplasmic secretion peptide coding in the steps 1) and 2) are shown as SEQ ID No. 5;
3) and (3) transformation: co-transforming the expression vector obtained in the step 1) and the auxiliary vector obtained in the step 2) to escherichia coli to obtain a recombinant bacterium.
3. The method according to claim 2, wherein the plasmid vector of step 1) is pet-22b vector; the plasmid vector in the step 2) is pACYC-DUET1 vector.
4. The method according to claim 2, wherein the primers used for the amplification of the hirudin gene with periplasmic secretion peptide in step 1) are F1 and R1; the nucleotide sequence of F1 is: ATACATATGAAGTATCTGTTACCTACCGC, wherein the nucleotide sequence of R1 is: GGTGCTCGAGTCATTGCAGATAGTAGTACGGA are provided.
5. The preparation method of claim 2, wherein primers for amplification of the sulfoase gene with periplasmic secretion peptide in step 2) are F2 and R2, the nucleotide sequence of F2 is TATACATATGAAATATCTGCTGCCTACC, and the nucleotide sequence of R2 is AGACTCGAGTCATCAGCAGCTAATGGT.
6. Use of the recombinant bacterium according to claim 1 for the production of a sulpho-recombinant hirudin.
7. The use according to claim 6, wherein the process for the production of a sulpho-recombinant hirudin is as follows:
1) adding the recombinant strain of claim 1 into a test tube of an LB culture medium containing kanamycin and chloramphenicol, and performing shake culture at 37 ℃ at the rotating speed of 100-250rpm for 6-16 h; after the culture, transferring the bacterial liquid in the test tube into a shake flask, and performing shake culture at 37 ℃ and 100-250rpm until the bacterial liquid is OD600 0.4～1.0；
2) Then adding IPTG and 4-nitrophenyl sulfate into the obtained bacterial liquid, wherein the final concentrations are 1mM and 0.01 mu M respectively, and culturing for 4-6 h at 37 ℃; centrifuging or filtering the obtained bacterial liquid, and collecting bacterial precipitation; adding periplasmic protein extracting solution into the obtained precipitate, extracting to obtain protein solution, and purifying to obtain the sulforecombinant hirudin.
8. The use of claim 7, wherein the periplasmic protein extract is formulated as: sucrose 171.15g/L, EDTA0.19g/L, balance water, and Tris-base powder brought to pH 8.0.
9. The use of claim 7, wherein the purification is carried out by dialyzing the obtained protein solution for 48-96 h with distilled water as dialysate, centrifuging to remove precipitate after dialysis, and lyophilizing the obtained supernatant solution.
10. The use according to claim 9, wherein the freeze-drying conditions are a temperature of-20 to-80 ℃ and a time of 24 to 72 hours.
CN202010444223.2A 2020-05-22 2020-05-22 Recombinant bacterium for producing sulforecombinant hirudin and preparation method and application thereof Active CN113699086B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202010444223.2A CN113699086B (en) 2020-05-22 2020-05-22 Recombinant bacterium for producing sulforecombinant hirudin and preparation method and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202010444223.2A CN113699086B (en) 2020-05-22 2020-05-22 Recombinant bacterium for producing sulforecombinant hirudin and preparation method and application thereof

Publications (2)

Publication Number Publication Date
CN113699086A true CN113699086A (en) 2021-11-26
CN113699086B CN113699086B (en) 2023-03-28

Family

ID=78646436

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202010444223.2A Active CN113699086B (en) 2020-05-22 2020-05-22 Recombinant bacterium for producing sulforecombinant hirudin and preparation method and application thereof

Country Status (1)

Country Link
CN (1) CN113699086B (en)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN113789293A (en) * 2021-11-16 2021-12-14 江苏省中国科学院植物研究所 Escherichia coli engineering strain for high yield of natural hirudin and application thereof
CN113789335A (en) * 2021-11-16 2021-12-14 江苏省中国科学院植物研究所 Leech tyrosine sulfotransferase gene and application thereof
CN114736289A (en) * 2022-03-17 2022-07-12 华南理工大学 Chemical synthesis method of hirudin with tyrosine sulfation modification

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6514730B1 (en) * 1991-03-21 2003-02-04 Consortium für elektrochemische Industrie GmbH Secretion of hirudin derivatives
CN103059130A (en) * 2012-12-22 2013-04-24 浙江工业大学 Hirudin mutant and genetically engineered bacterium thereof

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6514730B1 (en) * 1991-03-21 2003-02-04 Consortium für elektrochemische Industrie GmbH Secretion of hirudin derivatives
CN103059130A (en) * 2012-12-22 2013-04-24 浙江工业大学 Hirudin mutant and genetically engineered bacterium thereof

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
FIN等: "The effects of overexpression of cytoplasmic chaperones on secretory production of hirudin-PA in E.coli", 《PROTEIN EXORESSION AND PURIFICATION》 *
黄孔威等: "重组水蛭素的原核表达及分离纯化", 《中国畜牧兽医》 *

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN113789293A (en) * 2021-11-16 2021-12-14 江苏省中国科学院植物研究所 Escherichia coli engineering strain for high yield of natural hirudin and application thereof
CN113789335A (en) * 2021-11-16 2021-12-14 江苏省中国科学院植物研究所 Leech tyrosine sulfotransferase gene and application thereof
CN113789335B (en) * 2021-11-16 2022-03-15 江苏省中国科学院植物研究所 Leech tyrosine sulfotransferase gene and application thereof
CN114736289A (en) * 2022-03-17 2022-07-12 华南理工大学 Chemical synthesis method of hirudin with tyrosine sulfation modification
CN114736289B (en) * 2022-03-17 2023-07-18 华南理工大学 Chemical synthesis method of hirudin with tyrosine sulfation modification

Also Published As

Publication number Publication date
CN113699086B (en) 2023-03-28

Similar Documents

Publication Publication Date Title
CN113699086B (en) Recombinant bacterium for producing sulforecombinant hirudin and preparation method and application thereof
JP2004518444A (en) Fusion proteins for secretion of important proteins into bacterial culture supernatant
CN105647943B (en) Saussurea involucrate cell squalene synthase gene SiSQS and coded product and application thereof
CN111607613A (en) Plasmid vector for expressing mRNA of cellular immune vaccine and construction method and application thereof
WO2008100833A2 (en) Production of recombinant collagenases colg and colh in escherichia coli
WO2014097733A1 (en) Method for manufacturing human epidermal cell growth factor
KR100961528B1 (en) Method for Over-expressing Human Epidermal Growth Factor as Bioactive Form in Escherichia. coli
CN112608933B (en) High-purity preparation method of recombinant blue copper peptide precursor-oligopeptide
RU2603054C2 (en) Method of wheat cysteine protease proteins family (triticum aestivum) producing and preparation of tritikaie-alpha protein, obtained using said method
RU2447151C1 (en) ALKALINE PHOSPHATASE CmAP SYNTHESIS-DETERMINING 40Ph PLASMID, E. coli rosetta(DE3)/40Ph STRAIN - PRODUCER OF CHIMERIC PROTEIN, CONTAINING AMINO ACID SEQUENCE OF RECOMBINANT ALKALINE PHOSPHATASE CmAP, AND PRODUCTION METHOD THEREOF
WO2023019832A1 (en) Expression and purification method for main protease of coronavirus
CN113025599B (en) Recombinant clostridium histolyticum type I collagenase as well as preparation method and application thereof
US20220135960A1 (en) Polypeptide tag, highly soluble recombinant nitrilase and application thereof in synthesis of pharmaceutical chemicals
ES2270827T3 (en) USE OF PANCREATIC PROCARBOXIPEPTIDASE B FOR INSULIN PRODUCTION.
CN116478969A (en) Collagenase mutant, method for promoting secretory expression of recombinant collagenase and application thereof
RU2453604C1 (en) Hybrid protein (versions), bacterial strain escherichia coli - hybrid protein producer (versions) and method for producing methionine-free human interferon alpha-2
RU2441072C1 (en) FUSION PROTEIN, ESCHERICHIA COLI STRAIN BEING FUSION PROTEIN PRODUCER AND METHOD FOR PRODUCING METHIONINE-FREE HUMAN INTERFERON ALPHA-2b OF SUCH FUSION PROTEIN
JPH06311884A (en) Plasmid and escherichia coli transformed with the same
KR101261852B1 (en) Agarase expression vector, transgenic organism transformed with the same vector and method for the production of agarase using the same transgenic organism
CN112375774A (en) Construction method of engineering strain for recombinant protein expression
CN111607612A (en) Plasmid vector for expressing humoral immunity vaccine mRNA and construction method and application thereof
KR930003913B1 (en) Method for preparation of polypeptide having thrombin inhibiting activity
CN114702571B (en) Fibronectin capable of promoting stem cell colonization and preparation method thereof
CN116769756B (en) Application of PG2-LC protein as hydrolase of SNAP-25
WO2024087761A1 (en) Method for producing polypeptide from recombinant fusion protein and use thereof

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant
TR01 Transfer of patent right
TR01 Transfer of patent right

Effective date of registration: 20240221

Address after: 266101 Shandong Province, Qingdao city Laoshan District Songling Road No. 189

Patentee after: Shandong Energy Research Institute

Country or region after: China

Address before: 266101 Shandong Province, Qingdao city Laoshan District Songling Road No. 189

Patentee before: QINGDAO INSTITUTE OF BIOENERGY AND BIOPROCESS TECHNOLOGY, CHINESE ACADEMY OF SCIENCES

Country or region before: China