RU2603054C2 - Method of wheat cysteine protease proteins family (triticum aestivum) producing and preparation of tritikaie-alpha protein, obtained using said method - Google Patents

Abstract

FIELD: biotechnology.

SUBSTANCE: invention relates to biotechnology and represents method of tritikaine-alpha wheat truncated shape producing, having sequence of SEQ ID NO: 2 (shortTRIT-α), recombinant expressed in bacterial system, consisting in culturing of cells E.coli JM109, transformed by plasmid pQE80L_shortTRIT-α, containing DNA sequence coding shortTRIT-α protein, in LB medium with addition of ampicillin at 37 °C under aerobic conditions for 12-14 h, nutrient medium is inoculated with inoculum, culture is raised until optical density of A₆₀₀ 0.6-0.8, induced by 1 mM isopropylite-β-D-galactoside and raised for another 2.5-3 hours; target protein shortTRIT-α cleaning is carried out by affine metal-chelate chromatography: deposited by centrifugation expression culture cell biomass is re-suspended in buffer containing 0.01 M of Tris-HCl, pH 8.0 and homogenized on ultrasonic disintegrator for 1 min at 4 °C, produced after lysate centrifugation residue is washed with initial buffer and dissolved in buffer A, consisting of 6 M of guanidine-chloride and 0.05 M of Tris-HCl, pH 7.8, solution is clarified by centrifugation and applied on column with activated nickel ions iminodiacetate-sepharose, balanced by buffer A, sorbent is successively washed with balancing buffer A and same buffer containing 8 M of urea and 0.005 M of imidazole, protein is eluted with buffer A containing 8 M of urea and 0.25 M of imidazole, then eluate is added into cooled buffer of 0.05 M of Tris-HCl, 0.5 M of arginine-chloride, 2 M of urea, pH 7.8 at ratio of 1:5 and stirred for 1 h at 4 °C, solution is dialyzed against 0.05 M of Tris-HCl, pH 7.8 at 4 °C, supernatant produced after dialysate centrifugation, is concentrated on Amicon cell with RM-10 (Millipore) membrane, with subsequent dialysis against phosphate-salt buffer PBS, pH 7.4, at 4 °C, concentration of shortTRIT-α protein is determined, aliquoted by glass bottles, freezing and lyophilized.

EFFECT: invention enables to obtain pure protein preparation with tritikaine-alpha wheat activity with high degree of efficiency.

3 cl, 6 dwg, 4 ex

Description

The invention relates to the field of molecular biology, preparative biochemistry, biotechnology, biopharmacology, and in particular to the creation of a method for producing recombinant proteins of the wheat cysteine protease family (Triticum aestivum) and a triticain-alpha protein preparation consisting of a truncated form of wheat triticain-alpha. The invention can be used in medicine for the development of enzyme therapeutic drugs.

Triticaines (triticain-α, -β, -γ) are highly conserved papain-like wheat cysteine endoproteases, consisting of a signal (leader) peptide that is deleted when the pro-peptide domain is activated, a granulin-like domain [GenBank AB267407] and a catalytic domain with a catalytic Cys-His-Asn triad [1]. Cysteine proteases are common in plants and are expressed in their various organs [2, 3]. It is assumed that these enzymes participate in the stage of specific cleavage and post-translational modifications of storage proteins [4, 5]. Among the papain-like plant cysteine proteases, rice and barley enzymes, oryzain (oryzain-α, -β, -γ) and endopeptidase EPB (barley cysteine proteinase B-1, -2), are most widely studied [6, 7], but wheat proteases began to study relatively recently [1, 8].

The main advantage of papain-like cysteine proteinases from plant seeds at the moment is their endopeptidase activity, in particular glutenase activity - the ability to effectively hydrolyze peptides of gluten (a storage protein of wheat, consisting of a mixture of monomeric gliadins and polymer glutenins) or related storage proteins of rye and barley. This property of plant enzymes allows us to consider them promising objects in the development of drugs to combat celiac disease. Celiac disease (celiac enteropathy) is a complex inflammatory disease in humans, which develops in the presence of an appropriate genetic predisposition in response to peptides enriched in proline and glutamine residues, which are products of partial gluten proteolysis in the digestive tract [9, 10]. The prevalence of celiac enteropathy in the adult population of most countries of the world is estimated as 1: 100 - 1: 250 or 0.5-1% of the total population [11]. A proven effective treatment for celiac disease is a lifelong strict gluten-free diet that can prevent the development of complications and eliminate the clinical symptoms of the disease [12]. However, the main disadvantage of a gluten-free diet is the difficulty of its observance due to its restrictive nature, due to both the high cost and the complexity of the selection of gluten-free foods.

In this regard, the study and development of methods for producing highly specific proteases that are stable and active in the presence of endogenous enzymes of the human gastrointestinal tract (i.e., at the site of the intended action of a drug based on them) is of great importance for therapeutic purposes. In the framework of this invention, the wheat protease Triticum aestivum, triticaine alpha, was selected, because wheat plays a significant role as a food source in Russia, which means it is most suitable for the development of domestic therapeutic drugs for the treatment of celiac disease.

The full-size triticaine-alpha molecule consists of 461 amino acid residues with a molecular weight of 50.4 kDa. For the first time, the enzyme was cloned and expressed in the germ and the aleurone layer of wheat to elucidate its role in the process of seed maturation [1].

However, the biosynthesis of recombinant triticain-alpha to study its proteolytic functions has not yet been carried out. Providing an effective source of highly purified and active protein is one of the important tasks that arise when creating enzyme preparations. Therefore, there is a need to develop new technologies for producing such proteins and obtaining high-quality target drugs. In this regard, we have developed a method for producing a truncated form of full-sized triticaine-alpha corresponding to its catalytic domain (i.e., without a leader peptide and granulin-like domain) with a high yield and level of proteolytic activity.

Known work on the development of a method for producing a proenzyme form of EP-B2 (proEP-B2) [13, patent WO 2008115428 A2], which can be considered the closest in technical essence to the claimed invention. In this work, we solved the problem of obtaining the barley cysteine protease enzyme Hordeum vulgare EP-B2 in E. coli.

An object of the present invention is to develop a method for producing proteins of the wheat cysteine protease family (Triticum aestivum) in preparative quantities for research purposes and a highly purified triticaine-alpha preparation consisting of a truncated form of wheat triticaine alpha for use in enzymatic therapeutic agents.

The problem is solved as follows:

1. A method of obtaining a truncated form of triticaine-alpha wheat, having the sequence of SEQ ID NO: 2 (shortTRIT-α), recombinantly expressed in the bacterial system, which consists in culturing E. coli JM109 cells transformed with plasmid pQE80L_shortTRIT-α containing the DNA sequence encoding the shortTRIT-α protein in LB medium with the addition of ampicillin at 37 ° C under aerobic conditions for 12-14 hours, the culture medium is inoculated with seed, the culture is grown until the optical density A ₆₀₀ 0.6-0.8 is reached, 1 mM is induced from ropiltio-β-D-galactoside, and raise another 2.5-3 hours; purification of the target shortTRIT-α protein is carried out by affinity metal-chelate chromatography: the centrifugally precipitated cell biomass of the expression culture is resuspended in a buffer containing 0.01 M Tris-HCl, pH 8.0 and homogenized by ultrasonic disintegrator for 1 min at 4 ° C, obtained after centrifugation the lysate, the precipitate is washed with the original buffer and dissolved in buffer A, consisting of 6 M guanidine chloride and 0.05 M Tris-HCl, pH 7.8, the solution is clarified by centrifugation and applied to a column with nickel ions activated iminod with acetate A-sepharose equilibrated with buffer A, the sorbent is washed successively with equilibration buffer A and the same buffer containing 8 M urea and 0.005 M imidazole, the protein is eluted with buffer A containing 8 M urea and 0.25 M imidazole, then the eluate is added to the cooled buffer 0.05 M Tris-HCl, 0.5 M arginine chloride, 2 M urea, pH 7.8 in a 1: 5 ratio and stirred for 1 h at 4 ° C, the solution was dialyzed against 0.05 M Tris-HCl, pH 7.8 at 4 ° C, supernatant obtained after dialysate centrifugation, concentrated on an Amicon cell with a PM-10 membrane (Millipore), followed by dialysis against phosphate-buffered saline buffer PBS pH 7.4 at 4 ° C, determine the concentration of protein shortTRIT-α, aliquot in glass vials, freeze and lyophilize.

2. The method of claim 1, wherein the pQE80L_shortTRIT-α plasmid containing the DNA sequence encoding the shortTRIT-α protein can be modified by adding a sequence encoding the leader peptide and / or the granulin-like domain of triticain-alpha.

3. A biologically active protein preparation obtained by the method according to claim 1, the purity of which is at least 85% with a yield of at least 55 mg per liter of bacterial culture, characterized in that it has a high specific enzymatic activity and has the amino acid sequence of SEQ ID NO: 2.

The required technical result of the claimed invention is to develop a method for producing a protein of the wheat cysteine protease family (Triticum aestivum) by creating a DNA sequence encoding a fragment of full-sized wheat triticain-alpha (the so-called truncated form) in the bacterial expression system (SEQ ID NO: 2), biosynthesis truncated form of triticaine-alpha wheat in E. coli cells, as well as obtaining a preparation of triticaine-alpha, consisting of a truncated form of triticaine-alpha wheat, in high yield, level of purification and proteolytic activity.

The invention is illustrated by the following drawings:

in FIG. 1 - amino acid and nucleotide sequences of recombinant full-sized triticain-alpha expressed in E. coli (TRIT-α, italicized from the expression plasmid pET-42a (+) in italics; restriction enzyme recognition sites in italics and underline; underlined leader peptide; in italics and the catalytic triad Cys-His-Asn, which determines the affiliation of the protein to cysteine proteases, is highlighted in color; the granulin-like domain is highlighted in color; restriction enzyme recognition sites are underlined);

in FIG. 2 - amino acid and nucleotide sequences of recombinant truncated triticain-alpha expressed in E. coli (shortTRIT-α; italicized sequence from the expression plasmid pQE-80L; underlined by restrictase enzyme recognition sites);

in FIG. 3 is an electrophoregram of cell lysates of E. coli producer strain JM109 / pQE_shortTRIT-α before induction (lane 1), cell lysates of E. coli producer strain JM109 / pQE_shortTRIT-α after induction with isopropylthio-β-D-galactoside (lane 2), in a 12% polyacrylamide gel in the presence of SDS (M — protein molecular weight markers, kDa; the arrow indicates recombinant truncated triticain-alpha, shortTRIT-α);

in FIG. 4 - recombinant truncated triticaine-alpha (shortTRIT-α expressed in E. coli cells) after chromatographic isolation in a 14% polyacrylamide gel in the presence of SDS (M - protein molecular weight markers, kDa);

in FIG. 5 - electrophoregram of proteolytic cleavage of gluten (lane 2) with recombinant truncated triticaine-alpha (shortTRIT-α, lane 1) under reaction conditions: 37 ° C, pH 5.6, 10 min (lane 3), in a 14% polyacrylamide gel in the presence of SDS ( M - protein markers of molecular weight, kDa; the arrow indicates recombinant truncated triticain-alpha, shortTRIT-α);

in FIG. 6 - electrophoregram of proteolytic cleavage of collagen (lane 2) with recombinant truncated triticaine-alpha (shortTRIT-α, lane 1) under reaction conditions: 37 ° C, pH 5.6, 10 min, in 14% polyacrylamide gel in the presence of SDS (M - protein markers molecular weight, kDa; arrow indicates recombinant truncated triticaine-alpha, shortTRIT-α);

The invention is illustrated by the following examples.

Example 1. Cloning of the triticain-alpha gene of wheat and its truncated fragment

Based on the well-known wheat mRNA sequence (Triticum aestivum) encoding the full-length triticain-alpha gene (GeneBank AB267407), complementary DNA (cDNA) is synthesized using the reverse transcriptase of the mouse Moloney leukemia virus and primer on the 3′-untranslated region of 5ctctctctctctctctctctctctctctctctctctctctctctctctctctctctctctctctctctctctctctctctctctctctctctctctctctctctctctctctctctctctgg Amplification of the full-length triticain-alpha DNA gene encoding the translated region flanked by the NdeI and BamHI restriction sites (Fig. 1) is carried out using the following direct and reverse primers: 5′-ccccatatgcatcatcatcatcatcatcatgccatgagggctgctgctgctgctgctgctgctgctgctggggctggggctggggctggggctgggggggctgggggggctgggggggctggggggggggct . The amplification product and plasmid DNA pET-42a (+) are treated with restriction enzymes NdeI and BamHI, coupled by ligase reaction, after which the reaction mixture is transfected into competent E. coli cells BL21-CodonPlus (DE3) -RIL. Transformed cells are seeded on LB agar medium containing kanamycin (to a final concentration of 50 mg / ml). Of the clones selected by PCR (using universal primers for pET vectors), the target plasmid DNA (pET_TRIT-α) is isolated. The nucleotide sequence of the inserted fragment is confirmed by Sanger sequencing. Selected clones are expanded to evaluate productivity, antibiotic resistance, and transformation stability.

The construction of a new DNA sequence encoding a truncated fragment of the triticain-alpha gene (shortTRIT-α, without a leader peptide and granulin-like domain, Fig. 2) for expression in the bacterial system, is carried out on the basis of plasmid DNA pET_TRIT-α as a matrix and primers: 5′-atggatccatcgtgtcgtacggggag (the BamHI restriction site is underlined) and 5′-tattaagcttttagcccgtcttcgtcggg (the HindIII restriction site is underlined). The amplification product is cloned into the expression plasmid pQE-80L at the BamHI and HindIII restriction sites using E. coli strain JM109. Colony screening is performed by restriction analysis and subsequent sequencing.

Example 2. Synthesis of a truncated form of triticaine-alpha wheat (recombinant truncated triticaine-alpha, drug shortTRIT-α) in E. coli cells

The strain E. coli JM109, transformed with plasmid pQE80L_shortTRIT-α, is grown in LB medium at 37 ° C under aerobic conditions with the addition of ampicillin (to a final concentration of 100 mg / ml) for 12-14 hours (seed), inoculate a new portion of nutrient the medium in a ratio of 1:50, grow the culture until the optical density A ₆₀₀ 0.6-0.8 is reached, induce 1 mM isopropylthio-β-D-galactoside (IPTG) and grow another 2.5-3 hours. Upon induction of IPTG, the biosynthesis of recombinant shortTRIT-α (37.45 kDa, Fig. 3) takes place, which accumulates in the cells in insoluble form. Cell suspension samples were taken before and after induction in an amount corresponding to 0.1 optical units (pu), precipitated by centrifugation, suspended in lysis buffer (0.03 M Tris-HCl, pH 6.8, 10% glycerol, 1% sodium dodecyl sulfate, 3% mercaptoethanol, 0.005% bromophenol blue) is heated for 5 min at 95 ° C, and samples with a volume of 20 μl are analyzed by electrophoresis in 12% polyacrylamide gel with sodium dodecyl sulfate. The gel is stained with Coomassie R-250 according to standard procedures and scanned to determine the relative amount of protein in the target protein band (Fig. 3). According to the scan, the content of recombinant shortTRIT-α is 15-20% of all cellular proteins.

Example 3. Purification of the recombinant shortTRIT-α preparation from E. coli

Purification of the target protein shortTRIT-α is carried out by the method of affinity (metal-chelate) chromatography. The preparation of recombinant shortTRIT-α from cells of the producer strain JM109 / pQE80L_shortTRIT-α involves several stages. The cell biomass of the expression culture precipitated by centrifugation was resuspended in a buffer containing 0.01 M Tris-HCl, pH 8.0, and homogenized on an ultrasonic disintegrator for 1 min at 4 ° C. The precipitate obtained after centrifugation of the lysate (16000 × g, 4 ° C, 10 min) was washed with the initial buffer and dissolved in buffer A, consisting of 6 M guanidine chloride and 0.05 M Tris-HCl, pH 7.8. The solution was clarified by centrifugation (16000x g, 4 ° C, 1 h) and applied to a column (diameter 1.5 cm) with nickel-activated iminodiacetate-sepharose balanced by buffer A. The chromatography process was carried out on a BioLogic system (BioRad) with detection at 280 nm. The sorbent is washed sequentially with equilibration buffer A and the same buffer containing 8 M urea and 0.005 M imidazole. The protein is eluted with buffer A containing 8 M urea and 0.25 M imidazole, added to chilled 0.05 M Tris-HCl, pH 7.8 with 0.5 M arginine chloride and 2 M urea in a 1: 5 ratio and stirred for 1 h at 4 ° C. The solution was dialyzed against 0.05 M Tris-HCl, pH 7.8 at 4 ° С for 18 h, changing the buffer three times with fresh. The supernatant obtained after centrifugation of the dialysate (10000xg, 4 ° C, 30 min) was concentrated on an Amicon cell with a PM-10 membrane (Millipore) followed by dialysis against phosphate-buffered saline (PBS, pH 7.4, 4 ° C, 18 h) ) The concentration of the target protein is determined using the BCA reagent (bicinchoninic acid), aliquoted in glass vials, frozen and lyophilized.

The yield of recombinant shortTRIT-α obtained in this way is at least 55 mg per 1 liter of bacterial culture with a purity of at least 85% (according to electrophoretic analysis). It should be noted that the target protein shortTRIT-α, which exhibits protease activity, undergoes autoproteolysis during the isolation process and, as a result, is detected in an electrophoresis gel in the form of a major band of about 31 kDa (the so-called processed form) and low molecular weight fragments (Fig. 4).

Example 4. Determination of the proteolytic activity of recombinant shortTRIT-α

The enzymatic (proteolytic) activity of recombinant truncated triticaine-alpha shortTRIT-α is determined by the ability of the cleavage of protein substrates. Wheat gluten (Sigma) and collagen isolated from the dermis of cattle are used as substrates. The splitting of these proteins is of great importance in therapeutic (treatment of celiac disease, enzymatic purification of necrotic tissues, collagen-induced arthritis, etc. [12, 14, 15]), diagnostic [16] and some technological (hydrolysis of proteins of connective tissues [17]) purposes . The proteolytic reaction is carried out by incubating gluten or collagen with shortTRIT-α in a weight ratio of 20: 1 at 25 and 37 ° C for 10-15 minutes in 0.2 M glycine (pH 3.4), 0.2 M acetate (pH 5.6) or 0.2 M phosphate (pH 7.0) buffers. The results of proteolysis are analyzed by protein electrophoresis in a 14% polyacrylamide gel with sodium dodecyl sulfate (Fig. 5, 6). Recombinant shortTRIT-α exhibits optimal activity at pH 5-7 in just 10 minutes in the range of indicated temperatures.

The advantages of the claimed technical solution are, firstly, the possibility of obtaining a truncated fragment of triticaine-alpha in bacteria by creating an appropriate plasmid DNA construct; secondly, a simplified technique for isolating a recombinant protein from E. coli by introducing six histidine residues into the polypeptide chain; thirdly, obtaining a proteolytically active drug triticaine-alpha, consisting of a truncated form of full-sized triticaine-alpha, which can be the basis for the creation of enzymatic drugs in the treatment of certain diseases (in particular, celiac disease).

Information sources

1. T. Kiyosaki, T. Asakura, I. Matsumoto, et al. J Plant Physiol, 2009, 1, 166 (1), 101-106.

2. K. Muntz, M.A. Belozersky, Y.E. Dunaevsky, et al. J Exp Bot, 2001, 52, 1741-1752.

3. J.Q. Ling, T. Kojima, M. Shiraiwa, et al. Biochim Biophys Acta, 2003, 1627, 129-139.

4. A. Capocchi, M. Cinollo, L. Galleschi, et al. JAgric Food Chem, 2000, 48, 6271-6279.

5. T. Okamoto, T. Shimada, I. Hara-Nishimura, et al. Plant Physiol, 2003, 132, 1892-1900.

6. A. Mikkonen, I Porali, M. Cercos, et al. Plant Mol Biol, 1996, 31 (2), 239-254.

7. H. Kondo, K. Abe, I. Nishimura, et al. J Biol Chem, 1990, 15, 265 (26), 15832-15837.

8. T. Kiyosaki, I. Matsumoto, T. Asakura, et al. FEBS J, 2007, 274, 1908-1917.

9. N. McGough, J.H. Cummings. Proc Nutr Soc, 2005, 64 (4), 434-450.

10. J.S. Leeds, A.D. Hopper, D.S. Sanders. Br Med Bull, 2008, 88 (1), 157-170.

11. WGO - OMGE: Practice guidelines. World Gastroenterology News, 10 (2, 2), 2005, 1-8.

12. S. Rashtak, J.A. Murray Aliment Pharmacol Ther, 2012, 35 (7), 768-781.

13. H. Vora, J. McIntire, P. Kumar, et al. Biotechnol Bioeng, 2007, 1, 98 (1), 177-185.

14. D.P. Orgill, P.Y. Liu, L.S. Ritterbush, et al. J Burn Care Rehabil, 1996, 17, 311-322.

15. S. Khare, C. Krco, M. Griffiths, et. al. J Immunol, 1995, 155, 3653-3659.

16. T. Mazda, K. Makino, R. Yabe, et al. Transfus Med, 1995, 5, 43-50.

17. R.A. Lawrie, Meat Science, Pergamon Press, Oxford, 1991, p. 212.

Claims (3)

1. A method of obtaining a truncated form of triticaine-alpha wheat, having the sequence of SEQ ID NO: 2 (shortTRIT-α), recombinantly expressed in the bacterial system, which consists in culturing E. coli JM109 cells transformed with plasmid pQE80L_shortTRIT-α containing the DNA sequence encoding the shortTRIT-α protein in LB medium with the addition of ampicillin at 37 ° C under aerobic conditions for 12-14 hours, the culture medium is inoculated with seed, the culture is grown until the optical density A ₆₀₀ 0.6-0.8 is reached, 1 mM is induced from ropiltio-β-D-galactoside and raise another 2.5-3 hours; purification of the target shortTRIT-α protein is carried out by affinity metal-chelate chromatography: the centrifugally precipitated cell biomass of the expression culture is resuspended in a buffer containing 0.01 M Tris-HCl, pH 8.0 and homogenized by ultrasonic disintegrator for 1 min at 4 ° C, obtained after centrifugation the lysate, the precipitate is washed with the original buffer and dissolved in buffer A, consisting of 6 M guanidine chloride and 0.05 M Tris-HCl, pH 7.8, the solution is clarified by centrifugation and applied to a column with nickel ions activated iminod with acetate A-sepharose equilibrated with buffer A, the sorbent is washed successively with equilibration buffer A and the same buffer containing 8 M urea and 0.005 M imidazole, the protein is eluted with buffer A containing 8 M urea and 0.25 M imidazole, then the eluate is added to the cooled buffer 0.05 M Tris-HCl, 0.5 M arginine chloride, 2 M urea, pH 7.8 in a 1: 5 ratio and stirred for 1 h at 4 ° C, the solution was dialyzed against 0.05 M Tris-HCl, pH 7.8 at 4 ° C, supernatant obtained after dialysate centrifugation, concentrated on an Amicon cell with a PM-10 membrane (Millipore), followed by m dialysis against phosphate-buffered saline buffer PBS, pH 7.4, at 4 ° C, determine the concentration of protein shortTRIT-α, aliquot in glass vials, freeze and lyophilize. 2. The method of claim 1, wherein the pQE80L_shortTRIT-α plasmid containing the DNA sequence encoding the shortTRIT-α protein can be modified by adding a sequence encoding the leader peptide and / or the granulin-like domain of triticain-alpha. 3. A biologically active protein preparation obtained by the method according to claim 1, the purity of which is at least 85% with a yield of at least 55 mg per liter of bacterial culture, characterized in that it has a high specific enzymatic activity and has the amino acid sequence of SEQ ID NO: 2.

Images