CN113512600B - Primer and method for detecting pseudomonas putida and application thereof - Google Patents
Primer and method for detecting pseudomonas putida and application thereof Download PDFInfo
- Publication number
- CN113512600B CN113512600B CN202110681604.7A CN202110681604A CN113512600B CN 113512600 B CN113512600 B CN 113512600B CN 202110681604 A CN202110681604 A CN 202110681604A CN 113512600 B CN113512600 B CN 113512600B
- Authority
- CN
- China
- Prior art keywords
- pseudomonas putida
- primer
- detection
- pcr
- pseudomonas
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
- 241000589776 Pseudomonas putida Species 0.000 title claims abstract description 72
- 238000000034 method Methods 0.000 title claims abstract description 23
- 238000001514 detection method Methods 0.000 claims abstract description 41
- 235000020246 buffalo milk Nutrition 0.000 claims abstract description 27
- 230000001580 bacterial effect Effects 0.000 claims description 9
- 238000006243 chemical reaction Methods 0.000 claims description 8
- 238000000137 annealing Methods 0.000 claims description 7
- 238000012408 PCR amplification Methods 0.000 claims description 6
- 238000004925 denaturation Methods 0.000 claims description 3
- 230000036425 denaturation Effects 0.000 claims description 3
- 238000012257 pre-denaturation Methods 0.000 claims description 3
- 238000002360 preparation method Methods 0.000 claims description 3
- 238000001502 gel electrophoresis Methods 0.000 claims description 2
- 239000000203 mixture Substances 0.000 claims description 2
- 238000011144 upstream manufacturing Methods 0.000 claims description 2
- 201000010099 disease Diseases 0.000 claims 3
- 208000037265 diseases, disorders, signs and symptoms Diseases 0.000 claims 3
- 238000003745 diagnosis Methods 0.000 claims 2
- 230000035945 sensitivity Effects 0.000 abstract description 6
- 108020004707 nucleic acids Proteins 0.000 abstract description 3
- 102000039446 nucleic acids Human genes 0.000 abstract description 3
- 150000007523 nucleic acids Chemical class 0.000 abstract description 3
- 108020004414 DNA Proteins 0.000 description 24
- 241000589516 Pseudomonas Species 0.000 description 14
- 239000013642 negative control Substances 0.000 description 9
- 235000013336 milk Nutrition 0.000 description 8
- 239000008267 milk Substances 0.000 description 8
- 210000004080 milk Anatomy 0.000 description 8
- 238000013461 design Methods 0.000 description 7
- 241000589540 Pseudomonas fluorescens Species 0.000 description 6
- 238000012216 screening Methods 0.000 description 6
- 241000589538 Pseudomonas fragi Species 0.000 description 5
- 238000002474 experimental method Methods 0.000 description 5
- 239000013641 positive control Substances 0.000 description 5
- 238000000605 extraction Methods 0.000 description 4
- 239000012634 fragment Substances 0.000 description 4
- 230000000813 microbial effect Effects 0.000 description 4
- 108090000623 proteins and genes Proteins 0.000 description 4
- 241000894006 Bacteria Species 0.000 description 3
- LZZYPRNAOMGNLH-UHFFFAOYSA-M Cetrimonium bromide Chemical compound [Br-].CCCCCCCCCCCCCCCC[N+](C)(C)C LZZYPRNAOMGNLH-UHFFFAOYSA-M 0.000 description 3
- 108010067770 Endopeptidase K Proteins 0.000 description 3
- 241000588724 Escherichia coli Species 0.000 description 3
- 241000186779 Listeria monocytogenes Species 0.000 description 3
- 241000589517 Pseudomonas aeruginosa Species 0.000 description 3
- 241000293871 Salmonella enterica subsp. enterica serovar Typhi Species 0.000 description 3
- 241000191967 Staphylococcus aureus Species 0.000 description 3
- 230000003321 amplification Effects 0.000 description 3
- 239000003153 chemical reaction reagent Substances 0.000 description 3
- 238000010790 dilution Methods 0.000 description 3
- 239000012895 dilution Substances 0.000 description 3
- 238000003199 nucleic acid amplification method Methods 0.000 description 3
- 235000020185 raw untreated milk Nutrition 0.000 description 3
- 238000007400 DNA extraction Methods 0.000 description 2
- 108090000790 Enzymes Proteins 0.000 description 2
- 102000004190 Enzymes Human genes 0.000 description 2
- XEEYBQQBJWHFJM-UHFFFAOYSA-N Iron Chemical compound [Fe] XEEYBQQBJWHFJM-UHFFFAOYSA-N 0.000 description 2
- 241000186840 Lactobacillus fermentum Species 0.000 description 2
- 241000589614 Pseudomonas stutzeri Species 0.000 description 2
- 239000003795 chemical substances by application Substances 0.000 description 2
- 238000001962 electrophoresis Methods 0.000 description 2
- 239000000284 extract Substances 0.000 description 2
- 101150013736 gyrB gene Proteins 0.000 description 2
- 229940012969 lactobacillus fermentum Drugs 0.000 description 2
- 238000012986 modification Methods 0.000 description 2
- 230000004048 modification Effects 0.000 description 2
- 238000011895 specific detection Methods 0.000 description 2
- 238000003860 storage Methods 0.000 description 2
- 238000006467 substitution reaction Methods 0.000 description 2
- 235000003717 Boswellia sacra Nutrition 0.000 description 1
- 240000007551 Boswellia serrata Species 0.000 description 1
- 235000012035 Boswellia serrata Nutrition 0.000 description 1
- OYPRJOBELJOOCE-UHFFFAOYSA-N Calcium Chemical compound [Ca] OYPRJOBELJOOCE-UHFFFAOYSA-N 0.000 description 1
- 240000001008 Dimocarpus longan Species 0.000 description 1
- 235000000235 Euphoria longan Nutrition 0.000 description 1
- 101710089384 Extracellular protease Proteins 0.000 description 1
- 239000004863 Frankincense Substances 0.000 description 1
- 241000186866 Lactobacillus thermophilus Species 0.000 description 1
- 238000009004 PCR Kit Methods 0.000 description 1
- HCHKCACWOHOZIP-UHFFFAOYSA-N Zinc Chemical compound [Zn] HCHKCACWOHOZIP-UHFFFAOYSA-N 0.000 description 1
- 239000011543 agarose gel Substances 0.000 description 1
- 230000009286 beneficial effect Effects 0.000 description 1
- 230000015572 biosynthetic process Effects 0.000 description 1
- 235000019658 bitter taste Nutrition 0.000 description 1
- 239000011575 calcium Substances 0.000 description 1
- 229910052791 calcium Inorganic materials 0.000 description 1
- 235000020247 cow milk Nutrition 0.000 description 1
- 230000007547 defect Effects 0.000 description 1
- 238000011161 development Methods 0.000 description 1
- 230000000694 effects Effects 0.000 description 1
- 239000003925 fat Substances 0.000 description 1
- 239000000499 gel Substances 0.000 description 1
- 229910052742 iron Inorganic materials 0.000 description 1
- 244000144972 livestock Species 0.000 description 1
- 235000020191 long-life milk Nutrition 0.000 description 1
- 238000004519 manufacturing process Methods 0.000 description 1
- 239000000463 material Substances 0.000 description 1
- 235000013372 meat Nutrition 0.000 description 1
- 244000005700 microbiome Species 0.000 description 1
- 239000002366 mineral element Substances 0.000 description 1
- 238000002156 mixing Methods 0.000 description 1
- 235000016709 nutrition Nutrition 0.000 description 1
- 230000035764 nutrition Effects 0.000 description 1
- 238000003752 polymerase chain reaction Methods 0.000 description 1
- 238000001556 precipitation Methods 0.000 description 1
- 102000004169 proteins and genes Human genes 0.000 description 1
- 238000011896 sensitive detection Methods 0.000 description 1
- 239000007787 solid Substances 0.000 description 1
- 239000000243 solution Substances 0.000 description 1
- 241000894007 species Species 0.000 description 1
- 230000001954 sterilising effect Effects 0.000 description 1
- 238000004659 sterilization and disinfection Methods 0.000 description 1
- 239000011701 zinc Substances 0.000 description 1
- 229910052725 zinc Inorganic materials 0.000 description 1
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Biophysics (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Physics & Mathematics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a primer and a method for detecting pseudomonas putida and application thereof. The invention establishes a PCR detection method of the pseudomonas putida by designing a PCR detection primer of the pseudomonas putida and on the basis of the primer. The PCR primer has good specificity and high sensitivity, and the lowest nucleic acid detection amount is 198.0 multiplied by 10 ‑5 ng/mu L, the PCR detection method is simple to operate, has reliable results, and is suitable for identifying the pseudomonas putida and quickly detecting the pseudomonas putida in buffalo milk.
Description
Technical Field
The invention belongs to the technical field of microorganism detection. More particularly, relates to a primer and a method for detecting pseudomonas putida and application thereof.
Background
The buffalo is an important economic livestock breed distributed in the south of China, and with the continuous progress of production data, the buffalo in the new century has gradually changed into the development trend of' mainly milk and secondarily meat), so the buffalo has become a new industry. Buffalo milk is known as superior milk quality, comprehensive nutrition, high solid content, thick frankincense, rich zinc, iron, calcium and other mineral elements, easy to absorb and known as king of milk.
The pseudomonas is considered as the main psychrophile harmful to the raw milk and products thereof, can still grow and reproduce in the low-temperature storage process, and the secreted extracellular protease has heat resistance, and even can still have active residues after ultrahigh-temperature sterilization treatment, so that the milk products have the phenomena of rancidity, bitterness, viscosity increase, gel formation, precipitation and the like, the quality of the raw milk and the products thereof is seriously influenced, and the shelf life of the sterilized milk is shortened. However, the diversity of the pseudomonas is difficult due to the fact that the pseudomonas is various and the difference between the strain morphology and the biochemical property is small. In particular, since the advent of molecular typing methods, many of the pseudomonads found in starting milk do not belong to the genus Pseudomonas fluorescens, and the harmfulness of Pseudomonas fluorescens may be overestimated. Therefore, establishing a more reliable molecular typing method is very important for accurately evaluating the hazard potential of different species in pseudomonas. The researchers isolated and identified 67 pseudomonads from different raw milk in China, wherein the pseudomonas fluorescens, the pseudomonas putida, the pseudomonas fragi, the pseudomonas longuensis and the like are common strains.
Chinese patent CN 103898221A discloses a primer and a detection method for PCR detection of Pseudomonas putida, which aim to detect Pseudomonas putida of an imported environment-friendly microbial agent, increase the quality safety of the imported environment-friendly microbial agent and protect the natural environment of China from being damaged by foreign bacteria, but the sensitivity of the PCR detection primer is not high and is only 2.36 multiplied by 10 -2 μ g/mL. Therefore, the established PCR detection method for the pseudomonas putida has stronger specificity and higher sensitivity, and has important significance for ensuring the quality safety of buffalo milk.
Disclosure of Invention
The invention aims to overcome the defects of the prior art and provide a primer and a method for detecting pseudomonas putida and application thereof.
The invention aims to provide a primer for detecting pseudomonas putida.
Another object of the present invention is to provide a method for detecting Pseudomonas putida.
Still another object of the present invention is to provide a kit for detecting Pseudomonas putida.
The above purpose of the invention is realized by the following technical scheme:
the invention firstly provides a PCR primer for detecting pseudomonas putida, which comprises an upstream primer pp1 and a downstream primer pp2, and the sequences of the primers are shown as SEQ ID NO. 1-2 in sequence.
The PCR primer is designed by taking a gyrB gene sequence of pseudomonas putida on genebank as a target gene and is obtained by experimental screening. Experiments show that the PCR primers pp1 and pp2 (SEQ ID NO. 1-2) designed and screened by the invention can specifically amplify target fragments on pseudomonas putida, and can be used for detecting or identifying pseudomonas putida.
Therefore, the application of the invention protects the application of the primers shown in SEQ ID NO. 1-2 in the detection/identification of the pseudomonas putida.
The invention also applies to protect the application of the primers shown in SEQ ID NO. 1-2 in the preparation of products for detecting/identifying the pseudomonas putida.
Preferably, the primers shown in SEQ ID NO. 1-2 can be used for detecting pseudomonas putida in buffalo milk or preparing products for detecting pseudomonas putida in buffalo milk.
The invention also provides a PCR method for detecting/identifying the pseudomonas putida, which comprises the following steps:
s1, extracting bacterial genome DNA in a sample to be detected;
s2, using the DNA obtained in the step S1 as a template, and amplifying by using PCR primers shown in SEQ ID NO. 1-2;
and S3, carrying out gel electrophoresis detection on the PCR product, and if a single band with the size of 241bp appears, indicating that the detected sample contains the pseudomonas putida or is the pseudomonas putida.
Specifically, in step S1, bacterial genomic DNA was extracted using a bacterial genomic DNA extraction kit from Tiangen corporation or using the CTAB/proteinase K method.
Preferably, if the sample to be tested is cow's milk, the CTAB/proteinase K method is used to extract the bacterial genomic DNA.
Specifically, in step S2, the PCR amplification system is: 2 XTaq Master Mix 12.5. Mu.L, primers at 10. Mu.M concentration each 0.5. Mu.L, template DNA 1. Mu.L, add ddH 2 And O is supplemented to 25 mu L.
Specifically, in step S2, the PCR reaction procedure is: pre-denaturation at 94 ℃ for 2min; 30 cycles of denaturation at 94 ℃ for 30s, annealing at 60 ℃ for 30s, and extension at 72 ℃ for 30 s; extension was then carried out at 72 ℃ for 5min.
The invention also provides a PCR kit for detecting/identifying the pseudomonas putida, which contains PCR primers shown in SEQ ID No. 1-2.
Preferably, the kit further comprises reagents required for the PCR amplification reaction.
The application of the kit in the detection/identification of the pseudomonas putida is protected.
The invention also applies to protect the application of the kit in detecting the pseudomonas putida in buffalo milk.
The invention has the following beneficial effects:
the invention provides PCR primers pp1 and pp2 for detecting pseudomonas putida, and a PCR detection method for the pseudomonas putida is established by using the primers. The primers pp1 and pp2 have good specificity and high sensitivity, and the minimum nucleic acid detection amount is 198.0 multiplied by 10 -5 ng/mu L, the PCR detection method is simple to operate, has reliable results, and is suitable for identifying the pseudomonas putida and quickly detecting the pseudomonas putida in buffalo milk.
Drawings
FIG. 1 shows the result of PCR detection of Pseudomonas putida, wherein lanes 1 to 3 are Pseudomonas putida positive samples, and lane 4 is a blank control.
FIG. 2 shows the result of the specific detection of the PCR primers, wherein lane 1 is a negative control, the template corresponding to lane 2 is Pseudomonas putida, and the templates corresponding to lanes 3-13 are Pseudomonas fragi, pseudomonas londoide, pseudomonas fluorescens, pseudomonas aeruginosa, revolve Pseudomonas stutzeri, pseudomonas gesii, escherichia coli, staphylococcus aureus, lactobacillus fermentum, listeria monocytogenes, and Salmonella typhi in this order.
FIG. 3 shows the results of sensitivity detection of PCR primers, wherein lanes 1-10 correspond to DNA dilution concentrations of 10 0 ～10 -9 ng/. Mu.L, lane 11 is a negative control.
FIG. 4 shows the PCR detection result of artificially contaminated Pseudomonas putida in buffalo milk, wherein Lane 1 is the positive control of Pseudomonas putida, lane 2 is the negative control, and Lane 3 is an artificially contaminated buffalo milk sample.
FIG. 5 shows the PCR detection result of Pseudomonas putida in raw buffalo milk, wherein Lane 1 is a negative control, lane 2 is a positive control, and Lanes 3 to 17 are 15 collected raw buffalo milk samples.
Detailed Description
The invention is further described with reference to the drawings and specific examples, which are not intended to limit the invention in any way. Reagents, methods and apparatus used in the present invention are conventional in the art unless otherwise indicated.
Unless otherwise indicated, reagents and materials used in the following examples are commercially available.
Example 1 PCR primer design and detection
1. Design of PCR primers
The invention takes the gyrB gene sequence of pseudomonas putida on genebank as the target gene (the gene accession number is NC-021505.1) to carry out primer design, firstly 7 pairs of PCR primers with higher scores are designed and screened out, and then an optimal pair is screened out from the PCR primers through an experiment, wherein the sequences of the designed 7 pairs of primers are shown in a table 1:
TABLE 1 PCR primer information
The screening experiment shows that the specificity of the 4 th PCR primer is the best, so the 4 th PCR primer is selected for subsequent experiments and is named as primers pp1 and pp2, and the size of the fragment to be amplified is 241bp.
pp1(SEQ ID NO.1)：AGACAAAGAACGCAACGTATGG
pp2(SEQ ID NO.2)：ACGCTTGGTGGTCTCATTCAT
2. Extraction of bacterial genomic DNA
A bacterial genomic DNA extraction kit (cat. No.: DP 302) from Tiangen corporation was used to extract the genomic DNA of Pseudomonas putida, referring to the kit instructions.
3.PCR detection method
The extracted genome DNA of the pseudomonas putida is used as a template, PCR primers pp1 and pp2 are used for amplification, the enzyme used in the PCR reaction is Taq enzyme of century corporation, and a PCR amplification system is shown in Table 2:
TABLE 2 PCR reaction System
The PCR amplification procedure was: pre-denaturation at 94 ℃ for 2min; 30 cycles of denaturation at 94 ℃ for 30s, annealing at 60 ℃ for 30s and extension at 72 ℃; extension at 72 ℃ for 5min and final storage at 4 ℃.
The invention also optimizes the annealing temperature of the PCR primers pp1 and pp2, the selected annealing temperature range is 50-65 ℃, 12 temperature gradients are set in total, the temperature corresponding to the brightest strip is selected as the optimal annealing temperature, and the result shows that 60 ℃ is the optimal annealing temperature.
The above PCR reaction was carried out while ddH was added 2 Setting blank control with O as template, electrophoresis detection with 1% agarose gel after PCR reaction, taking 5 microliter PCR amplification product to sample, electrophoresis at 3-5V/cm for 40-50 min with 100 bpDNAdder and blank negative control as reference. The detection results are shown in FIG. 1, wherein lanes 1-3 are Pseudomonas putida positive samples, and lane 4 is a blank control. As can be seen from FIG. 1, a single band with a size of about 241bp is amplified in all the positive samples, which indicates that the PCR primers pp1 and pp2 obtained by design and screening can successfully amplify a target fragment of Pseudomonas putida, and the primers can be used for detecting or identifying Pseudomonas putida.
4. Specific detection of PCR primers
In order to detect the specificity of the PCR primers pp1 and pp2 obtained by design and screening, the PCR primers pp1 and pp2 are used for amplification reaction by respectively using genome DNAs of common contaminating bacteria in 11 types of buffalo milk as templates and using Pseudomonas fluorescens, pseudomonas putida, pseudomonas aeruginosa, pseudomonas fragi, pseudomonas longans, pseudomonas gesii, lactobacillus thermophilus, escherichia coli, staphylococcus aureus, listeria monocytogenes and Salmonella typhi. The result is shown in FIG. 2, wherein M is 100bp DNA Ladder, lane 1 is a negative control, the template corresponding to lane 2 is Pseudomonas putida, and the templates corresponding to lanes 3-13 are Pseudomonas fragi, pseudomonas lonella, pseudomonas fluorescens, pseudomonas aeruginosa, revolve Pseudomonas stutzeri, pseudomonas gesii, escherichia coli, staphylococcus aureus, lactobacillus fermentum, listeria monocytogenes and Salmonella typhi in sequence. As can be seen from FIG. 2, the PCR primers pp1 and pp2 of the invention can only amplify target fragments of Pseudomonas putida, and do not amplify other strains, indicating that the specificity of the primers is strong.
5. Sensitive detection of PCR primers
Taking the extracted pseudomonas putida genomic DNA as a template, measuring the concentration of the pseudomonas putida genomic DNA, measuring the initial concentration of the DNA template to be 198.0 ng/mu L, carrying out 10-fold gradient dilution on the genomic DNA, taking the pseudomonas putida genomic DNA with different concentrations as the template, and carrying out amplification by using PCR primers pp1 and pp 2. The results are shown in FIG. 3, in which M is 100bp DNA Ladder, and the dilution concentrations of DNA in lanes 1-10 are 10 in order 0 ～10 -9 ng/. Mu.L, lane 11 is a negative control. As can be seen from FIG. 3, the lowest nucleic acid detection level of Pseudomonas putida was 198.0X 10 -5 ng/mu L shows that the PCR primers pp1 and pp2 obtained by the design and screening of the invention have high detection sensitivity.
The invention discovers that the detection repeatability of the PCR primers pp1 and pp2 is also good in the process of multiple PCR experiments.
EXAMPLE 2 detection of actual samples
In order to detect the detection effect of the primers pp1 and pp2 obtained by design and screening in an actual sample, the invention obtains the buffalo milk polluted by psychrophile by respectively adding pseudomonas putida, pseudomonas fragrans and pseudomonas londer in the sterilized buffalo milk, and the buffalo milk is used for simulating the actual sample for detection. Taking 20mL of sterilized buffalo milk, respectively adding 1mL of bacterium solutions of pseudomonas putida, pseudomonas fragi and pseudomonas longder, and fully and uniformly mixing.
Since buffalo milk contains a large amount of proteins, fats and the like, it is not suitable to directly extract the microbial DNA from buffalo milk using a common bacterial genome extraction kit, and since a commercial milk microbial genome extraction kit is expensive and has low extraction efficiency, the present invention extracts the bacterial genomic DNA from buffalo milk using the improved CTAB/proteinase K method and detects the extracted genomic DNA by referring to the PCR detection method of example 1. The detection results are shown in FIG. 4, where M is 100bp DNA Ladder, lane 1 is a positive control of Pseudomonas putida, lane 2 is a negative control, and lane 3 is an artificially contaminated buffalo milk sample. As can be seen from FIG. 4, only the Pseudomonas putida positive control and the artificially contaminated buffalo milk sample amplified a single band with a size consistent with the expected size, which indicates that the PCR detection method constructed by the invention is suitable for detecting Pseudomonas putida in the actual milk sample.
The method simultaneously collects 15 parts of fresh raw buffalo milk samples in different areas of Guangxi, and performs PCR detection on the pseudomonas putida according to the method. The detection results are shown in FIG. 5, wherein lane 1 is a negative control, lane 2 is a positive control, and lanes 3-17 are 15 raw buffalo milk samples. As can be seen from FIG. 5, in the raw buffalo milk of 15 samples, a single band with a size of about 241bp is amplified from 8 samples, which indicates that the PCR detection method constructed by the invention is suitable for detecting Pseudomonas putida in actual milk samples.
The above embodiments are preferred embodiments of the present invention, but the present invention is not limited to the above embodiments, and any other changes, modifications, substitutions, combinations, and simplifications which do not depart from the spirit and principle of the present invention should be construed as equivalents thereof, and all such changes, modifications, substitutions, combinations, and simplifications are intended to be included in the scope of the present invention.
Sequence listing
<120> primer and method for detecting pseudomonas putida and application thereof
<160> 2
<170> SIPOSequenceListing 1.0
<210> 1
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
agacaaagaa cgcaacgtat gg 22
<210> 2
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
acgcttggtg gtctcattca t 21
Claims (10)
1. A primer for detecting pseudomonas putida is characterized by comprising an upstream primer pp1 and a downstream primer pp2, wherein the sequences of the primers are shown as SEQ ID NO. 1-2 in sequence.
2. Use of the primers of claim 1 for the detection/identification of P.putida for non-disease diagnosis purposes.
3. Use of the primer of claim 1 in the preparation of a product for detecting/identifying Pseudomonas putida.
4. The use according to claim 2 or 3, wherein the primer is used for the detection of Pseudomonas putida in buffalo milk or for the preparation of a product for the detection of Pseudomonas putida in buffalo milk.
5. A method for detecting/identifying pseudomonas putida for non-disease diagnostic purposes, comprising the steps of:
s1, extracting bacterial genome DNA in a sample to be detected;
s2, performing PCR amplification by using the DNA obtained in the step S1 as a template and primers shown in SEQ ID NO. 1-2;
and S3, carrying out gel electrophoresis detection on the PCR product, and if a single band with the size of 241bp appears, indicating that the detected sample contains the pseudomonas putida or is the pseudomonas putida.
6. The method of claim 5, wherein in step S2, the PCR amplification system is: 2 XTaq Master Mix 12.5. Mu.L, primers at 10. Mu.M concentration each 0.5. Mu.L, template DNA each 1. Mu.L, ddH 2 And O is supplemented to 25 mu L.
7. The method of claim 5, wherein in step S2, the PCR reaction procedure is: pre-denaturation at 94 ℃ for 2min; 30 cycles of denaturation at 94 ℃ for 30s, annealing at 60 ℃ for 30s and extension at 72 ℃; extension was then carried out at 72 ℃ for 5min.
8. A kit for detecting/identifying Pseudomonas putida is characterized by comprising primers shown in SEQ ID NO. 1-2.
9. Use of the kit according to claim 8 for the detection/identification of Pseudomonas putida for purposes other than disease diagnosis.
10. Use of the kit according to claim 8 for the detection of Pseudomonas putida in buffalo milk.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110681604.7A CN113512600B (en) | 2021-06-18 | 2021-06-18 | Primer and method for detecting pseudomonas putida and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110681604.7A CN113512600B (en) | 2021-06-18 | 2021-06-18 | Primer and method for detecting pseudomonas putida and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN113512600A CN113512600A (en) | 2021-10-19 |
| CN113512600B true CN113512600B (en) | 2023-04-11 |
Family
ID=78065728
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202110681604.7A Active CN113512600B (en) | 2021-06-18 | 2021-06-18 | Primer and method for detecting pseudomonas putida and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN113512600B (en) |
Family Cites Families (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103898221B (en) * | 2014-04-04 | 2015-12-30 | 中华人民共和国沈阳出入境检验检疫局 | The PCR detection primer of pseudomonas putida and PCR method thereof |
| CN103993072B (en) * | 2014-04-15 | 2015-09-02 | 浙江万里学院 | The multiple PCR detection kit of the pathogenic sweetfish pseudomonas of a kind of Rapid identification and method thereof |
| FR3055339B1 (en) * | 2016-09-01 | 2020-05-22 | Centre National De La Recherche Scientifique | METHOD FOR IN VITRO DETECTION AND IDENTIFICATION OF ONE OR MORE TARGET PATHOGENS PRESENT IN A BIOLOGICAL SAMPLE |
| CN110846423A (en) * | 2019-08-14 | 2020-02-28 | 武汉轻工大学 | Fluorescent quantitative PCR (polymerase chain reaction) rapid detection method for pseudomonas fluorescens, kit and application |
-
2021
- 2021-06-18 CN CN202110681604.7A patent/CN113512600B/en active Active
Also Published As
| Publication number | Publication date |
|---|---|
| CN113512600A (en) | 2021-10-19 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Corroler et al. | An ecological study of lactococci isolated from raw milk in the Camembert cheese registered designation of origin area | |
| Reyes-Escogido et al. | Purification of bacterial genomic DNA in less than 20 min using chelex-100 microwave: examples from strains of lactic acid bacteria isolated from soil samples | |
| KR102301527B1 (en) | A Primer composition for specifically detecting Lactobacillus plantarum and uses thereof | |
| Delcenserie et al. | Bifidobacterium pseudolongum are efficient indicators of animal fecal contamination in raw milk cheese industry | |
| CN103882012A (en) | Method for rapidly and efficiently extracting DNA (Desoxvribose Nucleic Acid) from milk products such as liquid milk and milk powder | |
| Liu et al. | The bacterial community structure of yond bap, a traditional fermented goat milk product, from distinct Chinese regions | |
| CN106282354B (en) | Detection primer and fluorescent quantitative PCR detection method for acinetobacter iwoffii | |
| CN113512600B (en) | Primer and method for detecting pseudomonas putida and application thereof | |
| JP5048622B2 (en) | PCR primers for detection of lactic acid bacteria | |
| JP3525259B2 (en) | Detection of Pectinatus spp. | |
| JP2023106944A (en) | Primer set which specifically detects lactic acid bacteria lq80 strain, kit including primer set, and detection method using primer set | |
| KR101695059B1 (en) | A composition for analyzing microbial flora in kefir fermented milk and a quantitative real-time pcr method therefor | |
| Markusková et al. | Impact of DNA extraction methods on 16S rRNA-based profiling of bacterial communities in cheese | |
| CN108330185A (en) | Double PCR technology detects the primer pair and method of bacillus cereus | |
| CN113337629A (en) | PCR detection primer, detection kit and detection method for pseudomonas longuensis | |
| CN111485014A (en) | Method for detecting live bacteria of escherichia coli | |
| Jin et al. | Characterization and amino acid metabolism performances of indigenous Oenococcus oeni isolated from Chinese wines | |
| CN114959083B (en) | Triple PCR detection primer set and kit | |
| Li et al. | Assessment of the microbial diversity during an industrial‐scale malting process by a polymerase chain reaction‐denaturing gradient gel electrophoresis analysis | |
| JP7252606B2 (en) | Lactic acid bacteria detection primer set and detection method using the primer set | |
| Klaubauf et al. | Research Tools and Methods for the Analysis of Microbiota in Dairy Products | |
| CN113355440B (en) | Multiple PCR (polymerase chain reaction) primer for detecting pathogenic bacteria of pasteurized milk and robustness detection method thereof | |
| CN113957165B (en) | Pseudomonas horizontal rapid detection method based on high-throughput sequencing and application thereof | |
| CN109943652B (en) | Multiplex PCR kit and method for rapidly detecting pediococcus acidilactici by using same | |
| CN111424102B (en) | Multiple PCR (polymerase chain reaction) rapid detection kit for specific bacteria of cosmetics and detection method thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| EE01 | Entry into force of recordation of patent licensing contract | ||
| EE01 | Entry into force of recordation of patent licensing contract |
Application publication date: 20211019 Assignee: Cenxi Qiliao Agricultural Development Co.,Ltd. Assignor: GUANGXI ZHUANG AUTONOMOUS REGION BUFFALO INSTITUTE Contract record no.: X2023980045747 Denomination of invention: A Primer and Method for Detecting Pseudomonas putrescens and Its Application Granted publication date: 20230411 License type: Common License Record date: 20231106 |