CN103898221B

CN103898221B - The PCR detection primer of pseudomonas putida and PCR method thereof

Info

Publication number: CN103898221B
Application number: CN201410135105.8A
Authority: CN
Inventors: 耿庆华; 王芳; 王金玲; 张莹; 林颖
Original assignee: SHENYANG ENTRY-EXIT INSPECTION AND QUARANTINE BUREAU
Current assignee: SHENYANG ENTRY-EXIT INSPECTION AND QUARANTINE BUREAU
Priority date: 2014-04-04
Filing date: 2014-04-04
Publication date: 2015-12-30
Anticipated expiration: 2034-04-04
Also published as: CN103898221A

Abstract

The invention discloses PCR detection primer and the PCR method thereof of a kind of pseudomonas putida, wherein, the nucleotides sequence of primer is classified as sequence 1 and sequence 2; Detection method comprises the following steps: 1) by the DNA profiling of the primer in claim 1, bacterium liquid to be checked and pcr amplification containing Mg ²⁺pCR damping fluid, dNTP, Taq? archaeal dna polymerase mixes, and prepares to obtain PCR reaction system; 2) above-mentioned PCR reaction system is placed in PCR instrument, increases according to predetermined amplification condition; 3), after amplification terminates, electrophoresis detection amplified fragments is utilized thus posit structure; The gene fragment that the present invention adopts PCR method to carry out pseudomonas putida detects, the accuracy of detected result is higher, detection method is sensitiveer, only needs common PCR instrument and electrophoresis apparatus just can reach the object of detection, and only just can provide detected result with 2-3 hour.

Description

The PCR detection primer of pseudomonas putida and PCR method thereof

Technical field

The present invention relates to field of biological detection, specifically provide PCR detection primer and the PCR method thereof of a kind of pseudomonas putida.

Background technology

Pseudomonas putida, at occurring in nature ubiquity, is a kind of environmental protection microbiobacterial agent can removing environmental pollution.The production in enormous quantities of this bacterium is made product and is sold countries in the world by the U.S., Japan and other countries.In order to increase the quality safety of import environmental protection microbiobacterial agent, protection China physical environment, not by the destruction of alien bacteria, needs to set up as early as possible the pseudomonas putida method of inspection in environmental protection microbiobacterial agent.

At present, only have Morphological Identification and biochemical identification two kinds of methods to detect pseudomonas putida, and the result of above-mentioned two kinds of detection methods all have very large uncertainty.

Therefore, how to research and develop a kind of method of detection pseudomonas putida newly, become people's problem demanding prompt solution.

Summary of the invention

Given this, the object of the present invention is to provide PCR detection primer and the PCR method thereof of a kind of pseudomonas putida, its gene fragment of carrying out pseudomonas putida by employing PCR method detects, and this detection method is not only more flexible, and detected result accuracy is high.

One aspect of the present invention provides the PCR detection primer of pseudomonas putida, and it is characterized in that, the nucleotides sequence of described primer is classified as:

Sequence 1:5'-CTGCATCATGGCCGGTGACAACATTT-3'

Sequence 2:5'-GTCGCATGGCTGTCGGTCTTCAGATC-3'

The present invention provides the PCR method of the PCR detection primer of pseudomonas putida on the other hand, it is characterized in that, comprises the following steps:

1) by the PCR detection primer of above-mentioned pseudomonas putida, the DNA profiling of bacterium liquid to be checked and pcr amplification containing Mg ²⁺pCR damping fluid, dNTP, Taq DNA polymerase mixing, prepare to obtain PCR reaction system;

2) above-mentioned PCR reaction system is placed in PCR instrument, increases according to predetermined amplification condition;

3), after amplification terminates, electrophoresis detection amplified fragments is utilized thus posit structure.

Preferably, described amplification condition is: 94 DEG C of denaturation 1min; 94 DEG C of sex change 15s, 61 DEG C of annealing 15s, 72 DEG C extend 15s, carry out 30 circulations; 72 DEG C extend 5min.

Further preferably, described electrophoresis detection is detected through gel electrophoresis.

Further preferably, described detected through gel electrophoresis is specially: 3 ~ 5V/cm constant voltage electrophoresis, electrophoresis 50 ~ 60min

The PCR detection primer of pseudomonas putida provided by the invention and detection method, the gene fragment adopting PCR method to carry out pseudomonas putida detects, the accuracy of detected result is higher, detection method is sensitiveer, only need common PCR instrument and electrophoresis apparatus just can reach the object of detection, and only just can provide detected result with 2-3 hour.

Accompanying drawing explanation

Fig. 1 is the electrophorogram that specificity is determined to detect;

Fig. 2 is the electrophorogram that susceptibility is determined to detect;

Fig. 3, Fig. 4 and Fig. 5 are the sample detection electrophorogram of 29 batches of pseudomonas putidas.

Embodiment

With specific embodiment, the present invention is further explained below, but is not limited to protection scope of the present invention.

Embodiment 1

The design of primer:

Gengbank consults pseudomonas putida complete genome sequence, and design the Auele Specific Primer for the design of pseudomonas putida conservative gene, its concrete nucleotides sequence is classified as:

Sequence 1:5'-CTGCATCATGGCCGGTGACAACATTT-3'

Sequence 2:5'-GTCGCATGGCTGTCGGTCTTCAGATC-3'

Amplification pseudomonas putida goal gene fragment is 161bp.

Embodiment 2

The DNA profiling of bacterium liquid to be checked extracts:

1) 1g(mL is got with aseptic technique) sample joins in 100mL physiological saline and mixes, and pipettes the continuous streak inoculation of 1 ring bacterium 5 pseudomonas color developing culture mediums dull and stereotyped, cultivates 24h for 30 DEG C.In sampling process, place 1 pseudomonas color developing culture medium on sample side dull and stereotyped as blank.

2) on picking flat board, 1-3 single bacterium colony turns Zengjing Granule 18h ~ 24h in nutrient broth 35 ± 1 DEG C of constant incubators.

3) extraction of bacterial genomes DNA

Get the bacterium liquid 200ul of above-mentioned cultivation, the bacterial genomes DNA extraction kit of commodity in use, the concrete operation reference specification sheets that extracts carries out, and extracts and obtains bacterial genomes DNA.

Embodiment 3

The foundation of PCR amplification method:

1) preparation of PCR reaction system: concrete one-tenth assignment system in table 1,

Table 1

Establish negative control and positive control simultaneously.

2) PCR reaction conditions:

By the above-mentioned PCR reaction solution tubule prepared, put into PCR instrument, reaction conditions: 94 DEG C of denaturation 1min; 94 DEG C of sex change 15s, 61 DEG C of annealing 15s, 72 DEG C extend 15s, carry out 30 circulations; 72 DEG C extend 5min.

Embodiment 4

The electrophoresis detection of pcr amplification product:

Prepare 2% sepharose with electrophoretic buffer (0.5 × TBE), get 5 μ LPCR amplified productions, and the mixing of 1 μ L sample-loading buffer, carry out point sample, DNAmarker (100bpDNAladder) does reference.3 ~ 5V/cm constant voltage electrophoresis, electrophoresis 50 ~ 60min, electrophoresis detection result Labworks image acquisition and analysis software record is also preserved.

Embodiment 5

Pcr amplification result judges:

Results of comparison

Positive control: the amplified band occurring 161bp;

Negative control: do not occur characteristic bands;

Blank: do not occur characteristic bands;

Detected result

Control experiment result is normal, and 161bp amplified band appears in testing sample, then can judge that this sample P CR amplification is as the positive.

Control experiment result is normal, and 161bp amplified band does not appear in testing sample, then can judge that this sample P CR amplification is as feminine gender.

Control experiment results abnormity, the result of this testing sample is invalid, should again test, and the factor that decontaminates.

Embodiment 6

Specificity is determined:

Extract the genomic dna that pseudomonas putida, Pseudomonas fluorescens, Pseudomonas stutzeri, Pseudomonas alcaligenes, pseudomonas pseudoalcaligenes, subtilis, Bacillus licheniformis, intestinal bacteria etc. amount to 8 kinds, detect by present method, concrete electrophorogram, see Fig. 1, wherein: M represents 100bpDNAMarker; 1 represents water contrast; 2 represent pseudomonas putida; 3 represent Pseudomonas fluorescens; 4 represent Pseudomonas stutzeri; 5 represent Pseudomonas alcaligenes; 6 representation class Pseudomonas alcaligenes; 7 represent subtilis; 8 represent Bacillus licheniformis; 9 represent intestinal bacteria.

Embodiment 7

Accuracy is determined:

By above-mentioned pseudomonas putida PCR primer, after cutting glue recovery purifying, deliver to biotech firm and check order.The BLAST that result is used on GENBANK is defined as pseudomonas putida.

Embodiment 8

Susceptibility is determined:

Extract pseudomonas putida genomic dna, measuring DNA concentration with ultraviolet spectrophotometer is 23.6ug/ml, and carry out 10 times of dilutions with deionized water, detected result is shown in Fig. 2, wherein: M represents 100bpDNAMarker; 1 ~ 6 represents pseudomonas putida DNA10 respectively ⁰~ 10 ^-5.

This detection method is minimum can detect that concentration is 23.6 × 10 ^-3ug/ml, the i.e. DNA content of 0.118ng.

Embodiment 9

Repeatability is determined:

To 29 batches, the sample turning out to be pseudomonas putida, carry out repeated detection, result is all consistent, and show there is good repeatability, concrete electrophorogram is shown in Fig. 3 ~ Fig. 5, wherein: MM represents 100bpDNAMarker, other be the sample of pseudomonas putida.

Sequence table

<110> Shenyang Entry-Exit Inspection and Quarantine Bureau of P.R.C.

The PCR detection primer of <120> pseudomonas putida and detection method

<130>2014

<160>2

<170>PatentInversion3.3

<210>1

<211>26

<212>DNA

<213> artificial sequence

<400>1

ctgcatcatggccggtgacaacattt26

<210>2

<211>26

<212>DNA

<213> artificial sequence

<400>2

gtcgcatggctgtcggtcttcagatc26

Claims

1. a PCR detection primer for pseudomonas putida, it is characterized in that, the nucleotides sequence of described primer is classified as:

Sequence 1:5'-CTGCATCATGGCCGGTGACAACATTT-3'

Sequence 2:5'-GTCGCATGGCTGTCGGTCTTCAGATC-3'.