CN106282354B - Detection primer and fluorescent quantitative PCR detection method for acinetobacter iwoffii - Google Patents
Detection primer and fluorescent quantitative PCR detection method for acinetobacter iwoffii Download PDFInfo
- Publication number
- CN106282354B CN106282354B CN201610747187.0A CN201610747187A CN106282354B CN 106282354 B CN106282354 B CN 106282354B CN 201610747187 A CN201610747187 A CN 201610747187A CN 106282354 B CN106282354 B CN 106282354B
- Authority
- CN
- China
- Prior art keywords
- quantitative pcr
- acinetobacter iwoffii
- standard
- acinetobacter
- sample
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6851—Quantitative amplification
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides an acinetobacter iwoffii fluorescence quantitative PCR detection primer and a method. The nucleotide sequences of the primers are respectively as follows: TTATTTGATCAGGCGCAAAG and CGTTTCTTGCCATCCCATTTA; the detection method comprises the following steps: 1) extracting DNA of a sample to be detected; 2) the DNA is used as a template, the primer is used, the acinetobacter iwoffii is amplified by adopting a fluorescent quantitative PCR method, and the fluorescence value Ct is collected at the annealing stage of 55 DEG CSample (I)A value; 3) according to the model, the concentration of bacteria is X102、×103、×104、×105、×106、×107Ct of time correspondenceStandard of meritValue, establishing the bacteria number lg of A.reuteriStandard of meritAnd CtStandard of meritStandard curve of values and according to CtSample (I)Values, the number of acinetobacter iwoffii in the sample was determined on the standard curve. The primer provided by the invention has strong specificity and high sensitivity, and the detection limit can reach multiplied by 102cfu/mL, the detection method is rapid and accurate, and the time consumption is short.
Description
Technical Field
The invention belongs to the technical field of bioengineering, and particularly relates to a real-time fluorescent quantitative PCR detection method for acinetobacter iwoffii.
Background
Acinetobacter lwofii (Acinetobacter lwofii) is widely found in nature, and can be detected mainly in water and soil, and also in milk, dairy products, poultry and frozen foods. Acinetobacter iwoffii is an important opportunistic pathogen, often causing septicemia, pneumonia, endocarditis and the like[1]In addition, acinetobacter iwoffii can produce heat-resistant protease and lipase to destroy food ingredients, and the heat sterilization treatment can destroy acinetobacter iwoffii, but the activity of the heat-resistant enzyme is basically not influenced, and partial activity can be maintained even after the ultrahigh temperature sterilization treatment, and the heat-resistant enzyme and the activity can continuously decompose protein and fat in the process of food storage, so that the product is changed, and finally, the adverse effect is generated on the quality of food: (1) the protease decomposes milk protein to cause bitter taste of the product, and amino acid released in the hydrolysis process can aggravate browning reaction; (2) the protease can decompose casein to cause protein gelatinization; (3) the lipase decomposes fat globule membrane to release free fatty acid, which causes fat to polymerize and float, resulting in a series of flavor defects, such as cheese flavor, fish flavor, malt flavor, putrefactive flavor, soap flavor, dirty flavor or yeast flavor, etc[2]. Therefore, the acinetobacter iwoffii is one of the important factors influencing the development of food industry, and the rapid and accurate detection of the content of acinetobacter iwoffii in food has strategic significance in improving the quality of dairy products and enhancing the economic benefit of enterprises.
The conventional method for measuring acinetobacter iwoffii in raw milk is to use culture medium to separate and identify or detect by a common PCR method. Wherein, the culture medium separation and identification method is very complicated in actual operation and is easily polluted by mixed bacteria in the environment: compared with the traditional separation, identification and detection method, the common PCR method is sensitive and rapid, but has strict requirements on the content of acinetobacter iwoffii in a bacterial liquid, the quantity of mixed bacteria and the like, and results such as false positive and false negative can occur, so that the pollution degree of screened food is deviated. In recent years, the real-time fluorescent quantitative PCR technology has been successfully applied to the microbial detection in food due to the characteristics of strong specificity, high sensitivity, rapidness, wide application range and the like[3]。
Study ofIt was found that certain sequences within the bacterial genome are highly conserved, and these highly conserved gene sequences provide the basis for the identification of families, genera and species of organisms[4]. Therefore, specific PCR primers can be designed according to the conserved sequence to detect the microorganisms in the food. Guanjingshi rock[5]The method for detecting the pseudomonas in the raw milk by the fluorescent quantitative PCR is established according to the primer designed according to the 16S rRNA gene sequence of the pseudomonas, and research results show that the method can quickly and stably detect the pseudomonas in the raw milk within 10 hours, and the detection limit is lower than 103cfu/mL。Martins[6]The detection of Pseudomonas bacteria carrying apr gene in milk by PCR technique, the apr gene encoding an alkaline metalloprotease, showed that the minimum detection limit of Pseudomonas bacteria in artificially contaminated milk was 105cfu/mL. Research shows that the beta-lactamase gene of acinetobacter iwoffii can be used as a specific recognition sequence[7]。
Reference to the literature
[1] Clinical distribution and drug resistance analysis of Mingdong, Panyanping, Zhu Yan, Acinetobacter lwoffii [ J ]. J.Hospital Infection, 2014,24(10):2351-2353.
[2]Samarzija D,Zamberlin S,Pogacic T.Psychrotrophic bacteria and their negative effects on milk and dairy products quality[J].Mljekarstvo,2012,62(2):77-95.
[3] The research progress of the psychrophile hazard in the Zhu Ping, the Li nan and the Jing and the milk and the detection method thereof [ J ] the academic newspaper for food safety quality detection, 2014,5(10):3142 and 3148.
[4]Vithanage NR,Yeager TR,Jadhav SR et al.Comparison of identification systems for psychrotrophic bacteria isolated from raw bovine milk[J].International Journal of Food Microbiology,2014,189:26-38.
[5] Guanjingye, Zhao Xinhuai, fast PCR counting method of psychrophile in raw milk sample research [ J ] food industry, 2009,5:63-66.
[6]Martins ML,de Araujo EF,Mantovani HC et al.Detection of the apr gene in proteolytic psychrotrophic bacteria isolated from refrigerated raw milk[J].International Journal of Food Microbiology,2005,102(2):203-211.
[7]Turton JF.,Hyde R,Martin K,et al.Genes encoding OXA-134-like enzymes are found in Acinetobacter lwoffii and A.schindleri and can be used for identification[J].Journal of Clinical Microbiology,2012,50(3):1019-1022.
Disclosure of Invention
The invention aims to provide an acinetobacter iwoffii fluorescent quantitative PCR primer and a detection method, which are used for quickly and accurately quantitatively detecting acinetobacter iwoffii in food, such as acinetobacter iwoffii in raw milk and dairy products, with high sensitivity and strong specificity, so that the number of acinetobacter iwoffii in production of food factories is effectively controlled, the harm of the acinetobacter iwoffii to product quality is reduced, a theoretical basis is provided for improving the product quality, and the primers and the detection method have important significance for guaranteeing the food safety. The basic principle of the invention is that a specific recognition sequence in acinetobacter iwoffii is searched through genome comparison, and the primers are designed to carry out fluorescence quantitative PCR detection on the acinetobacter iwoffii in the food. The SYBR Green I chimeric fluorescence method is adopted for detection, and the sensitivity and the specificity are good.
In order to achieve the above purpose, the technical scheme of the invention is as follows:
the invention provides an acinetobacter iwoffii fluorescent quantitative PCR detection primer, which has the following nucleotide sequence:
AL-F：TTATTTGATCAGGCGCAAAG，
AL-R：CGTTTCTTGCCATCCCATTTA。
the invention provides a fluorescence quantitative PCR detection method for acinetobacter iwoffii, which comprises the following steps:
1) extracting DNA in a sample to be detected;
2) using the DNA extracted in the step 1) as a template, and amplifying acinetobacter iwoffii by adopting a fluorescent quantitative PCR method, wherein the nucleotide sequence of the used primer is as follows:
AL-F：TTATTTGATCAGGCGCAAAG，
AL-R：CGTTTCTTGCCATCCCATTTA；
fluorescence values, Ct, were collected at the 55 ℃ annealing stageSample (I)Value of, and extend aboveAfter the condition is increased, the melting curve analysis of 60 ℃ to 95 ℃ is added to determine whether the product is single or not so as to reflect the specificity of the primer;
optionally, the fluorescent dye used in the fluorescent quantitative PCR method is SYBR Green I.
3) Drawing a standard curve and judging a detection result: according to the selected mode, the concentration of the bacteria is multiplied by 102、×103、×104、×105、×106、×107Ct of time correspondenceStandard of meritValue, establishing the bacteria number lg of A.reuteriStandard of merit(cfu/mL) and CtStandard of meritA standard curve of values, and the Ct value of the sample to be detected obtained in the step 2)Sample (I)Values, the number of acinetobacter iwoffii in the sample was determined on the standard curve.
Optionally, the detection method specifically includes the following steps:
1) extracting DNA in a sample to be detected;
2) taking the DNA extracted in the step 1) as a template, and amplifying acinetobacter iwoffii by adopting a fluorescent quantitative PCR method based on SYBR Green I, wherein the nucleotide sequences of the primers are as follows:
AL-F：TTATTTGATCAGGCGCAAAG，
AL-R：CGTTTCTTGCCATCCCATTTA；
fluorescence values, Ct, were collected at the 55 ℃ annealing stageSample (I)And adding a melting curve analysis of 60 ℃ to 95 ℃ after the amplification conditions;
further, when using the SYBR Green I fluorescent quantitative test method, the PCR amplification reaction system is 20 μ L: SYBR Premix Ex Taq II 10. mu.L, AL-F0.8. mu.L, AL-R0.8. mu.L, DNA template 2.0. mu.L, ddH2O 6.0μL，Rox Reference DyeⅡ0.4μL；
Further, in the fluorescent quantitative PCR method, the PCR reaction conditions are as follows: 30s at 95 ℃; 5s at 95 ℃, 34s at 55 ℃ and 40 cycles;
3) drawing a standard curve: a.lwoffii ATCC1530 was selected as a model bacterium, and the concentration was 2.4X 102、2.4×103、2.4×104、2.4×105、2.4×106、2.4×107Ct of time correspondenceStandard of meritValue, establishing the bacteria number lg of A.reuteriStandard of merit(cfu/mL) and CtStandard of meritThe standard curve of values is-3.838 x +40.93, R2＝0.993；
4) And (3) judging a detection result: subjecting the sample Ct to be detected obtained in the step 2) toSample (I)Values, the number of acinetobacter iwoffii in the sample was determined on the standard curve.
The invention also provides the acinetobacter iwoffii fluorescent quantitative PCR detection primer and the application of the acinetobacter iwoffii fluorescent quantitative PCR detection method in the aspect of detecting the acinetobacter iwoffii food.
The technical scheme of the invention has the following beneficial effects:
1) the invention determines the beta-lactamase gene of the OXA134 family as the specific conserved gene sequence of the acinetobacter iwoffii according to the genome comparison of the acinetobacter, so as to design a pair of specific primers and successfully establish the fluorescence quantitative PCR detection method of the acinetobacter iwoffii. The method has strong specificity, can not detect fluorescence signals for common microorganisms in food, can detect only acinetobacter iwoffii as positive, can quickly and accurately detect whether the acinetobacter iwoffii exists in the food, has short time consumption for the whole detection, and greatly improves the detection efficiency compared with the conventional culture detection method;
2) the fluorescence quantitative PCR detection method for acinetobacter iwoffii has high sensitivity which can reach 240cfu/mL, can be used for quantitative detection of acinetobacter iwoffii in food, and has important significance for guaranteeing food safety.
Drawings
FIG. 1 shows agarose gel electrophoresis of fluorescent quantitative PCR products. M is 1000bp Marker, 1. beta-lactamase gene PCR product, 2. Control.
FIG. 2 is a standard curve for fluorescent quantitative PCR amplification of A.rouxii.
FIG. 3 is a sensitivity experiment for fluorescent quantitative PCR detection of acinetobacter iwoffii beta-lactamase gene. Wherein, 1-7: 2.4X 107～2.4×101cfu/mL。
FIG. 4 is a sensitivity test for detecting the gene of acinetobacter iwoffii beta-lactamase by conventional PCR. Wherein, 1-7: 2.4X 107～2.4×101cfu/mL。
FIG. 5 is a fluorescent quantitative PCR amplification specificity experiment of acinetobacter iwoffii beta-lactamase gene.
Detailed Description
In order to clarify the technical solution and technical object of the present invention, the present invention will be further described with reference to the accompanying drawings and the detailed description.
Example 1
1. Design and synthesis of primers:
through comparing the genome sequences of Acinetobacter lwoffii and similar strains, such as Acinetobacter baumannii (Acinetobacter baumannii), Acinetobacter schendleri (Acinetobacter scheimnleri), Acinetobacter haemolyticus (Acinetobacter haemolyticus) and the like, the interspecific specific sequence of the Acinetobacter lwoffii is found out, then BLAST comparison is carried out on the sequence, the homology of the sequence and a microorganism of the Acinetobacter lwoffii is analyzed, and finally the beta-lactamase gene of the OXA134 family is determined to be the specific conserved gene sequence of the Acinetobacter lwoffii. Specific primers were designed based on this gene for analysis.
When designing primers, firstly, finding out interspecies conserved sequence segments according to the beta-lactamase amino acid sequence (GenBank: WP _004728961) of A.lwoffii ATCC1530, A.lwoffii strain St17095 (GenBank: AHA11126.1), A.lwoffii AL3 (GenBank: ADM47435.1) and A.lwoffii strain S459 (GenBank: ALM26450.1) in a database; then carrying out DNAMAN software homologous comparison on the coding region sequence of the amino acid sequence, and designing primers AL-F and AL-R as follows:
AL-F：TTATTTGATCAGGCGCAAAG，
AL-R：CGTTTCTTGCCATCCCATTTA。
2. detection of the correctness of the designed primers was achieved by cloning of the a.lwoffii ATCC1530 β -lactamase gene sequence:
total DNA of a. lwoffii ATCC1530 was extracted using a rhizobacteria genomic DNA extraction kit and PCR amplified using the primer sequences AL-F and AL-R described above:
the PCR amplification reaction system is 20 mu L: SYBR Premix Ex Taq II 10. mu.L; 0.8 mu L of AL-F and 0.8 mu L of AL-R; 2.0 μ L of DNA template; ddH2O 6.0μL；Rox Reference DyeⅡ50x 0.4μL；
The PCR reaction conditions are as follows: 30s at 95 ℃; 5s at 95 ℃, 34s at 55 ℃ and 40 cycles; annealing at 55 ℃.
The obtained PCR product was analyzed by 1% agarose gel electrophoresis, and the result (see FIG. 1) showed that 197bp of the fragment of the A.reuteri beta-lactamase gene was amplified. The target band was recovered and ligated with pUCm-T, transformed into JM109, and subjected to Shanghai's sequencing after the identification. The sequence analysis shows that the gene sequence is consistent with the gene sequence of the pseudoclone, which indicates that the A.lwoffii ATCC15309 beta-lactamase gene sequence is amplified correctly.
3. Drawing a fluorescent quantitative PCR standard curve:
a) lwoffii ATCC1530 was used as a model bacterium for plotting a standard curve for fluorescent quantitative PCR, which may represent other acinetobacter iwoffii. Culturing A.lwoffii ATCC1530 in a brain heart infusion medium (BHI) culture medium overnight, quantifying bacterial liquid according to a method in GB4789.2-2010 food microbiology test-colony total number determination, and diluting by 10-fold gradient to obtain bacterial liquids with different concentrations: 2.4X 101、2.4×102、2.4×103、2.4×104、2.4×105、2.4×106、2.4×107cfu/mL。
b) Extracting genome DNA of bacterial liquids with different concentrations by adopting a rhizobacteria genome DNA extraction kit;
c) performing PCR amplification by using a SYBR Green I real-time quantitative PCR kit, wherein the amplification system and the reaction conditions are as described in the 2; in addition, fluorescence values, Ct, were collected at the 55 ℃ annealing stageStandard of meritAdding melting curve analysis at 60-95 ℃ after the amplification condition, wherein each sample is 3 parallels;
d) ct of each concentration was obtained after fluorescent quantitative PCRStandard of meritA value corresponding to the number of cycles at which the fluorescent signal was first detected, reflecting the initial amount of template, in lg of the number of bacteriaStandard of meritValue sumCtStandard of meritThe standard curve y of the bacterial suspension is-3.838 x +40.93, and the correlation coefficient is 0.993 (figure 2), which shows that the detection method established by the invention can accurately and quantitatively detect A.lwoffii in food; and its detection limit is x 102cfu/mL。
Example 2
In example 2, the real-time fluorescent quantitative PCR method for detecting acinetobacter iwoffii provided by the present invention was used to detect raw milk sampled from 8 dairy farms in the Yangzhou city of Jiangsu province in different months (11, 12, 1, 2 months) to determine whether the raw milk of each pasture is contaminated with acinetobacter iwoffii (A.lwoffii), thereby monitoring the milk source quality of each pasture.
The specific method comprises the following steps:
(1) extracting DNA in a raw milk sample to be detected:
1mL of raw milk is taken, centrifuged at 12000g/min for 5min, the upper layer fat is discarded, the raw milk is washed twice by sterile normal saline, centrifuged at 12000g/min for 2min, and then DNA in the lower layer precipitate is extracted by the method in the patent of the method for extracting total DNA from milk (patent application No. 200810115822.9).
(2) Taking the DNA extracted in the step (1) as a template, and performing fluorescent quantitative PCR amplification on a partial fragment of the acinetobacter iwoffii beta-lactamase gene;
the PCR amplification reaction system is 20 mu L and comprises: SYBR Premix Ex Taq II 10 uL, upstream primer AL-F0.8 uL, downstream primer AL-R0.8 u L, DNA template 2.0 u L, ddH2O6.0 μ L and Rox Reference Dye II 0.4 μ L; wherein, the nucleotide sequences of the upstream primer AL-F and the downstream primer AL-R are shown in step 1) of example 1 for designing and synthesizing the primers.
The PCR reaction conditions are as follows: 30s at 95 ℃; 5s at 95 ℃, 34s at 55 ℃ and 40 cycles; fluorescence Ct values collected at 55 ℃ annealing stageSample (I)And adding a melting curve analysis of 60 ℃ to 95 ℃ after the amplification conditions.
(3) And (3) judging a detection result: number lg of bacteria of Acinetobacter lwoffii established with reference to 3d) in example 1Standard of merit(cfu/mL) and CtStandard of meritStandard curve of values, determining the bacterial concentration to be 2.4X 102、2.4×103、2.4×104、2.4×105、2.4×106、2.4×107Ct of time correspondenceStandard of meritThe value is obtained. According to the sample Ct to be detected obtained in the step (2)Sample (I)Values, against the standard curve (y-3.838 x +40.93, R)20.993), the number of acinetobacter iwoffii in the raw milk was determined.
In the detection of 32 raw milk samples, the conventional PCR does not detect an A.lwoffi positive sample, while the fluorescent quantitative PCR method detects 2 A.lwoffi positive samples, the Ct value is between 30 and 31, and the positive rate is 6.25 percent. Therefore, the method can be used for quantitative detection of acinetobacter iwoffii in raw milk, and has important significance for guaranteeing the safety of dairy products.
Example 3
In this example 3, the sensitivity of the fluorescent quantitative PCR detection method of the present invention was compared with that of the conventional PCR.
Taking the genome DNA of the bacterial liquid with different concentrations obtained in the step 4) in the example 1 as a template, and AL-F and AL-R as primers to carry out conventional PCR amplification, wherein the reaction conditions are as follows: 95 ℃ for 3min, 30 cycles (95 ℃ for 30s, 55 ℃ for 30s, 72 ℃ for 30s), 72 ℃ for 10 min. As can be seen from FIG. 4, the sensitivity of conventional PCR detection A.lwoffii was 2.4X 103cfu/mL; this was compared with the lowest colony count (2.4X 10) detected by the fluorescent quantitative PCR of the present invention shown in FIG. 32cfu/mL), the sensitivity of the invention is obviously higher than that of the common PCR detection.
Example 4
In this example 4, the primers and the fluorescent quantitative PCR method provided by the present invention (see example 2) were used to amplify common microorganisms (e.g., enterobacter sakazakii, staphylococcus aureus, escherichia coli, salmonella, listeria, serratia marcescens, and pseudomonas fluorescens) in 8 kinds of milk, and a.lwoffi ATCC1530 was selected as a positive control to detect the specificity of the method of the present invention.
The results (see fig. 5) show that only the a. lwoffii ATCC1530 sample showed a strong fluorescence signal, and the remaining 8 samples did not show corresponding fluorescence signals, thereby showing that the specificity of the present invention is strong.
The foregoing shows and describes the general principles, essential features, and advantages of the invention. It will be understood by those skilled in the art that the present invention is not limited to the embodiments described above, which are described in the foregoing description only for the purpose of illustrating the principles of the present invention, but that various changes and modifications may be made therein without departing from the spirit and scope of the invention as defined by the appended claims, specification, and equivalents thereof.
Sequence listing
<110> Yangzhou university
<120> detection primer of acinetobacter iwoffii and fluorescent quantitative PCR detection method
<160> 2
<170> SIPOSequenceListing 1.0
<210> 1
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
<210> 2
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
cgtttcttgc catcccattt a 21
Claims (3)
1. An application of a fluorescent quantitative PCR detection primer in preparing a kit for detecting acinetobacter iwoffii based on the fluorescent quantitative PCR detection method of acinetobacter iwoffii is characterized in that,
the fluorescent quantitative PCR detection primer is an acinetobacter iwoffii fluorescent quantitative PCR detection primer as follows:
AL-F：TTATTTGATCAGGCGCAAAG，
AL-R：CGTTTCTTGCCATCCCATTTA；
the fluorescence quantitative PCR detection method for acinetobacter iwoffii comprises the following steps:
1) extracting DNA in a sample to be detected;
2) amplifying acinetobacter iwoffii by using the DNA extracted in the step 1) as a template and adopting a fluorescent quantitative PCR method, wherein the used primer is the fluorescent quantitative PCR detection primer;
collecting fluorescence value, namely Ct sample value at the annealing stage of 55 ℃, and adding a melting curve of 60-95 ℃ for analysis after the amplification condition;
3) drawing a standard curve and judging a detection result: according to the selected mode, the concentration of the bacteria is multiplied by 102、×103、×104、×105、×106、×107Establishing a standard curve of the bacterial number lg standard and the Ct standard value of the acinetobacter iwoffii according to the corresponding Ct standard value, and determining the quantity of the acinetobacter iwoffii in the sample on the standard curve according to the Ct sample value of the sample to be detected obtained in the step 2).
2. The use according to claim 1, wherein in step 2) of the quantitative fluorescence PCR detection method, the fluorescent dye used in the quantitative fluorescence PCR method for Acinetobacter rouxii is SYBR Green I.
3. Use according to claim 1, characterized in that: in step 3) of the fluorescent quantitative PCR detection method for acinetobacter iwoffii, the model bacterium is a.lwoffii ATCC1530 according to the concentration thereof of 2.4 × 102、2.4×103、2.4×104、2.4×105、2.4×106、2.4×107Then corresponding Ct standard value, and establishing a standard curve of the bacterial number lg standard of the acinetobacter iwoffii and the Ct standard value as-3.838 x +40.93, R2＝0.993。
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610747187.0A CN106282354B (en) | 2016-08-26 | 2016-08-26 | Detection primer and fluorescent quantitative PCR detection method for acinetobacter iwoffii |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610747187.0A CN106282354B (en) | 2016-08-26 | 2016-08-26 | Detection primer and fluorescent quantitative PCR detection method for acinetobacter iwoffii |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN106282354A CN106282354A (en) | 2017-01-04 |
| CN106282354B true CN106282354B (en) | 2021-03-12 |
Family
ID=57677637
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610747187.0A Active CN106282354B (en) | 2016-08-26 | 2016-08-26 | Detection primer and fluorescent quantitative PCR detection method for acinetobacter iwoffii |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106282354B (en) |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110987717B (en) * | 2019-12-24 | 2021-08-27 | 光明乳业股份有限公司 | Analysis method of yoghourt |
| CN112358980B (en) * | 2020-10-23 | 2022-04-12 | 扬州大学 | Acinetobacter lwoffii and application thereof |
| CN113005182A (en) * | 2021-05-08 | 2021-06-22 | 上海应用技术大学 | Quantitative detection method and quantitative detection kit for radiation-resistant acinetobacter and application of quantitative detection kit |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102603875A (en) * | 2011-12-26 | 2012-07-25 | 台州市立医院 | Fluorescent quantitative polymerase chain reaction (PCR) kit for Acinetobacter baunannii/calcoaceticus complex OXA-23 mutant gene |
| KR20140019219A (en) * | 2012-07-09 | 2014-02-14 | 조선대학교산학협력단 | Development of species-specific pcr method for detection of acinetobacter species |
-
2016
- 2016-08-26 CN CN201610747187.0A patent/CN106282354B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102603875A (en) * | 2011-12-26 | 2012-07-25 | 台州市立医院 | Fluorescent quantitative polymerase chain reaction (PCR) kit for Acinetobacter baunannii/calcoaceticus complex OXA-23 mutant gene |
| KR20140019219A (en) * | 2012-07-09 | 2014-02-14 | 조선대학교산학협력단 | Development of species-specific pcr method for detection of acinetobacter species |
Non-Patent Citations (2)
| Title |
|---|
| Genes Encoding OXA-134-Like Enzymes Are Found in Acinetobacter lwoffii and A. schindleri and Can Be Used for Identification;Turton JF等;《J Clin Microbiol》;20120111;第50卷(第3期);第1019页，第1020页表1 * |
| Turton JF等.Genes Encoding OXA-134-Like Enzymes Are Found in Acinetobacter lwoffii and A. schindleri and Can Be Used for Identification.《J Clin Microbiol》.2012,第50卷(第3期),第1019页，第1020页表1. * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN106282354A (en) | 2017-01-04 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN110760569B (en) | Rapid constant-temperature detection method and kit for nucleic acid of cronobacter sakazakii | |
| Ingianni et al. | Rapid detection of Listeria monocytogenes in foods, by a combination of PCR and DNA probe | |
| Garrido-Maestu et al. | Rapid and sensitive detection of viable Listeria monocytogenes in food products by a filtration-based protocol and qPCR | |
| Torriani et al. | Rapid detection and quantification of tyrosine decarboxylase gene (tdc) and its expression in gram-positive bacteria associated with fermented foods using PCR-based methods | |
| CN101617057B (en) | Microorganism detection method and microorganism detection kit | |
| CN105671197B (en) | A kind of detection method of food-borne pathogens Listeria monocytogenes | |
| Machado et al. | Development of a PCR method for detecting proteolytic psychrotrophic bacteria in raw milk | |
| CN106282354B (en) | Detection primer and fluorescent quantitative PCR detection method for acinetobacter iwoffii | |
| Trnčíková et al. | Rapid and sensitive detection of Staphylococcus aureus in food using selective enrichment and real-time PCR targeting a new gene marker | |
| CN111378774A (en) | Primer group, kit and method for rapidly detecting Listeria monocytogenes | |
| JP6236690B2 (en) | Composition for detecting food spoilage microorganisms | |
| CN108018364A (en) | A kind of kit and detection method of absolute quantitation detection vibrio parahemolyticus | |
| CN107523622A (en) | The detection primer and fluorescent quantitative PCR detection method of a kind of serratia marcescens | |
| CN113512601B (en) | Molecular targets for screening for Proteus and quantitative detection methods | |
| KR101747249B1 (en) | Weissella cibaria specific primer and method for detection of Weissella cibaria using the same | |
| Zhang et al. | Real‐time loop‐mediated isothermal amplification assays combined with ethidium monoazide bromide and bentonite coated activated carbon for rapid and sensitive detection of viable Escherichia coli O157: H7 from milk without enrichment | |
| CN112553355A (en) | Primer probe combination, kit and method for detecting listeria monocytogenes based on RAA technology | |
| AL-ZAIDI et al. | CONVENTIONAL VERSUS MODERN TECHNIQUES USED FOR THE DETECTION OF PATHOGENS IN FOOD MATRICES: A REVIEW. | |
| CN113373249B (en) | Molecular target for screening flavobacterium and quantitative detection method thereof | |
| Maršálková et al. | Quantitative real-time PCR detection of putrescine-producing gram-negative bacteria | |
| JP2004344004A (en) | Method for detecting histamine-producing bacterium and primer to be used in the same | |
| Hussain et al. | Enterotoxigenecity and Typing of Clostridium perfringens Isolated from Raw Meat, Meat Products and Water Samples in Kashmir, India | |
| CN116024358A (en) | Target gene for detecting salmonella, PCR primer pair, detection method and application | |
| ÖZER | A REVIEW OF CULTURAL AND MOLECULAR DETECTION OF Listeria monocytogenesIN FOOD | |
| CN113234844A (en) | PCR primer pair for detecting pseudomonas fluorescens capable of producing heat-resistant protease in raw milk and application of PCR primer pair |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |