CN113430224A

CN113430224A - Visual CRISPR/Cas9 gene editing system and using method

Info

Publication number: CN113430224A
Application number: CN202110679391.4A
Authority: CN
Inventors: 余东; 袁定阳; 段美娟; 周天顺; 刘玲; 刘海; 孙学武; 孙志忠; 刘次桃; 谭炎宁; 盛夏冰; 陈劲; 袁贵龙
Original assignee: Hunan Agricultural University; Hunan Hybrid Rice Research Center
Current assignee: Hunan Agricultural University; Hunan Hybrid Rice Research Center
Priority date: 2021-06-18
Filing date: 2021-06-18
Publication date: 2021-09-24
Anticipated expiration: 2041-06-18
Also published as: CN113430224B

Abstract

The invention discloses a visual CRISPR/Cas9 gene editing system, which comprises a gene editing element, an exogenous T-DNA visual tracking element and a transgenic pollen inactivation element, wherein the transgenic pollen inactivation element is an expression frame of a corn alpha-amylase gene ZMAA 1; the gene editing element is a CRISPR/Cas9 expression structure, and the CRISPR/Cas9 expression structure comprises a Cas9 gene expression frame and a gRNA expression frame; the exogenous T-DNA visual tracking element is an expression frame of a red fluorescent protein gene DsRed. The invention utilizes endosperm fluorescent protein to mark transgenic seeds carrying an exogenous Cas9 gene T-DNA region so as to screen mutant seeds without transgenes. Meanwhile, pollen carrying the Cas9 gene is inactivated by a pollen inactivation technology, the proportion of seeds without transgenic components is increased, and the biological potential safety hazard caused by transgenic pollen drift is avoided.

Description

Visual CRISPR/Cas9 gene editing system and using method

Technical Field

The invention relates to the technical field of genetic engineering, in particular to a visual CRISPR/Cas9 gene editing system and a using method thereof.

Background

Currently, a number of classical CRISPR/Cas9 systems suitable for plant gene editing have been developed. The CRISPR/Cas9 system has the characteristics of simple operation, high efficiency and controllability, and is widely used for the improvement of crop genetic breeding. However, when the CRISPR/Cas9 system is used for gene editing breeding in crops, the problems of large and tedious screening workload of early positive transgenic plants, long and difficult period of later non-transgenic mutants screening and the like still exist. Particularly, in the process of screening the mutant without transgene, an exogenous T-DNA region carrying a Cas9 gene element is removed mainly by selfing or backcrossing, gene editing plants without transgene are obtained by the method, stable mutation single plants can be obtained generally by planting more than 2 generations, and the time span is usually more than 2 years and even longer. In addition, researchers also try to directly introduce the Cas9 protein and the gRNA into plant cells by using a gene gun and nanoparticles or to avoid the integration of elements such as the Cas9 gene into the genome by using methods such as agrobacterium-mediated transgene transient expression of the Cas9 protein and the gRNA, so as to obtain a non-transgenic gene editing plant. However, the above strategies have low efficiency of gene editing, and require high throughput methods to identify the edited plants, which is very costly. In addition, there are reports of methods for screening non-transgenic plants by killing transgenic plants with herbicides, but the methods are not environmentally friendly and cannot avoid drift of transgenic pollen, and there may be a transgenic safety risk.

The CRISPR/Cas9 gene editing system is simple to operate, particularly, the standardized biological brick assembling technology developed by BsaI endonuclease is utilized for the problem of Liu flare light, the construction of the CRISPR/Cas9 gene editing vector is greatly simplified, and the application of the CRISPR/Cas9 gene editing system in crop genetic improvement is accelerated. However, when DsRed and ZMAA1 expression cassettes are introduced, IIS type restriction enzymes such as BsaI cannot be used, which makes it difficult to construct vectors.

Disclosure of Invention

The invention aims to solve the technical problem of seeking a CRISPR/Cas9 gene editing system for visually screening positive transgenic plants and quickly rejecting transgenic components and a using method thereof in the face of urgent need to solve the problem. Transgenic seeds carrying a T-DNA region of an exogenous Cas9 gene are marked by endosperm fluorescent protein to screen mutant seeds without transgenes. Meanwhile, pollen carrying the Cas9 gene is inactivated by a pollen inactivation technology, the proportion of seeds without transgenic components is increased, and the biological potential safety hazard caused by transgenic pollen drift is avoided.

In order to achieve the above object, the invention provides a visual CRISPR/Cas9 gene editing system, comprising a gene editing element, an exogenous T-DNA visual tracking element and a transgenic pollen inactivation element; the gene editing element, the exogenous T-DNA visual tracking element and the transgenic pollen inactivation element are constructed in the same T-DNA region of the expression vector, so that the three genes are linked to be inherited;

the transgenic pollen inactivation element is an expression frame of a corn alpha-amylase gene ZMAA1, a ZMAA1 gene is driven by a pollen specific promoter Pg47, and the gene is terminated by an IN2-1 terminator;

the DNA sequence of the pollen specific promoter Pg47 is shown in SEQ ID NO. 12;

the DNA sequence of the ZMAA1 gene is shown as SEQ ID NO. 13;

the DNA sequence of the IN2-1 terminator is shown IN SEQ ID NO. 14.

In the visualized CRISPR/Cas9 gene editing system, the gene editing element is a CRISPR/Cas9 expression structure, and the CRISPR/Cas9 expression structure comprises a Cas9 gene expression cassette and a gRNA expression cassette.

In the visualized CRISPR/Cas9 gene editing system, further, the Cas9 gene expression cassette is driven by a Ubi promoter to drive a Cas9 gene and is terminated by an NOS terminator;

the DNA sequence of the Ubi promoter is shown as SEQ ID NO. 1;

the DNA sequence of the Cas9 gene is shown as SEQ ID NO. 2;

the DNA sequence of the NOS terminator is shown in SEQ ID NO. 3.

The above visualized CRISPR/Cas9 gene editing system, further, the gRNA expression cassette comprises a small RNA promoter and guide-RNA separated by a 1.8kb spacer sequence;

the small RNA promoter is one of OsU3, OsU6a, OsU6b and OsU6 c;

the DNA sequence of OsU3 is shown in SEQ ID NO. 4;

the DNA sequence of OsU6a is shown as SEQ ID NO. 5;

the DNA sequence of OsU6b is shown as SEQ ID NO. 6;

the DNA sequence of OsU6c is shown as SEQ ID NO. 7;

the guide-RNA sequence is shown as SEQ ID NO. 8;

the DNA sequence of the spacer sequence is shown as SEQ ID NO. 15.

In the visualized CRISPR/Cas9 gene editing system, the exogenous T-DNA visualized tracking element is an expression cassette of a red fluorescent protein gene DsRed, an endosperm-specific promoter ltp drives the DsRed gene, and a PINII terminator terminates;

the DNA sequence of the endosperm-specific promoter ltp is shown as SEQ ID NO. 9;

the DNA sequence of the DsRed gene is shown in SEQ ID NO. 10;

the DNA sequence of the PINII terminator is shown as SEQ ID NO. 11.

The visualized CRISPR/Cas9 gene editing system introduces an enzymatic assembly inlet sequence between a transgenic pollen inactivation element and an exogenous T-DNA visualization tracking element; the DNA sequence of the enzymatic assembly inlet sequence is shown as SEQ ID NO. 16.

Based on a general technical concept, the invention also provides a using method of the visualized CRISPR/Cas9 gene editing system, which comprises the following steps:

s1, designing a joint primer sequence according to a target site of a gene to be knocked out, and synthesizing a target site recombination joint T1-Adapter and T2-Adapter; designing primers gRNA-F, OsU3-R and OsU6-R according to a small RNA promoter and guide-RNA, and respectively amplifying corresponding U3-gRNA expression frame precursors and U6-gRNA expression frame precursors;

s2, carrying out enzymatic assembly on the U3-gRNA expression frame precursor and the U6-gRNA expression frame precursor and a target site recombinant joint T1-Adapter and T2-Adapter respectively to obtain enzymatic assembly products U3-T1-gRNA and U6-T2-gRNA;

s3, converting the enzymatic assembly products U3-T1-gRNA and U6-T2-gRNA into escherichia coli competent cells to obtain transformants pU3-T1-gRNA and pU6-T2-gRNA containing the complete gRNA expression cassette of the target site;

s4, amplifying transformants pU3-T1-gRNA and pU6-T2-gRNA containing the complete gRNA expression frame of the target site by using recombinant primers gR-ZF and gR-ZR to obtain an amplification product U3-T1-gRNA expression frame and U6-T1-gRNA expression frame containing the recombinant primers and the complete gRNA expression frame;

s5, carrying out enzymatic assembly on the U3-T1-gRNA expression cassette and a C9DZ vector to obtain an enzymatic assembly product I;

s6, after the enzymatic assembly product I is transformed into an escherichia coli competent cell, screening a transformant containing a gene editing vector of a single target site;

s7, carrying out enzymatic assembly on the transformant and the U6-T2-gRNA expression cassette to obtain an enzymatic assembly product II;

s8, introducing the enzymatic assembly product II into rice to obtain a gene editing plant with a mutated target site;

s9, screening seeds without red fluorescence according to the fact that whether endosperm contains fluorescence or not from gene editing plant offspring with mutation of the target site, namely the target plant with the transgenic components removed and the target site mutated.

In the using method, the sequence of the gRNA-F is shown as SEQ ID NO. 23;

the sequence of OsU3-R is shown in SEQ ID NO. 24;

the sequence of OsU6-R is shown in SEQ ID NO. 25.

The using method is characterized in that the DNA sequence of the recombinant primer gR-ZF is shown as SEQ ID NO. 26;

the DNA sequence of the recombinant primer gR-ZR is shown in SEQ ID NO. 27.

In the above method of use, further, the vector is a C9DZ vector.

In the above using method, further, the gene to be edited is rice panicle neck elongation gene OsEUI1, and the method for editing the rice panicle neck elongation gene OsEUI1 and visually removing transgenic components comprises the following steps:

(1) designing a joint primer sequence according to a target site of OsEUI1, and synthesizing target site recombination joints EUI1-U3-T1-Adapter and EUI-U6-T2-Adapter;

(2) carrying out enzymatic assembly on a U3-gRNA expression frame precursor and a U6-gRNA expression frame precursor and a target site recombinant joint EUI1-U3-T1-Adapter and EUI-U6-T2-Adapter respectively to obtain enzymatic assembly products EUI1-U3-T1-gRNA and EUI 1-U6-T2-gRNA;

(3) after the enzymatic assembly products EUI1-U3-T1-gRNA and EUI1-U6-T2-gRNA are transformed into escherichia coli competent cells, transformants pEUI1-U3-T1-gRNA and pEUI1-U6-T2-gRNA containing a complete gRNA expression frame of a target site are obtained;

(4) amplifying plasmid pEUI1-U3-T1-gRNA and pEUI1-U6-T2-gRNA containing a complete gRNA expression frame by using recombinant primers gR-ZF and gR-ZR;

(5) carrying out enzymatic assembly on an expression frame of an amplification product EUI1-U3-T1-gRNA containing a recombinant primer and a complete gRNA expression frame and a C9DZ vector to obtain an enzymatic assembly product C9DZ-EUI 1-T1;

(6) s5, after the enzymatic assembly product C9DZ-EUI1-T1 is transformed into an escherichia coli competent cell, a transformant pC9DZ-EUI1-T1 containing a gene editing vector of a single target site is screened;

(7) after SwaI enzyme digestion pC9DZ-EUI1-T1, carrying out enzymatic assembly with an amplification product EUI1-U6-T2-gRNA expression frame containing a recombinant primer and a complete gRNA expression frame to obtain an enzymatic assembly product pC9DZ-EUI 1-T1-T2;

(8) introducing the enzymatic assembly product pC9DZ-EUI1-T1-T2 into rice to obtain a gene editing plant with a mutant target site;

(9) and screening seeds without red fluorescence from the offspring of the edited plant with the EUI1 gene mutation according to the fact that whether the endosperm contains fluorescence or not, namely the target plant with the transgenic components removed and the EUI1 gene mutation.

Compared with the prior art, the invention has the advantages that:

1. the invention provides a visual CRISPR/Cas9 gene editing system, which utilizes endosperm fluorescent protein to mark transgenic seeds carrying an exogenous Cas9 gene T-DNA region, can visually screen gene editing plants without transgenosis without molecular biology means such as PCR and the like, thereby not only reducing a large amount of screening work, but also saving time and cost; the pollen inactivation technology inactivates transgenic pollen carrying the Cas9 gene, increases the proportion of seeds without transgenic components, and more importantly, can avoid the biological potential safety hazard caused by the drift of the transgenic pollen.

2. The invention provides a use method of a visual CRISPR/Cas9 gene editing system, belonging to a method for circularly stacking and enzymatically assembling a CRISPR/Cas9 gene editing vector.

Drawings

In order to make the objects, technical solutions and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below with reference to the drawings in the embodiments of the present invention.

FIG. 1 is a diagram showing a vector structure of a gRNA expression cassette according to example 1 of the present invention.

Fig. 2 is a technical flow chart for constructing a CRISPR/Cas9 gene editing vector C9DZ and a gRNA expression cassette for visually removing a transgenic component in embodiment 1 of the present invention.

FIG. 3 shows a strain and a seed whose plant height becomes high after the OsEUI1 gene is knocked out in example 2 of the present invention.

FIG. 4 is a field phenotype after the development of the plant from the non-fluorescent seeds with increased plant height of example 2 of the present invention.

FIG. 5 shows the PCR detection of the transgenic components after the non-fluorescent seeds with increased plant height developed into plants in example 2 of the present invention. M is TAKARA 100bp DNA ladder, 1-12 are non-fluorescent and plant height increased gene editing plants, "-" is negative control, and "+" is positive control.

Detailed Description

The invention is further described below with reference to specific preferred embodiments, without thereby limiting the scope of protection of the invention.

Unless otherwise defined, all terms of art used hereinafter have the same meaning as commonly understood by one of ordinary skill in the art. The terminology used herein is for the purpose of describing particular embodiments only and is not intended to limit the scope of the present invention.

Unless otherwise specifically stated, various raw materials, reagents, instruments, equipment and the like used in the present invention are commercially available or can be prepared by existing methods. The methods in the following examples are conventional in the art unless otherwise specified.

Examples

The materials and equipment used in the following examples are commercially available.

Example 1

A CRISPR/Cas9 gene editing system for visually removing transgenic components comprises three basic structural elements which are respectively a gene editing element, an exogenous T-DNA visual tracking element and a transgenic pollen inactivation element, wherein the gene editing element, the exogenous T-DNA visual tracking element and the transgenic pollen inactivation element are constructed in the same T-DNA region of an expression vector, so that the three genes are linked and inherited. Introducing an enzymatic assembly entry sequence between the transgenic pollen inactivation element and the exogenous T-DNA visual tracking element; the DNA sequence of the enzymatic assembly inlet sequence is shown as SEQ ID NO.16, and specifically comprises: cgtggatggacaatttaaattccgttttacctg are provided.

The gene editing element is a CRISPR/Cas9 expression structure, and the CRISPR/Cas9 expression structure comprises a Cas9 gene expression frame and a gRNA expression frame; the Cas9 gene expression cassette was driven by the Ubi promoter (seq1) for the Cas9 gene (seq2) and terminated by the NOS terminator (seq 3). The nucleotide sequence of the Ubi promoter (SEQ1) is shown in SEQ ID NO. 1. The nucleotide sequence of the Cas9 gene (SEQ2) is shown as SEQ ID No. 2. The nucleotide sequence of the NOS terminator (SEQ3) is shown in SEQ ID NO. 3.

The gRNA expression cassette consists of a small RNA promoter (which may be one of OsU3(seq4), OsU6a (seq5), OsU6b (seq6), OsU6c (seq 7)), a target site, and a guide-RNA (seq 8).

OsU3 promoter (SEQ4) has the nucleotide sequence shown in SEQ ID NO. 4. The nucleotide sequence of the OsU6a promoter (SEQ5) is shown as SEQ ID No. 5. The nucleotide sequence of the OsU6b promoter (SEQ6) is shown as SEQ ID No. 6. The nucleotide sequence of the OsU6c promoter (SEQ7) is shown as SEQ ID No. 7.

The nucleotide sequence of guide-RNA (SEQ8) is shown in SEQ ID NO.8, and specifically comprises:

gttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgctttttttcaagagcttggagtggatggaattttcctccg。

the small RNA promoter and the guide-RNA are separated by a 1.8kb spacer sequence (SEQ15), and the DNA sequence of the spacer sequence is shown as SEQ ID NO.15, and specifically comprises:

tctgccagcccggctacccggcgaacttcgccggcgccggcggcttcagggacaacgtgaggacgctgctcggcttcgcgcacctggaggccggcgtccacggcgagaccaagtgctggtcgttccagctcgagctgcaccgccacccccccaccgtcgtgaggctcttcgtcgtcgaggaggaggtcgccgcctcgccgcaccgccagtgccacctctgccgccatattggtccgtcgaacaaactacaattaatcaatcaacctttacataggattgatccgatcgatgccatggtgttgtagggtgggggaggcatctgatatgcagcaagaggtatcacttcttgctgccgaggagggaatcggcggcggaagccgacggcctgtgcttcgcgatcaaccacggcggcggcggtggcgcggagaaagcgtcgtcgaaagggacgacgacgacggcctccagcagaggccacctgctacacggcgtcgtgcacctcaacggctacggccacctcgtcgccctccacggcctcgagggcggctccgacttcgtctccggccaccagatcatggacctctgggaccgcatttgctcagccttgcacgtaaggtagtagtagtatacatgtgcgtgtgcatgcatgcaagcaatgcaacgatgtcgggctgcgtgtgagaacatttgcttgggcatggtgtggtgtatgcaaggacggtgagcctggtggacacggcgaggaagggccacatggagctgaggctgctgcacggcgtcgcgtacggcgagacgtggttcgggcggtgggggtacaggtacggccggccgagctacggcgtcgcgctgccgtcgtaccggcagtcgctgcacgtgctcggctccatgccgctctgcgtgctggtgccgcacctgtcgtgcttcagccaggagctccccatggtggtcaccaagtaccaggccatcagcggccacaagctgctcagcctcggcgacctcctccgcttcatgctcgagctgcgcgcccgcctgccggccacctccgtcacggccatggactaccggggcatcatgtcggaggcctcgtgccggtggtcggcgaagcgcgtcgacatggcggcgcgcgccgtcgtggacgcgctccgccgcgccgagccggcggcgcggtgggtcacgcggcaggaggtgcgcgacgcggcgcgcgcctacatcggcgacacgggcctcctcgacttcgtgctcaagtccctcggcaaccacatcgtcggcaactacgtcgtgcgccgcaccatgaacccggtgaccaaggtgctcgagtactgcctcgaggacgtctccagcgtgctcccggcggtcgccgccggcggcggcgtgccggcgcagggcaagatgagggtgaggttccagctcacgcgtgcgcagctcatgagggacctggtgcacctgtaccggcacgtgctcaaggagcccagccaggcgctcaccggcggcgcgttcggcgcgatcccggtggcggtgcggatggtcctggacatcaagcacttcgtcaaagattaccacgaaggacaagccgcggcgagcagcaatggcggtggcggattcgggcatccccacatcaacctgtgctgcacgctgctcgtgagcaacgggagcccggagctagctccaccgtacgagacggtgaccctgccggcgcacgcgacggtgggcgagctgaagtgggaggcgcagagggtgttcagcgagatgtacctcggcctgaggagcttcgcggcggactccgtcgtcggggtcggcgccgac。

the exogenous T-DNA visual tracking element is an expression frame of a red fluorescent protein gene DsRed, an endosperm-specific promoter ltp (seq9) drives the DsRed gene (seq10), and a PINII terminator (seq11) terminates. The nucleotide sequence of the Ltp promoter (SEQ9) is shown in SEQ ID NO. 9. The nucleotide sequence of the DsRed gene (SEQ10) is shown in SEQ ID NO. 10. The nucleotide sequence of the PINII terminator (SEQ11) is shown in SEQ ID NO. 11.

The transgenic pollen inactivation element is an expression frame of a maize alpha-amylase gene ZMAA1, a ZMAA1 gene (seq13) is driven by a pollen-specific promoter Pg47(seq12), and is terminated by an IN2-1 terminator (seq 14). The nucleotide sequence of the Pg47 promoter (SEQ12) is shown as SEQ ID No. 12. The nucleotide sequence of the ZMAA1 gene (SEQ13) is shown as SEQ ID No. 13. The nucleotide sequence of the IN2-1 terminator (SEQ14) is shown IN SEQ ID NO. 14.

In the above basic structural elements, the gRNA expression cassette is constructed by homologous recombination of a gRNA expression cassette precursor with a target site, and the gRNA expression cassette precursor is constructed on pMD18-T, wherein a small RNA promoter (mainly OsU3, OsU6a, OsU6b, OsU6c) is separated from guide-RNA by a 1.8kb spacer sequence, so that the PCR-amplified gRNA expression cassette precursor can be conveniently recovered and subjected to homologous recombination with the target site (see fig. 1). The expression frame of the Cas9 gene, the expression frame of the DsRed gene and the expression frame of the ZMAA1 gene are constructed in the same T-DNA region of a plant expression vector C9DZ, so that the three genes are inherited in a linkage manner (shown in figure 2). A33 bp enzymatic assembly entry sequence cgtggatggacaatttaaattccgttttacctg is introduced between the ZMAA1 gene expression frame and the DsRed gene expression frame, the assembly entry sequence comprises a SwaI blunt-end enzyme cutting site, 15bp of homology is respectively arranged between the linearized vector after the SwaI enzyme cutting and forward and reverse primers of the gRNA expression frame, and an identical assembly entry sequence is regenerated after each gRNA expression frame is recombined and can be used for the cycle assembly of the next gRNA expression frame (see the attached figure 2).

Example 2

An application method of CRISPR/Cas9 gene editing for visually rejecting transgenic components in embodiment 1 is specifically applied to a rice panicle neck elongation gene OsEUI1, and specifically comprises the following steps:

(1) by usinghttp://skl.scau.edu.cn/targetdesign/The website targetDesign tool designs 2 target sites EUI1-U3-T1 and EUI-U6a-T2 of the OsEUI1 gene. The recombinant linker primer sequences EUI1-U3-T1-F and EUI1-U3-T1-R, EUI1-U6a-T2-F and EUI1-U6a-T2-R are designed according to target sites as follows, wherein underlined sequences are the corresponding target site sequences.

The target site-directed sequence is as follows:

the nucleotide sequence of EUI1-U3-T1(SEQ17) is shown as SEQ ID NO.17, and specifically comprises:gatcgccgggctgtgcatta；

the nucleotide sequence of EUI-U6a-T2(SEQ18) is shown as SEQ ID NO.18, and specifically comprises:caagtacctccagaaaggcc。

the target site recombination linker primer sequence is as follows:

the nucleotide sequence of EUI1-U3-T1-F (SEQ19) is shown as SEQ ID NO.19, and specifically comprises the following steps: agatgatccgtggcagatcgccgggctgtgcattagttttagagctagaa；

The nucleotide sequence of EUI1-U3-T1-R (SEQ20) is shown as SEQ ID NO.20, and specifically comprises: ttctagctctaaaactaatgcacagcccggcgatctgccacggatcatct, respectively;

the nucleotide sequence of EUI1-U6a-T2-F (SEQ21) is shown as SEQ ID NO.21, and specifically comprises the following steps: ctggcttggctgccgcaagtacctccagaaaggccgttttagagctagaa；

The nucleotide sequence of EUI1-U6a-T2-R (SEQ22) is shown as SEQ ID NO.22, and specifically comprises the following steps: ttctagctctaaaacggcctttctggaggtacttgcggcagccaagccag are provided.

(2) Respectively taking 10 mu L of forward primer F and reverse primer R, uniformly mixing, heating to 94 ℃, standing to room temperature, and preparing into target site recombinant joints EUI1-U3-T1-adapter and EUI-U6 a-T2-adapter.

(3) The corresponding U3-gRNA expression cassette precursor and U6a-gRNA expression cassette precursor were amplified using gRNA-F/OsU3-R and gRNA-F/OsU6a-R, respectively.

The nucleotide sequence of gRNA-F (SEQ23) is shown in SEQ ID NO.23, and specifically comprises: gttttagagctagaaatagcaagttaaaataag, respectively;

OsU3-R (SEQ24) has a nucleotide sequence shown as SEQ ID NO.24, and specifically comprises: tgccacggatcatctgcacaactcttttaaac, respectively;

OsU6 (6 a-R) (SEQ25) has a nucleotide sequence shown in SEQ ID NO.25, which specifically comprises: cggcagccaagccagcaccc are provided.

The PCR reaction system is as follows: KOD 2 XPCR buffer 25ul, 2mM dNTP 10ul, forward and reverse primers 1.5 uL each, KOD FX DNA polymerase 1 uL, template 1 uL about 50ng, 10uL ddH₂O to a total volume of 50. mu.L.

The PCR reaction program is: firstly, performing pre-denaturation at 98 ℃ for 3 min; ② 35 circulation (98 ℃ for 10s, 60 ℃ for 30s and 68 ℃ for 2.5 min); extending for 5min at 68 ℃; and fourthly, storing at 4 ℃.

Agarose gel electrophoresis recovered 2.6kb of U3-gRNA expression cassette precursor and U6a-gRNA expression cassette precursor.

(4) The U3-gRNA expression frame precursor and the U6a-gRNA expression frame precursor are respectively subjected to enzymatic assembly with a target site recombinant joint EUI1-U3-T1-Adaptor and EUI-U6a-T2-Adaptor to obtain enzymatic assembly products EUI1-U3-T1-gRNA and EUI1-U6 a-T2-gRNA.

The enzymatic reaction system is as follows: the full gold 2 × Assembly Mix 5ul, gRNA expression cassette precursor 2.0 μ L (about 200ng), target site recombination linker 1.0 μ L, complement ddH₂O to a total volume of 10. mu.L.

Reaction conditions are as follows: 50 ℃ for 20 min; 2min at 20 ℃; then stored at 12 ℃.

(5) And (3) transforming the enzymatic assembly products EUI1-U3-T1-gRNA and EUI1-U6a-T2-gRNA into escherichia coli competent cells in a heat shock mode to obtain transformation products. The transformation products were plated on LB plates containing kanamycin resistance for overnight culture. Single colonies are picked the next day and subjected to colony PCR detection by using universal primers M13-F and M13-R, and single colonies with the band size of 650bp are screened and sequenced.

The sequencing result shows that: the pEUI1-U3-T1-gRNA and pEUI1-U6a-T2-gRNA plasmids contain the complete gRNA expression cassette for the target site.

(6) The C9DZ vector was digested with SwaI, the linearized vector C9DZ was recovered after agarose gel electrophoresis, and the digestion system and digestion conditions were performed according to the instructions of NEB Inc. Plasmids pEUI1-U3-T1-gRNA and pEUI1-U6a-T2-gRNA containing the complete gRNA expression cassette, which are correctly sequenced in the amplification step (5) by using the recombinant primers gR-ZF and gR-ZR.

The nucleotide sequence of gR-ZF (SEQ26) is shown in SEQ ID NO.26, and specifically comprises the following steps:cgtggatggacaatttaa attccgttttacctgtggaatcgg；

the nucleotide sequence of gR-ZR (SEQ27) is shown in SEQ ID NO.27, and specifically comprises:caggtaaaacggaatttaattccatccactccaagctcttg。

the PCR reaction system is as follows: KOD 2 XPCR buffer 25. mu.L, 2mM dNTP 10. mu.L, forward and reverse primers 1.5. mu.L each, KOD FX DNA polymerase 1. mu.L, template 1. mu.L about 50ng, 10. mu.L ddH₂O to a total volume of 50. mu.L.

The PCR reaction program is: firstly, performing pre-denaturation at 98 ℃ for 3 min; ② 35 circulation (98 ℃ for 10s, 60 ℃ for 30s and 68 ℃ for 45 s); extending for 5min at 68 ℃; and fourthly, storing at 4 ℃.

The expression cassettes of EUI1-U3-T1-gRNA and EUI1-U6a-T2-gRNA with the size of 600bp are recovered after agarose gel electrophoresis.

(7) And carrying out enzymatic assembly on a PCR product of a linearized vector C9DZ and EUI1-U3-T1-gRNA containing a recombinant primer and a complete gRNA expression frame to obtain an enzymatic assembly product C9DZ-EUI 1-T1.

The enzymatic reaction system is as follows: the total gold 2 × Assembly Mix 5 μ L, gRNA expression cassette precursor 2.0 μ L (about 200ng), target site recombination linker 1.0 μ L, complement ddH₂O to a total volume of 10. mu.L.

(8) The enzymatic assembly product C9DZ-EUI1-T1 was transformed into E.coli competent cells by heat shock and the transformation product was plated on LB plates containing kanamycin resistance for overnight culture. And selecting a single colony on the next day, carrying out colony PCR detection by using primers Target-J-F and Target-J-R, screening the single colony with the band size of 803bp, and sequencing.

The PCR reaction program is: firstly, performing pre-denaturation at 98 ℃ for 3 min; ② 35 circulation (98 ℃ for 10s, 60 ℃ for 30s and 68 ℃ for 50 s); extending for 5min at 68 ℃; and fourthly, storing at 4 ℃.

The sequencing result shows that: the correct plasmid was the gene editing vector pC9DZ-EUI1-T1 containing a single target site.

(9) SwaI enzyme digestion pC9DZ-EUI1-T1 vector, and EUI1-U6a-T2-gRNA expression frame PCR product containing recombinant primer and complete gRNA expression frame are subjected to enzymatic assembly to obtain enzymatic assembly product C9DZ-EUI 1-T1-T2. After the enzymatic assembly product is transformed into escherichia coli, single colonies with the band size of 1362bp are screened by using Target-J-F and Target-J-R primers and sequenced.

The PCR reaction program is: firstly, performing pre-denaturation at 98 ℃ for 3 min; ② 35 circulation (98 ℃ for 10s, 60 ℃ for 30s and 68 ℃ for 1 min); extending for 5min at 68 ℃; and fourthly, storing at 4 ℃.

The sequencing result shows that: the correct plasmid is the gene editing vector pC9DZ-EUI1-T1-T2 containing double target sites.

(10) The gene editing vector pC9DZ-EUI1-T1-T2 is used for transforming the rice variety Zhonghua 11 by adopting an agrobacterium-mediated method.

(11) Plant height was observed from T0 plant, seeds of T0 plant with increased plant height were harvested, and non-fluorescent seeds were screened from the individual plants with increased plant height (see FIG. 3).

(12) After the non-fluorescent seeds with increased plant height are planted, the field phenotype is that the plant height is increased, the seeds do not fluoresce (see figure 4), Cas9 gene and HPT gene in the plants are detected by PCR, the plants developed by the non-fluorescent seeds are found to contain no exogenous Cas9 gene and HPT gene (see figure 5), and the plants are gene editing plants without transgenic components and mutation of target sites.

The foregoing is merely a preferred embodiment of the invention and is not intended to limit the invention in any manner. Although the present invention has been described with reference to the preferred embodiments, it is not intended to be limited thereto. Those skilled in the art can make many possible variations and modifications to the disclosed embodiments, or equivalent modifications, without departing from the spirit and scope of the invention, using the methods and techniques disclosed above. Therefore, any simple modification, equivalent replacement, equivalent change and modification made to the above embodiments according to the technical essence of the present invention are still within the scope of the protection of the technical solution of the present invention.

Sequence listing

<110> research center for hybrid rice in Hunan province

Hunan Agricultural University

<120> visual CRISPR/Cas9 gene editing system and using method

<160> 27

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1763

<212> DNA

<213> corn (corn)

<400> 1

aggacaattg agtattttga caacaggact ctacagtttt atctttttag tgtgcatgtg 60

ttctcctttt tttttgcaaa tagcttcacc tatataatac ttcatccatt ttattagtac 120

atccatttag ggtttagggt taatggtttt tatagactaa tttttttagt acatctattt 180

tattctattt tagcctctaa attaagaaaa ctaaaactct attttagttt ttttatttaa 240

taatttagat ataaaataga ataaaataaa gtgactaaaa attaaacaaa taccctttaa 300

gaaattaaaa aaactaagga aacatttttc ttgtttcgag tagataatgc cagcctgtta 360

aacgccgtcg acgagtctaa cggacaccaa ccagcgaacc agcagcgtcg cgtcgggcca 420

agcgaagcag acggcacggc atctctgtcg ctgcctctgg acccctctcg agagttccgc 480

tccaccgttg gacttgctcc gctgtcggca tccagaaatt gcgtggcgga gcggcagacg 540

tgagccggca cggcaggcgg cctcctcctc ctctcacggc accggcagct acgggggatt 600

cctttcccac cgctccttcg ctttcccttc ctcgcccgcc gtaataaata gacaccccct 660

ccacaccctc tttccccaac ctcgtgttgt tcggagcgca cacacacaca accagatctc 720

ccccaaatcc acccgtcggc acctccgctt caaggtacgc cgctcgtcct cccccccccc 780

cctctctacc ttctctagat cggcgttccg gtccatggtt agggcccggt agttctactt 840

ctgttcatgt ttgtgttaga tccgtgtttg tgttagatcc gtgctgctag cgttcgtaca 900

cggatgcgac ctgtacgtca gacacgttct gattgctaac ttgccagtgt ttctctttgg 960

ggaatcctgg gatggctcta gccgttccgc agacgggatc gatttcatga ttttttttgt 1020

ttcgttgcat agggtttggt ttgccctttt cctttatttc aatatatgcc gtgcacttgt 1080

ttgtcgggtc atcttttcat gctttttttt gtcttggttg tgatgatgtg gtctggttgg 1140

gcggtcgttc tagatcggag tagaattctg tttcaaacta cctggtggat ttattaattt 1200

tggatctgta tgtgtgtgcc atacatattc atagttacga attgaagatg atggatggaa 1260

atatcgatct aggataggta tacatgttga tgcgggtttt actgatgcat atacagagat 1320

gctttttgtt cgcttggttg tgatgatgtg gtgtggttgg gcggtcgttc attcgttcta 1380

gatcggagta gaatactgtt tcaaactacc tggtgtattt attaattttg gaactgtatg 1440

tgtgtgtcat acatcttcat agttacgagt ttaagatgga tggaaatatc gatctaggat 1500

aggtatacat gttgatgtgg gttttactga tgcatataca tgatggcata tgcagcatct 1560

attcatatgc tctaaccttg agtacctatc tattataata aacaagtatg ttttataatt 1620

attttgatct tgatatactt ggatgatggc atatgcagca gctatatgtg gattttttta 1680

gccctgcctt catacgctat ttatttgctt ggtactgttt cttttgtcga tgctcaccct 1740

gttgtttggt gttacttctg cag 1763

<210> 2

<211> 4203

<212> DNA

<213> Streptococcus thermophilus

<400> 2

atggctccta agaagaagcg gaaggttggt attcacgggg tgcctgcggc tgacaagaag 60

tactccatcg gcctcgacat cggcaccaac agcgtcggct gggcggtgat caccgacgag 120

tacaaggtcc cgtccaagaa gttcaaggtc ctgggcaaca ccgaccgcca ctccatcaag 180

aagaacctca tcggcgccct cctcttcgac tccggcgaga cggcggaggc gacccgcctc 240

aagcgcaccg cccgccgccg ctacacccgc cgcaagaacc gcatctgcta cctccaggag 300

atcttctcca acgagatggc gaaggtcgac gactccttct tccaccgcct cgaggagtcc 360

ttcctcgtgg aggaggacaa gaagcacgag cgccacccca tcttcggcaa catcgtcgac 420

gaggtcgcct accacgagaa gtaccccact atctaccacc ttcgtaagaa gcttgttgac 480

tctactgata aggctgatct tcgtctcatc taccttgctc tcgctcacat gatcaagttc 540

cgtggtcact tccttatcga gggtgacctt aaccctgata actccgacgt ggacaagctc 600

ttcatccagc tcgtccagac ctacaaccag ctcttcgagg agaaccctat caacgcttcc 660

ggtgtcgacg ctaaggcgat cctttccgct aggctctcca agtccaggcg tctcgagaac 720

ctcatcgccc agctccctgg tgagaagaag aacggtcttt tcggtaacct catcgctctc 780

tccctcggtc tgacccctaa cttcaagtcc aacttcgacc tcgctgagga cgctaagctt 840

cagctctcca aggataccta cgacgatgat ctcgacaacc tcctcgctca gattggagat 900

cagtacgctg atctcttcct tgctgctaag aacctctccg atgctatcct cctttcggat 960

atccttaggg ttaacactga gatcactaag gctcctcttt ctgcttccat gatcaagcgc 1020

tacgacgagc accaccagga cctcaccctc ctcaaggctc ttgttcgtca gcagctcccc 1080

gagaagtaca aggagatctt cttcgaccag tccaagaacg gctacgccgg ttacattgac 1140

ggtggagcta gccaggagga gttctacaag ttcatcaagc caatccttga gaagatggat 1200

ggtactgagg agcttctcgt taagcttaac cgtgaggacc tccttaggaa gcagaggact 1260

ttcgataacg gctctatccc tcaccagatc caccttggtg agcttcacgc catccttcgt 1320

aggcaggagg acttctaccc tttcctcaag gacaaccgtg agaagatcga gaagatcctt 1380

actttccgta ttccttacta cgttggtcct cttgctcgtg gtaactcccg tttcgcttgg 1440

atgactagga agtccgagga gactatcacc ccttggaact tcgaggaggt tgttgacaag 1500

ggtgcttccg cccagtcctt catcgagcgc atgaccaact tcgacaagaa cctccccaac 1560

gagaaggtcc tccccaagca ctccctcctc tacgagtact tcacggtcta caacgagctc 1620

accaaggtca agtacgtcac cgagggtatg cgcaagcctg ccttcctctc cggcgagcag 1680

aagaaggcta tcgttgacct cctcttcaag accaaccgca aggtcaccgt caagcagctc 1740

aaggaggact acttcaagaa gatcgagtgc ttcgactccg tcgagatcag cggcgttgag 1800

gaccgtttca acgcttctct cggtacctac cacgatctcc tcaagatcat caaggacaag 1860

gacttcctcg acaacgagga gaacgaggac atcctcgagg acatcgtcct cactcttact 1920

ctcttcgagg atagggagat gatcgaggag aggctcaaga cttacgctca tctcttcgat 1980

gacaaggtta tgaagcagct caagcgtcgc cgttacaccg gttggggtag gctctcccgc 2040

aagctcatca acggtatcag ggataagcag agcggcaaga ctatcctcga cttcctcaag 2100

tctgatggtt tcgctaacag gaacttcatg cagctcatcc acgatgactc tcttaccttc 2160

aaggaggata ttcagaaggc tcaggtgtcc ggtcagggcg actctctcca cgagcacatt 2220

gctaaccttg ctggttcccc tgctatcaag aagggcatcc ttcagactgt taaggttgtc 2280

gatgagcttg tcaaggttat gggtcgtcac aagcctgaga acatcgtcat cgagatggct 2340

cgtgagaacc agactaccca gaagggtcag aagaactcga gggagcgcat gaagaggatt 2400

gaggagggta tcaaggagct tggttctcag atccttaagg agcaccctgt cgagaacacc 2460

cagctccaga acgagaagct ctacctctac tacctccaga acggtaggga tatgtacgtt 2520

gaccaggagc tcgacatcaa caggctttct gactacgacg tcgaccacat tgttcctcag 2580

tctttcctta aggatgactc catcgacaac aaggtcctca cgaggtccga caagaacagg 2640

ggtaagtcgg acaacgtccc ttccgaggag gttgtcaaga agatgaagaa ctactggagg 2700

cagcttctca acgctaagct cattacccag aggaagttcg acaacctcac gaaggctgag 2760

aggggtggcc tttccgagct tgacaaggct ggtttcatca agaggcagct tgttgagacg 2820

aggcagatta ccaagcacgt tgctcagatc ctcgattcta ggatgaacac caagtacgac 2880

gagaacgaca agctcatccg cgaggtcaag gtgatcaccc tcaagtccaa gctcgtctcc 2940

gacttccgca aggacttcca gttctacaag gtccgcgaga tcaacaacta ccaccacgct 3000

cacgatgctt accttaacgc tgtcgttggt accgctctta tcaagaagta ccctaagctt 3060

gagtccgagt tcgtctacgg tgactacaag gtctacgacg ttcgtaagat gatcgccaag 3120

tccgagcagg agatcggcaa ggccaccgcc aagtacttct tctactccaa catcatgaac 3180

ttcttcaaga ccgagatcac cctcgccaac ggcgagatcc gcaagcgccc tcttatcgag 3240

acgaacggtg agactggtga gatcgtttgg gacaagggtc gcgacttcgc tactgttcgc 3300

aaggtccttt ctatgcctca ggttaacatc gtcaagaaga ccgaggtcca gaccggtggc 3360

ttctccaagg agtctatcct tccaaagaga aactcggaca agctcatcgc taggaagaag 3420

gattgggacc ctaagaagta cggtggtttc gactccccta ctgtcgccta ctccgtcctc 3480

gtggtcgcca aggtggagaa gggtaagtcg aagaagctca agtccgtcaa ggagctcctc 3540

ggcatcacca tcatggagcg ctcctccttc gagaagaacc cgatcgactt cctcgaggcc 3600

aagggctaca aggaggtcaa gaaggacctc atcatcaagc tccccaagta ctctcttttc 3660

gagctcgaga acggtcgtaa gaggatgctg gcttccgctg gtgagctcca gaagggtaac 3720

gagcttgctc ttccttccaa gtacgtgaac ttcctctacc tcgcctccca ctacgagaag 3780

ctcaagggtt cccctgagga taacgagcag aagcagctct tcgtggagca gcacaagcac 3840

tacctcgacg agatcatcga gcagatctcc gagttctcca agcgcgtcat cctcgctgac 3900

gctaacctcg acaaggtcct ctccgcctac aacaagcacc gcgacaagcc catccgcgag 3960

caggccgaga acatcatcca cctcttcacg ctcacgaacc tcggcgcccc tgctgctttc 4020

aagtacttcg acaccaccat cgacaggaag cgttacacgt ccaccaagga ggttctcgac 4080

gctactctca tccaccagtc catcaccggt ctttacgaga ctcgtatcga cctttcccag 4140

cttggtggtg ataagcgtcc tgctgccacc aaaaaggccg gacaggctaa gaaaaagaag 4200

tag 4203

<210> 3

<211> 253

<212> DNA

<213> nopaline synthase (nopalinesynthase)

<400> 3

gatcgttcaa acatttggca ataaagtttc ttaagattga atcctgttgc cggtcttgcg 60

atgattatca tataatttct gttgaattac gttaagcatg taataattaa catgtaatgc 120

atgacgttat ttatgaggtg ggtttttatg attagagtcc cgcaattata catttaatac 180

gcgatagaaa acaaaatata gcgcgcaaac taggataaat tatcgcgcgc ggtgtcatct 240

atgttactag atc 253

<210> 4

<211> 383

<212> DNA

<213> Rice (rice)

<400> 4

aaggaatctt taaacatacg aacagatcac ttaaagttct tctgaagcaa cttaaagtta 60

tcaggcatgc atggatcttg gaggaatcag atgtgcagtc agggaccata gcacaagaca 120

ggcgtcttct actggtgcta ccagcaaatg ctggaagccg ggaacactgg gtacgttgga 180

aaccacgtgt gatgtgaagg agtaagataa actgtaggag aaaagcattt cgtagtgggc 240

catgaagcct ttcaggacat gtattgcagt atgggccggc ccattacgca attggacgac 300

aacaaagact agtattagta ccacctcggc tatccacata gatcaaagct ggtttaaaag 360

agttgtgcag atgatccgtg gca 383

<210> 5

<211> 466

<212> DNA

<213> Rice (rice)

<400> 5

tggaatcggc agcaaaggat tttttcctgt agttttccca caaccatttt ttaccatccg 60

aatgatagga taggaaaaat atccaagtga acagtattcc tataaaattc ccgtaaaaag 120

cctgcaatcc gaatgagccc tgaagtctga actagccggt cacctgtaca ggctatcgag 180

atgccataca agagacggta gtaggaacta ggaagacgat ggttgattcg tcaggcgaaa 240

tcgtcgtcct gcagtcgcat ctatgggcct ggacggaata ggggaaaaag ttggccggat 300

aggagggaaa ggcccaggtg cttacgtgcg aggtaggcct gggctctcag cacttcgatt 360

cgttggcacc ggggtaggat gcaatagaga gcaacgttta gtaccacctc gcttagctag 420

agcaaactgg actgccttat atgcgcgggt gctggcttgg ctgccg 466

<210> 6

<211> 350

<212> DNA

<213> Rice (rice)

<400> 6

gaatcggcag caaaggatgc aagaacgaac taagccggac aaaaaaaaaa ggagcacata 60

tacaaaccgg ttttattcat gaatggtcac gatggatgat ggggctcaga cttgagctac 120

gaggccgcag gcgagagaag cctagtgtgc tctctgcttg tttgggccgt aacggaggat 180

acggccgacg agcgtgtact accgcgcggg atgccgctgg gcgctgcggg ggccgttgga 240

tggggatcgg tgggtcgcgg gagcgttgag gggagacagg tttagtacca cctcgcctac 300

cgaacaatga agaacccacc ttataacccc gcgcgctgcc gcttgtgttg 350

<210> 7

<211> 760

<212> DNA

<213> Rice (rice)

<400> 7

ggaatcggca gcaaaggact cattagcggt atgcatgttg gtagaagtcg gagatgtaaa 60

taattttcat tatataaaaa aggtacttcg agaaaaataa atgcatacga attaattctt 120

tttatgtttt ttaaaccaag tatatagaat ttattgatgg ttaaaatttc aaaaatatga 180

cgagagaaag gttaaacgta cggcatatac ttctgaacag agagggaata tggggttttt 240

gttgctccca acaattctta agcacgtaaa ggaaaaaagc acattatcca cattgtactt 300

ccagagatat gtacagcatt acgtaggtac gttttctttt tcttcccgga gagatgatac 360

aataatcatg taaacccaga atttaaaaaa tattctttac tataaaaatt ttaattaggg 420

aacgtattat tttttacatg acaccttttg agaaagaggg acttgtaata tgggacaaat 480

gaacaatttc taagaaatgg gcatatgact ctcagtacaa tggaccaaat tccctccagt 540

cggcccagca atacaaaggg aaagaaatga gggggcccac aggccacggc ccacttttct 600

ccgtggtggg gagatccagc tagaggtccg gcccacaagt ggcccttgcc ccgtgggacg 660

gtgggattgc agagcgcgtg ggcggaaaca acagtttagt accacctcgc tcacgcaacg 720

acgcgaccac ttgcttataa gctgctgcgc tgaggctcag 760

<210> 8

<211> 115

<212> DNA

<213> Rice (rice)

<400> 8

gttttagagc tagaaatagc aagttaaaat aaggctagtc cgttatcaac ttgaaaaagt 60

ggcaccgagt cggtgctttt tttcaagagc ttggagtgga tggaattttc ctccg 115

<210> 9

<211> 831

<212> DNA

<213> corn (corn)

<400> 9

aaaccgtctc ttcgtgagaa taaccgtggc ctaaaaataa gccgatgagg ataaataaaa 60

tgtggtggta cagtacttca agaggtttac tcatcaagag gatgcttttc cgatgagctc 120

tagtagtaca tcggacctca catacctcca ttgtggtgaa atattttgtg ctcatttagt 180

gatgggtaaa ttttgtttat gtcactctag gttttgacat ttcagttttg ccactcttag 240

gttttgacaa ataatttcca ttccgcggca aaagcaaaac aattttattt tacttttacc 300

actcttagct ttcacaatgt atcacaaatg ccactctaga aattctgttt atgccacaga 360

atgtgaaaaa aaacactcac ttatttgaag ccaaggtgtt catggcatgg aaatgtgaca 420

taaagtaacg ttcgtgtata agaaaaaatt gtactcctcg taacaagaga cggaaacatc 480

atgagacaat cgcgtttgga aggctttgca tcacctttgg atgatgcgca tgaatggagt 540

cgtctgcttg ctagccttcg cctaccgccc actgagtccg ggcggcaact accatcggcg 600

aacgacccag ctgacctcta ccgaccggac ttgaatgcgc taccttcgtc agcgacgatg 660

gccgcgtacg ctggcgacgt gcccccgcat gcatggcggc acatggcgag ctcagaccgt 720

gcgtggctgg ctacaaatac gtaccccgtg agtgccctag ctagaaactt acacctgcaa 780

ctgcgagagc gagcgtgtga gtgtagccga gtagatccac cggtcgccac c 831

<210> 10

<211> 678

<212> DNA

<213> coral worm (Discosoma)

<400> 10

atggcctcct ccgagaacgt catcaccgag ttcatgcgct tcaaggtgcg catggagggc 60

accgtgaacg gccacgagtt cgagatcgag ggcgagggcg agggccgccc ctacgagggc 120

cacaacaccg tgaagctgaa ggtgacgaag ggcggccccc tgcccttcgc ctgggacatc 180

ctgtcccccc agttccagta cggctccaag gtgtacgtga agcaccccgc cgacatcccc 240

gactacaaga agctgtcctt ccccgagggc ttcaagtggg agcgcgtgat gaacttcgag 300

gacggcggcg tggcgaccgt gacccaggac tcctccctgc aggacggctg cttcatctac 360

aaggtgaagt tcatcggcgt gaacttcccc tccgacggcc ccgtgatgca gaagaagacc 420

atgggctggg aggcctccac cgagcgcctg tacccccgcg acggcgtgct gaagggcgag 480

acccacaagg ccctgaagct gaaggacggc ggccactacc tggtggagtt caagtccatc 540

tacatggcca agaagcccgt gcagctgccc ggctactact acgtggacgc caagctggac 600

atcacctccc acaacgagga ctacaccatc gtggagcagt acgagcgcac cgagggccgc 660

caccacctgt tcctgtag 678

<210> 11

<211> 342

<212> DNA

<213> corn (corn)

<400> 11

cggcccatgg atattcgaac gcgtagactt gtccatcttc tggattggcc aacttaatta 60

atgtatgaaa taaaaggatg cacacatagt gacatgctaa tcactataat gtgggcatca 120

aagttgtgtg ttatgtgtaa ttactagtta tctgaataaa agagaaagag atcatccata 180

tttcttatcc taaatgaatg tcacgtgtct ttataattct ttgatgaacc agatgcattt 240

cattaaccaa atccatatac atataaatat taatcatata taattaatat caattgggtt 300

agcaaaacaa atctagtcta ggtgtgtttt gcgaatgcgg cc 342

<210> 12

<211> 2717

<212> DNA

<213> corn (corn)

<400> 12

ggcataccag acagtccggt gtgccagatc agggcaccct tcggttcctt tgctcctttg 60

cttttgaacc ctaactttga tcgtttattg gtttgtgttg aacctttatg cacctgtgga 120

atatataatc tagaacaaac tagttagtcc aatcatttgt gttgggcatt caaccaccaa 180

aattatttat aggaaaaggt taaaccttat ttccctttca atctccccct ttttggtgat 240

tgatgccaac acaaaccaaa gaaaatatat aagtgcagaa ttgaactagt ttgcataagg 300

taagtgcata ggttacttag aattaaatca atttatactt ttacttgata tgcatggttg 360

ctttctttta ttttaacatt ttggaccaca tttgcaccac ttgttttgtt ttttgcaaat 420

ctttttggaa attctttttc aaagtctttt gcaaatagtc aaaggtatat gaataagatt 480

gtaagaagca ttttcaagat ttgaaatttc tccccctgtt tcaaatgctt ttcctttgac 540

taaacaaaac tccccctgaa taaaattctc ctcttagctt tcaagagggt tttaaataga 600

tatcaattgg aaatatattt agatgctaat tttgaaaata taccaattga aaatcaacat 660

accaatttga aattaaacat accaatttaa aaaatttcaa aaagtggtgg tgcggtcctt 720

ttgctttggg cttaatattt ctcccccttt ggcattaatc gccaaaaacg gagactttgt 780

gagccattta tactttctcc ccattggtaa atgaaatatg agtgaaagat tataccaaat 840

ttggacagtg atgcggagtg acggcgaagg ataaacgata ccgttagagt ggagtggaag 900

ccttgtcttc gccgaagact ccatttccct ttcaatctac gacttagcat agaaatacac 960

ttgaaaacac attagtcgta gccacgaaag agatatgatc aaaggtatac aaatgagcta 1020

tgtgtgtaat gtttcaatca aagtttcgag aatcaagaat atttagctca ttcctaagtt 1080

tgctaaaggt tttatcatat aatggtttgg taaagatatc gactaattgt tctttggtgc 1140

taacataagc aatctcgata tcaccccttt gttggtgatc cctcaaaaag tgataccgaa 1200

tgtctatgtg cttagtgcgg ctgtgttcaa cgggattatc cgccatgcag atagcactct 1260

cattgtcaca taggagaggg actttgctca atttgtagcc atagtcccta aggttttgcc 1320

tcatccaaag taattgcaca caacaatgtc ctgcggcaat atacttggct tcggcggtag 1380

aaagagctat tgagttttgt ttctttgaag tccaagacac cagggatctc cctagaaact 1440

gacaagtccc tgatgtgctc ttcctatcaa ttttacaccc tgcccaatcg gcatctgaat 1500

atcctattaa atcaaaggtg gatcccttgg ggtaccaaag accaaattta ggagtgtaaa 1560

ctaaatatct catgattctt ttcacggccc taaggtgaac ttccttagga tcggcttgga 1620

atcttgcaca catgcatata gaaagcatac tatctggtcg agatgcacat aaatagagta 1680

aagatcctat catcgaccgg tatacctttt ggtctacgga tttacctccc gtgtcgaggt 1740

cgagatgccc attagttccc atgggtgtcc tgatgggctt ggcatccttc attccaaact 1800

tgttgagtat gtcttgaatg tactttgttt ggctgatgaa ggtgccatct tggagttgct 1860

tgacttgaaa tcctagaaaa tatttcaact tccccatcat agacatctcg aatttcggaa 1920

tcatgatcct actaaactct tcacaagtag atttgttagt agacccaaat ataatatcat 1980

caacataaat ttggcataca aacaaaactt ttgaaatggt tttagtaaag agagtaggat 2040

cggctttact gactctgaag ccattagtga taagaaaatc tcttaggcat tcataccatg 2100

ctgttggggc ttgcttgagc ccataaagcg cctttgagag tttataaaca tggttagggt 2160

actcactatc ttcaaagccg agaggttgct caacatagac ctattcaccc catttgatca 2220

cttttttggt ccttcaggat ctaatagtta tgtataattt agagtctctt gtttaatggc 2280

cagatatttc taattaatct aagaatttat gatatttttt aattttttat catgtctgat 2340

gagaattaac ataaaggctc aattgggtcc tgaattaata atagagtgaa aattaatcca 2400

gaggctctat tagaaccttc aattagtaat accaagatat atataagata gtagagtata 2460

gtttaaatgt tggcattgtt cattctttct tttgttattt aatttatgct ttccacggtg 2520

gttagtggtt acttctgaag ggtccaaata atgcatgaag agtttgagga caagaagtct 2580

gccctaaaaa tagcgatgca aaggcatggt gtccaagcca tacatatagc gcactaattt 2640

tatcagcaga acaatggtat ttataggtcc tagtgcccag gcaacaagag acacgaataa 2700

agcatcgatc acgacac 2717

<210> 13

<211> 1488

<212> DNA

<213> corn (corn)

<400> 13

atggcggcga caatggcagt gacgacgatg gtgacgagga gcaaggagag ctggtcgtca 60

ttgcaggtcc cggcggtggc attcccttgg aagccacgag gtggcaagac cggcggcctc 120

gagttccctc gccgggcgat gttcgccagc gtcggcctca acgtgtgccc gggcgtcccg 180

gcggggcgcg acccgcggga gcccgatccc aaggtcgtcc gggcggcctg cggcctggtc 240

caggcacaag tcctcttcca ggggtttaac tgggagtcgt gcaagcagca gggaggctgg 300

tacaacaggc tcaaggccca ggtcgacgac atcgccaagg ccggcgtcac gcacgtctgg 360

ctgcctccac cctcgcactc cgtctcgcca caaggctaca tgccaggccg cctatacgac 420

ctggacgcgt ccaagtacgg cacggcggcg gagctcaagt ccctgatagc ggcgttccac 480

ggcaggggcg tgcagtgcgt ggcggacatc gtcatcaacc accggtgcgc ggaaaagaag 540

gacgcgcgcg gcgtgtactg catcttcgag ggcgggactc ccgacgaccg cttggactgg 600

ggccccggga tgatctgcag cgacgacacg cagtactcgg acgggacggg gcaccgcgac 660

acgggcgagg ggttcgcggc ggcgcccgac atcgaccacc tcaacccgcg cgtgcagcgg 720

gagctctccg cctggctcaa ctggctcagg tccgacgccg tggggttcga cggctggcgc 780

ctcgacttcg ccaagggcta ctcgccggcc gtcgccagaa tgtacgtgga gagcacgggg 840

ccgccgagct tcgtcgtcgc ggagatatgg aactcgctga gctacagcgg ggacggcaag 900

ccggcgccca accaggacca gtgccggcag gagctgctgg actggacgcg ggccgtcggc 960

gggcccgcca tggcgttcga cttccccacc aagggcctgc tgcaggcggg cgtgcagggg 1020

gagctgtggc ggctgcgcga cagctccggc aacgcggccg gcctgatcgg gtgggcgccc 1080

gagaaggccg tcaccttcgt cgacaaccat gacaccgggt cgacgcagaa gctctggccg 1140

ttcccatccg acaaggtcat gcagggctac gcctacatcc tcacccatcc aggagtcccc 1200

tgcattttct acgaccacat gttcgactgg aacctgaagc aggagatatc cacgctgtct 1260

gccatcaggg cgcggaacgg catccgcgcc gggagcaagc tgcggatcct cgtggcggac 1320

gcggacgcgt acgtggccgt cgtcgacgag aaggtcatgg tgaagatcgg gacaaggtac 1380

ggcgtgagca gcgtggtccc gtcggatttc cacccggcgg cgcacggcaa ggactactgc 1440

gtctgggaga aagcgagcct ccgcgtcccg gcggggcgcc acctctag 1488

<210> 14

<211> 421

<212> DNA

<213> corn (corn)

<400> 14

cagctcagat tgctcagtct tgtgctgcat tgcaaacaca gcagcacgac actgcataac 60

gtcttttcct tgagatctga caaagcagca ttagtccgtt gatcggtgga agaccactcg 120

tcagtgttga gttgaatgtt tgatcaataa aatacggcaa tgctgtaagg gttgtttttt 180

atgccattga taatacactg tactgttcag ttgttgaact ctatttctta gccatgccaa 240

gtgcttttct tattttgaat aacattacag caaaaagttg aaagacaaaa aaaaaaaccc 300

ccgaacagag tgctttgggt cccaagctac tttagactgt gttcggcgtt ccccctaaat 360

ttctccccct atatctcact cacttgtcac atcagcgttc tctttcccct atatctccac 420

g 421

<210> 15

<211> 1800

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 15

tctgccagcc cggctacccg gcgaacttcg ccggcgccgg cggcttcagg gacaacgtga 60

ggacgctgct cggcttcgcg cacctggagg ccggcgtcca cggcgagacc aagtgctggt 120

cgttccagct cgagctgcac cgccaccccc ccaccgtcgt gaggctcttc gtcgtcgagg 180

aggaggtcgc cgcctcgccg caccgccagt gccacctctg ccgccatatt ggtccgtcga 240

acaaactaca attaatcaat caacctttac ataggattga tccgatcgat gccatggtgt 300

tgtagggtgg gggaggcatc tgatatgcag caagaggtat cacttcttgc tgccgaggag 360

ggaatcggcg gcggaagccg acggcctgtg cttcgcgatc aaccacggcg gcggcggtgg 420

cgcggagaaa gcgtcgtcga aagggacgac gacgacggcc tccagcagag gccacctgct 480

acacggcgtc gtgcacctca acggctacgg ccacctcgtc gccctccacg gcctcgaggg 540

cggctccgac ttcgtctccg gccaccagat catggacctc tgggaccgca tttgctcagc 600

cttgcacgta aggtagtagt agtatacatg tgcgtgtgca tgcatgcaag caatgcaacg 660

atgtcgggct gcgtgtgaga acatttgctt gggcatggtg tggtgtatgc aaggacggtg 720

agcctggtgg acacggcgag gaagggccac atggagctga ggctgctgca cggcgtcgcg 780

tacggcgaga cgtggttcgg gcggtggggg tacaggtacg gccggccgag ctacggcgtc 840

gcgctgccgt cgtaccggca gtcgctgcac gtgctcggct ccatgccgct ctgcgtgctg 900

gtgccgcacc tgtcgtgctt cagccaggag ctccccatgg tggtcaccaa gtaccaggcc 960

atcagcggcc acaagctgct cagcctcggc gacctcctcc gcttcatgct cgagctgcgc 1020

gcccgcctgc cggccacctc cgtcacggcc atggactacc ggggcatcat gtcggaggcc 1080

tcgtgccggt ggtcggcgaa gcgcgtcgac atggcggcgc gcgccgtcgt ggacgcgctc 1140

cgccgcgccg agccggcggc gcggtgggtc acgcggcagg aggtgcgcga cgcggcgcgc 1200

gcctacatcg gcgacacggg cctcctcgac ttcgtgctca agtccctcgg caaccacatc 1260

gtcggcaact acgtcgtgcg ccgcaccatg aacccggtga ccaaggtgct cgagtactgc 1320

ctcgaggacg tctccagcgt gctcccggcg gtcgccgccg gcggcggcgt gccggcgcag 1380

ggcaagatga gggtgaggtt ccagctcacg cgtgcgcagc tcatgaggga cctggtgcac 1440

ctgtaccggc acgtgctcaa ggagcccagc caggcgctca ccggcggcgc gttcggcgcg 1500

atcccggtgg cggtgcggat ggtcctggac atcaagcact tcgtcaaaga ttaccacgaa 1560

ggacaagccg cggcgagcag caatggcggt ggcggattcg ggcatcccca catcaacctg 1620

tgctgcacgc tgctcgtgag caacgggagc ccggagctag ctccaccgta cgagacggtg 1680

accctgccgg cgcacgcgac ggtgggcgag ctgaagtggg aggcgcagag ggtgttcagc 1740

gagatgtacc tcggcctgag gagcttcgcg gcggactccg tcgtcggggt cggcgccgac 1800

<210> 16

<211> 33

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 16

cgtggatgga caatttaaat tccgttttac ctg 33

<210> 17

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 17

gatcgccggg ctgtgcatta 20

<210> 18

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 18

caagtacctc cagaaaggcc 20

<210> 19

<211> 50

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 19

agatgatccg tggcagatcg ccgggctgtg cattagtttt agagctagaa 50

<210> 20

<211> 50

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 20

ttctagctct aaaactaatg cacagcccgg cgatctgcca cggatcatct 50

<210> 21

<211> 50

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 21

ctggcttggc tgccgcaagt acctccagaa aggccgtttt agagctagaa 50

<210> 22

<211> 50

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 22

ttctagctct aaaacggcct ttctggaggt acttgcggca gccaagccag 50

<210> 23

<211> 33

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 23

gttttagagc tagaaatagc aagttaaaat aag 33

<210> 24

<211> 32

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 24

tgccacggat catctgcaca actcttttaa ac 32

<210> 25

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 25

cggcagccaa gccagcaccc 20

<210> 26

<211> 42

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 26

cgtggatgga caatttaaat tccgttttac ctgtggaatc gg 42

<210> 27

<211> 41

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 27

caggtaaaac ggaatttaat tccatccact ccaagctctt g 41

Claims

1. A visual CRISPR/Cas9 gene editing system is characterized by comprising a gene editing element, an exogenous T-DNA visual tracking element and a transgenic pollen inactivation element, wherein the gene editing element, the exogenous T-DNA visual tracking element and the transgenic pollen inactivation element are constructed in the same T-DNA region of an expression vector;

the DNA sequence of the ZMAA1 gene is shown as SEQ ID NO. 13;

the DNA sequence of the IN2-1 terminator is shown IN SEQ ID NO. 14.

2. The visualized CRISPR/Cas9 gene editing system according to claim 1, wherein the gene editing element is a CRISPR/Cas9 expression structure, and the CRISPR/Cas9 expression structure comprises a Cas9 gene expression cassette and a gRNA expression cassette.

3. The visualized CRISPR/Cas9 gene editing system according to claim 2, wherein the Cas9 gene expression cassette is characterized in that the Cas9 gene is driven by a Ubi promoter and is terminated by a NOS terminator;

the DNA sequence of the Ubi promoter is shown as SEQ ID NO. 1;

the DNA sequence of the Cas9 gene is shown as SEQ ID NO. 2;

the DNA sequence of the NOS terminator is shown in SEQ ID NO. 3.

4. The visualized CRISPR/Cas9 gene editing system according to claim 2, wherein the gRNA expression cassette comprises a small RNA promoter and a guide-RNA separated by a spacer sequence;

the small RNA promoter is one of OsU3, OsU6a, OsU6b and OsU6 c;

the DNA sequence of OsU3 is shown in SEQ ID NO. 4;

the DNA sequence of OsU6a is shown as SEQ ID NO. 5;

the DNA sequence of OsU6b is shown as SEQ ID NO. 6;

the DNA sequence of OsU6c is shown as SEQ ID NO. 7;

the guide-RNA sequence is shown as SEQ ID NO. 8;

the DNA sequence of the spacer sequence is shown as SEQ ID NO. 15.

5. The visualized CRISPR/Cas9 gene editing system according to claim 1, wherein the exogenous T-DNA visualization tracking element is an expression cassette of red fluorescent protein gene DsRed, the DsRed gene is driven by endosperm-specific promoter ltp and terminated by a PINII terminator;

the DNA sequence of the DsRed gene is shown in SEQ ID NO. 10;

the DNA sequence of the PINII terminator is shown as SEQ ID NO. 11.

6. The visual CRISPR/Cas9 gene editing system according to claims 1 to 5, characterized in that an enzymatic assembly entry sequence is introduced between a transgenic pollen inactivation element and an exogenous T-DNA visual tracking element; the DNA sequence of the enzymatic assembly inlet sequence is shown as SEQ ID NO. 16.

7. A method of using the visualized CRISPR/Cas9 gene editing system of any one of claims 1-6, comprising the steps of:

s1, designing a joint primer sequence according to a target site of a gene to be knocked out, and synthesizing a target site recombination joint T1-Adapter and T2-Adapter; primers gRNA-F, OsU3-R and OsU6-R are designed according to a small RNA promoter and guide-RNA, and a U3-gRNA expression frame precursor and a U6-gRNA expression frame precursor are obtained through respective amplification;

s4, amplifying the pU3-T1-gRNA and the pU6-T2-gRNA by using recombinant primers gR-ZF and gR-ZR to obtain an amplification product U3-T1-gRNA expression frame and a U6-T1-gRNA expression frame which contain recombinant primers and a complete gRNA expression frame;

8. The use of claim 7, wherein the gRNA-F has the sequence set forth in SEQ ID No. 23;

the sequence of OsU3-R is shown in SEQ ID NO. 24;

the sequence of OsU6-R is shown in SEQ ID NO. 25.

9. The use method as claimed in claim 7, characterized in that the DNA sequence of the recombination primer gR-ZF is shown in SEQ ID No. 26;

the DNA sequence of the recombinant primer gR-ZR is shown in SEQ ID NO. 27.

10. The use of claim 7, wherein the vector is a C9DZ vector.