CN113355246A - Aspergillus flavus SX0104 without producing toxicity and application thereof - Google Patents
Aspergillus flavus SX0104 without producing toxicity and application thereof Download PDFInfo
- Publication number
- CN113355246A CN113355246A CN202110664640.2A CN202110664640A CN113355246A CN 113355246 A CN113355246 A CN 113355246A CN 202110664640 A CN202110664640 A CN 202110664640A CN 113355246 A CN113355246 A CN 113355246A
- Authority
- CN
- China
- Prior art keywords
- aspergillus flavus
- aflatoxin
- toxin
- aspergillus
- peanut
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Classifications
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01G—HORTICULTURE; CULTIVATION OF VEGETABLES, FLOWERS, RICE, FRUIT, VINES, HOPS OR SEAWEED; FORESTRY; WATERING
- A01G7/00—Botany in general
- A01G7/06—Treatment of growing trees or plants, e.g. for preventing decay of wood, for tingeing flowers or wood, for prolonging the life of plants
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Biodiversity & Conservation Biology (AREA)
- Ecology (AREA)
- Forests & Forestry (AREA)
- Engineering & Computer Science (AREA)
- Wood Science & Technology (AREA)
- Botany (AREA)
- Environmental Sciences (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
Abstract
The invention provides a non-toxigenic aspergillus flavus SX0104 and application thereof, and particularly relates to the technical field of microorganisms. The invention provides a non-toxigenic aspergillus flavus SX0104 strain, wherein the preservation number of the aspergillus flavus SX0104 is CCTCC NO: M2020520. The aspergillus flavus SX0104 does not produce aflatoxin, aflatoxin and variegated aspergillus toxin, is a biocontrol strain with high safety and strong reproductive capacity, has the capacity of efficiently competitively inhibiting the growth, reproduction and toxin production of toxin-producing aspergillus flavus, and can remarkably reduce the contents of aflatoxin, aflatoxin and variegated aspergillus toxin in agricultural products such as peanuts and the like.
Description
Technical Field
The invention relates to the technical field of microorganisms, in particular to a non-toxigenic aspergillus flavus SX0104 strain and application thereof.
Background
After the Aspergillus flavus infects crops, toxic secondary metabolites such as Aflatoxin (AFT), aflatoxin (Aflatrem), variegated aflatoxin (ST) and the like can be generated, and the consumption safety and the life health of people are seriously threatened. Aflatoxins have acute and chronic toxicity, can cause cancer, teratogenesis and mutagenesis, and are mycotoxins which are discovered so far and pollute agricultural products with the highest toxicity and the highest carcinogenicity. Aflatoxin is an indole diterpenoid mycotoxin, has tumorigenic properties and acute neurotoxic effects, and can cause animal tremor. The aflatoxin is an intermediate product in the later stage of the process of synthesizing the aflatoxin by aspergillus flavus, and the toxicity and carcinogenicity of the aflatoxin are highly regarded by various countries in the world due to the similarity of the structure of the aflatoxin. China is in a region with serious aflatoxin pollution, agricultural products such as peanuts, corns, rice, nuts and the like and food are reported and detected, and the phenomenon of mixed pollution with aflatoxin, variegated aflatoxin and the like exists, so that the consumption safety of agricultural products in China is threatened, and the industrial development and export trade are limited. Among them, peanuts and corns are most susceptible to aflatoxin infection and aflatoxin and other mycotoxins. Therefore, the research on field prevention and control of the aspergillus flavus pollution of agricultural products can reduce the aspergillus flavus infection and the mycotoxin pollution generated by the aspergillus flavus infection from the source, and the method has important significance for ensuring the quality safety of agricultural products in China and improving the international competitiveness of agricultural products in China.
The biological prevention and control has the advantages of no damage to the original quality of agricultural products, safety, high efficiency, environmental protection and the like, and is an effective way for green control of aspergillus flavus and aflatoxin. The growth and the propagation of the aflatoxin produced in the field are competitively inhibited by using the aflatoxin which does not produce toxin, so that the number of bacteria of the toxin producing bacteria is reduced, the aflatoxin pollution level is reduced, and the method is a very effective biological control method for controlling the aflatoxin pollution in agricultural products such as peanuts, corns and the like from the source. The research of the aspergillus flavus biocontrol bacteria which do not produce the toxin in China is in the initial stage, and no case exists for successful popularization and application in the field. The non-toxigenic aspergillus flavus used for biological control and the application thereof (such as CN 110157626A, CN 110305796A, CN 110129212A, CN 107177516 and CN 104789480A) reported at present only aim at the situation that aflatoxin is not generated, and the pollution risk of aflatoxin, variegated aspergillus toxin and other mycotoxins can be brought after the field application. Therefore, the high-safety aspergillus flavus which does not produce a plurality of fungaltoxins such as aflatoxin, variegated aspergillus toxin and the like is screened, developed and utilized, toxin pollution prevention and control are carried out before crops are harvested, the risk that aflatoxin, variegated aspergillus toxin and the like enter a food chain is effectively reduced, and the wide application prospect is realized in the aspect of improving the quality safety level of agricultural products.
Disclosure of Invention
In order to solve the problems, the invention provides a non-toxigenic aspergillus flavus SX0104 strain and application thereof. The aspergillus flavus SX0104 is a biocontrol strain which does not produce aflatoxin, aflatoxin and variegated aspergillus toxin, has the advantages of high safety, broad spectrum and strong reproductive capacity, and can remarkably reduce the content of aflatoxin, variegated aspergillus toxin and other mycotoxins in agricultural products such as peanuts and the like.
In order to achieve the above purpose, the invention provides the following technical scheme:
the invention provides a non-toxigenic Aspergillus flavus (Aspergillus flavus) SX0104, wherein the preservation number of the Aspergillus flavus SX0104 is CCTCC NO: M2020520.
Preferably, the aspergillus flavus SX0104 does not produce aflatoxin, aflatoxin and variegated aflatoxin.
Preferably, the aflatoxin comprises aflatoxin B1Aflatoxins B2Aflatoxin G1And aflatoxin G2。
The invention provides application of the aspergillus flavus SX0104 in competitive inhibition of toxin production by the aspergillus flavus.
Preferably, the toxins include aflatoxins, aflatoxins and aflatoxins.
The invention provides application of the aspergillus flavus SX0104 in reducing aflatoxin, aflatoxin and variegated aspergillus toxin pollution in agricultural products.
Preferably, the agricultural products include peanuts, corns, and the like.
The invention provides a method for reducing aflatoxin, aflatoxin and variegated aspergillus toxin pollution in agricultural products, which comprises the following steps:
root irrigation treatment was performed using the suspension of aspergillus flavus SX0104 described above.
Preferably, the suspension of Aspergillus flavus SX0104 has conidium concentration of 1 × 103～1×106The dosage of the fertilizer is 70-100L/mu.
The invention provides a toxin production inhibitor for aspergillus flavus, which comprises the aspergillus flavus SX 0104; the concentration of conidium of the aspergillus flavus SX0104 is 1 × 103～1×106One per ml.
The Aspergillus flavus SX0104 nontoxic is provided, and the preservation number of the Aspergillus flavus SX0104 is CCTCC NO: M2020520. The strain can competitively inhibit growth and toxin production of toxin-producing aspergillus flavus, remarkably reduce the contents of aflatoxin, aflatoxin and variegated aspergillus toxin in agricultural products such as peanuts and the like, and has the advantages of high safety, broad spectrum and strong fertility. The experimental result shows that the strain has good effect of inhibiting aflatoxin of toxin-producing aspergillus flavus separated from a standard strain 3.4408 (disclosed in PCR-RFLP method for identifying aflatoxin toxin-producing strains, China agricultural science 2014, purchased from China general microbiological culture Collection center) and different peanut producing areas; the diameter of the colony after 5 days of culture is 7.3cm, and the spore yield is 5.25 multiplied by 108A plurality of; the result of the determination of the toxin producing capability is that the aflatoxin B is not produced1Aflatoxins B2Aflatoxin G1Aspergillus flavus toxin G2Aflatoxins and aflatoxins. Therefore, the strain is a biocontrol strain with high safety and strong competitive advantage, and can obviously inhibit the produced toxin aspergillus flavus from infecting agricultural products and reduce mycotoxin pollution such as aflatoxin, variegated aspergillus toxin and the like in the agricultural products.
Drawings
FIG. 1 shows colony forms of Aspergillus flavus SX0104 on the back of DG-18 culture medium and AFPA culture medium, wherein A is colony form of Aspergillus flavus SX0104 on DG-18 culture medium, and B is colony form of Aspergillus flavus SX0104 on the back of AFPA culture medium;
FIG. 2 shows Aspergillus flavus SX0104 pair of toxigenic Aspergillus flavus AFT and AFB with different conidium concentrations1The inhibition rate of the strain is shown in the specification, wherein the non-toxigenic bacteria are aspergillus flavus SX0104, the toxigenic bacteria are standard aspergillus flavus strain 3.4408, the AFT is the total amount of aflatoxin, and the AFB is1Is aflatoxin B1(ii) a In addition, in FIG. 2, A is the inhibition rate of Aspergillus flavus SX0104 with different conidium concentrations on producing toxin Aspergillus flavus AFT, and B is the inhibition rate of Aspergillus flavus SX0104 with different conidium concentrations on producing toxin Aspergillus flavus AFB1The inhibition ratio of (3).
Biological preservation information
Aspergillus flavus SX0104 is preserved in China Center for Type Culture Collection (CCTCC) at 9/18/2020, with the preservation address of Wuhan university in China and the preservation number of M2020520.
Detailed Description
The invention provides a non-toxigenic Aspergillus flavus (Aspergillus flavus) SX0104, wherein the preservation number of the Aspergillus flavus SX0104 is CCTCC NO: M2020520. The aspergillus flavus SX0104 is preferably screened from peanut planting fields of southern Chaxincun of Shanxi Xiangfen county.
The aspergillus flavus SX0104 is screened from 1600 strains of aspergillus flavus separated from different peanut producing areas in China through strain toxicity production capability evaluation and biocontrol inhibition effect test; after the aflatoxin production capacity of 1600 strains is measured, 97 aspergillus flavus which does not produce aflatoxin is selected, co-culture and toxin production inhibition effect evaluation are respectively carried out on two substrates of peanut kernel and peanut powder and 8 aspergillus flavus separated from different areas of a standard strain 3.4408, and then 1 non-toxigenic aspergillus flavus which does not produce secondary metabolites such as aflatoxin, variegated aflatoxin and the like is obtained by screening.
The nucleotide sequence of the ITS gene of the aspergillus flavus SX0104 is preferably shown as SEQ ID No. 1: CGGAGGGCCAACCTTTTCCTCCGGCTTATTGATATGCTTAAGTTCAGCGGGTATCCCTACCTGATCCGAGGTCAACCTGGAAAAGATTGATTTGCGTTCGGCAAGCGCCGGCCGGGCCTACAGAGCGGGTGACAAAGCCCCATACGCTCGAGGATCGGACGCGGTGCCGCCGCTGCCTTTGGGGCCCGTCCCCCCCGGAGAGGGGACGACGACCCAACACACAAGCCGTGCTTGATGGGCAGCAATGACGCTCGGACAGGCATGCCCCCCGGAATACCAGGGGGCGCAATGTGCGTTCAAAGACTCGATGATTCACGGAATTCTGCAATTCACACTAGTTATCGCATTTCGCTGCGTTCTTCATCGATGCCGGAACCAAGAGATCCATTGTTGAAAGTTTTAACTGATTGCGATACAATCAACTCAGACTTCACTAGATCAGACAGAGTTCGTGGTGTCTCCGGCGGGCGCGGGCCCGGGGCTGAGAGCCCCCGGCGGCCATGAATGGCGGGCCCGCCGAAGCAACTAAGGTACAGTAAACACGGGTGGGAGGTTGGGCTCGCTAGGAACCCTACACTCGGTAATGATCCTTCCGCAGGTCACCCTACGGAAGGATCATTACCGAGTGTAGGGTTCCTAGCGAGCCCAACCTCCCACCCGTGTTTACTGTACCTTAGTTGCTTCGGCGGGCCCGCCATTCATGGCCGACGGTGGATCATAGTTA are provided. The similarity between the ITS gene sequence of the aspergillus flavus SX0104 and the 18S ribosomal RNA gene sequence of the aspergillus flavus (A. flavus) is 98.65%.
The nucleotide sequence of the calmodulin coding gene of the aspergillus flavus SX0104 is preferably shown as SEQ ID No. 2: CTCGGGACGGCTTTTTTTTGCCTTCCCTAGTGGACAAACTCGTTGTCTAAAATCGGTCAGTATCACCATTTTTACAGCCGCAATGGGTCTGGGTGGGCTTCGCGAAACGTACAGTCAATCCGGCCGTCACCATCCTGATCCGCCTCGCGGATCATCTCATCAACTTCGTCATCGGTAAGCTTCTCGCCGATGGAGGTCATGACGTGACGCAATTCGGCAGCGGAGATGAAGCCGTTGTTATCGCGGTCGAAAACCTTGAAAGCCTCCCGGATCTCCTCCTCAGAGTCGGTATCCTTCATCTTTCTCGCCATCATCGTCAGGAACTCTATTTGAACATTAACAGCTATTTCATTTATGAATCGTACGGAAGCCGTCTCGTACCAGGGAAGTCAATGGTGCCATTGTTGTCGGCGTCAACCTCGTTAATCATGTCCTGGAGTTCCGACTCAGAGGGGTTTTGGCCCAGAGAGCGCATGACAGTGCCCAACTCCTTGGTGGTGATCTGGCCTGCATATCAAGTCAATTCATCAATGCCAAGACTTCAGCCGATCGAACAGAAACTGGATAAAATTATGGCGGCTAAAACATATTGGTCGCATTTGAAGGGAGAATGAATAAAATAAACTGTACTAACCATCACCGTCCTTGTCCTATAGGAAACCCAAGAAAGCCAAGTCAGCTTGTGTTCAAATCATGACGACTAACAAAACCAATTTTCACGAACGACGATAACTACTTACGAATAGGGAGAAGGCCTCCTTGTACTCGGAGACCTGTTCTTCAGTCAAAAAAACCGGCCTAAATAAAACCC are provided. The similarity between the calmodulin coding gene sequence of Aspergillus flavus SX0104 and the calmodulin A gene sequence of Aspergillus flavus is 100%.
The colony morphology of the aspergillus flavus SX0104 is preferably as follows: producing white hyphae and green spores on a PDA culture medium; producing yellow-green spores on DG-18 medium; the back of the strain presents bright orange characteristic bacterial colony on an AFPA culture medium, and according to morphological and molecular biological identification results, the Aspergillus flavus SX0104 is Aspergillus flavus.
The aspergillus flavus SX0104 provided by the invention preferably does not produce aflatoxin, aflatoxin and variegated aspergillus toxin, and is a biocontrol bacterium with high safety; the aflatoxin preferably comprises aflatoxin B1Aflatoxins B2Aflatoxin G1And aflatoxin G2(ii) a The aspergillus flavus SX0104 can efficiently compete to inhibit the toxin production of the toxin-producing aspergillus flavus, and has the capability of reducing the content of aflatoxin in peanuts.
In the embodiment of the invention, an ITS amplification primer pair and/or a calmodulin coding gene amplification primer pair are preferably adopted to identify the Aspergillus flavus SX 0104; the ITS amplification primer pair comprises an upstream primer ITS1 and a downstream primer ITS 4; the nucleotide sequence of the upstream primer ITS1 is shown as SEQ ID No. 3: TCCGTAGGTGAACCTGCGG, respectively; the nucleotide sequence of the downstream primer ITS4 is shown as SEQ ID No. 4: TCCTCCGCTTATTGATATGC, respectively; the calmodulin coding gene amplification primer pair comprises an upstream primer CF1 and a downstream primer CF4, wherein the nucleotide sequence of the upstream primer CF1 is shown as SEQ ID No. 5: AGGCCGAYTCTYTGACYGA, respectively; the nucleotide sequence of the downstream primer CF4 is shown as SEQ ID No. 6: TTTYTGCATCATRAGYTGGAC, respectively; the ITS amplification primer pair and the calmodulin coding gene amplification primer pair are preferably synthesized by Wuhan division of Biotechnology Limited in Beijing Optimalaceae. The ITS amplification primer pair in the primer group can be used for amplifying all the ITS regions and 5.8S rDNA of the fungi, is a general identification primer for the fungi, and can distinguish variation of the same genus and different species levels; the calmodulin coding gene amplification primer pair in the primer set can be used for amplifying calmodulin coding genes and can be used for effectively distinguishing three fungi, namely Aspergillus flavus (Aspergillus flavus), Aspergillus oryzae (Aspergillus nomius) and Aspergillus tamarii (Aspergillus tamarii).
In the embodiment of the invention, the mode for identifying the aspergillus flavus SX0104 preferably comprises the following steps:
the SX0104 genomic DNA was used as a template DNA, mixed with the above primer set, and subjected to PCR.
In the embodiment of the present invention, the PCR procedure preferably includes: pre-denaturation at 94 ℃ for 5 min; denaturation at 94 ℃ for 30s, annealing at 57-58 ℃ for 30s, extension at 72 ℃ for 30 s-60 s, and 35 cycles; extension at 72 ℃ for 10 min. In the present invention, when the template is mixed with the ITS amplification primer pair, the reaction sequence of PCR is preferably 94 ℃ denaturation for 30s, 58 ℃ annealing for 30s, 72 ℃ extension for 30s, 35 cycles; extending for 10min at 72 ℃; the reaction system of the PCR is calculated by 50 mu L, and preferably comprises 1 mu L of template DNA, 11 mu L of upstream primer ITS, 41 mu L of downstream primer ITS, 25 mu L of PCRMix and the balance of double distilled water; the working concentration of the upstream primer ITS1 and the downstream primer ITS4 is preferably 10 μ M; when the template is mixed with the calmodulin amplification primer pair, the reaction procedure for PCR is preferably 94 ℃ denaturation for 30s, 57 ℃ annealing for 30s, 72 ℃ extension for 60s (1min), 35 cycles; extending for 10min at 72 ℃; the reaction system of the PCR is calculated by 50 mu L, and preferably comprises 1 mu L of template DNA, an upstream primer CF 11 mu L, a downstream primer CF41 mu L, 25 mu L of PCR Mix and the balance of double distilled water; the working concentration of the upstream primer CF1 and the downstream primer CF4 are both preferably 10. mu.M.
The invention provides application of the aspergillus flavus SX0104 in competitive inhibition of toxin production by the aspergillus flavus. In the present invention, the toxin preferably comprises aflatoxin B1Aflatoxins B2Aflatoxin G1And aflatoxin G2。
The invention provides application of the aspergillus flavus SX0104 in reducing aflatoxin pollution in agricultural products. In the present invention, the agricultural products preferably include peanuts, corns, and the like. The concentration of conidium of the aspergillus flavus SX0104 is 5 multiplied by 102～5×105Under the condition of each ml, the toxin production inhibition rate of Aspergillus flavus SX0104 on Aspergillus flavus standard strain 3.4408 in peanut seeds is 52.2% -96.8%, and the peanut pot culture test (the pot culture area is 0.3 m)24 peanuts per pot, with a concentration of 1X 10 per plant of 9mL according to the dosage of 80L/mu5Root irrigation of conidium suspension/mL at peanut rhizosphere), and treating AFT and AFB1The product toxin production inhibition effect is obvious, and the inhibition rates are respectively 89% and 93.5%, so that the aspergillus flavus SX0104 can reduce the contents of aflatoxin, aflatoxin and variegated aspergillus toxin in agricultural products.
The invention provides a method for reducing aflatoxin, aflatoxin and variegated aspergillus toxin pollution in agricultural products, which comprises the following steps:
root irrigation treatment was performed using the suspension of aspergillus flavus SX0104 described above.
The agricultural products of the present invention include peanuts; the conidium concentration of the suspension of the aspergillus flavus SX0104 is preferably 1X 103～1×106One/ml, more preferably 1X 104～1×106One/ml, most preferably 1X 105～1×106Per ml; the using amount of the aspergillus flavus SX0104 suspension is preferably 70-100L/mu, more preferably 76-95L/mu and most preferably 80L/mu; the root irrigation treatment time of the suspension of the aspergillus flavus SX0104 is preferably the flowering and coning period of the peanuts.
The invention provides a toxin production inhibitor for aspergillus flavus, which comprises the aspergillus flavus SX 0104. The conidium concentration of the aspergillus flavus SX0104 is preferably 1X 103～1×106One/ml, more preferably 1X 104～1×106One/ml, most preferably 1X 105～1×106The strain/ml, under the concentration, the inhibition rate of Aspergillus flavus SX0104 to CGMCC No:3.4408 strain reaches 52.2-96.8%.
For further illustration of the present invention, the non-toxigenic aspergillus flavus SX0104 and its application provided by the present invention are described in detail below with reference to the drawings and examples, but they should not be construed as limiting the scope of the present invention.
Example 1
1. Separation and purification
DG-18 medium (cat # HB0296, Qingdao high-tech industrial park Haibo Biotechnology Co., Ltd.) was selected as the isolation medium for Aspergillus flavus. The soil samples collected from peanut planting fields of Shanxi Xiangfen Nanchaimen are treated by removing plant residues and large-particle stones, grinding the soil, uniformly mixing and the like.
The ground 10.0g of soil sample is weighed and added into 90mL of sterilized water, and the mixture is put into a shaking table to shake for 2h, so as to prepare 100mL of sample suspension. 50 μ l of the suspension was added to a DG-18 medium plate and spread evenly with a spreading bar. Then, the coated plate is placed into a constant temperature incubator, and cultured at 28 +/-1 ℃ under the condition of relative humidity of 90% and darkness.
After 5 days, selecting colonies with yellow-green spores on the appearance, transferring the colonies to a new DG-18 medium plate for secondary streak purification culture until single colonies are obtained, wherein the diameter of the Aspergillus flavus SX0104 colony is 7.3cm, and the spore yield is 5.25 multiplied by 108And is a pure culture of mold. The colony diameter of standard Aspergillus flavus strain 3.4408 under the same conditions is 7.0cm, and the spore yield is 4.25X 108And (4) respectively. Therefore, the aspergillus flavus SX0104 provided by the invention has the advantages of rapid growth and propagation.
2. Morphological identification
Colonies (A in FIG. 1) with yellowish green spores were picked from DG-18 medium, transferred to AFPA (Cat. No.: HB6276, Islands high tech, Yuangaku, Hippobo Biotech Co., Ltd., Triticum Agar, Aspergillus flavus and Aspergillus paraticus Agar), and cultured at 28. + -. 1 ℃ under a relative humidity of 90% in the dark.
The colony back color was observed after 5 days, and the colony with bright orange characteristic (B in FIG. 1) on the back of AFPA medium was preliminarily identified as Aspergillus flavus or Aspergillus parasiticus. Then selecting hypha which presents bright orange colony from the AFPA culture medium to a DG-18 culture medium, culturing for 5 days at the temperature of 28 +/-1 ℃ and the relative humidity of 90% under the dark condition until obtaining yellow green spores, and carrying out further molecular biological identification.
3. Molecular biological identification
The strain SX0104 is subjected to molecular identification through a fungal ITS gene sequence and a calmodulin gene sequence.
Primers used for amplification of Aspergillus flavus genome ITS were:
ITS1(SEQ ID No.3)：5′-TCCGTAGGTGAACCTGCGG-3′；
ITS4(SEQ ID No.4)：5′-TCCTCCGCTTATTGATATGC-3′。
the primers used for the amplification of the aspergillus flavus genome calmodulin are as follows:
CF1(SEQ ID No.5)：5′-AGGCCGAYTCTYTGACYGA-3′；
CF4(SEQ ID No.6)：5′-TTTYTGCATCATRAGYTGGAC-3′。
the ITS gene sequence PCR amplification system is as follows: mu.l of template DNA, 1. mu.l each of 10. mu.M primers (ITS1 and ITS4), 25. mu.l of PCR Mix, and made up to 50. mu.l with double distilled water. The PCR amplification conditions were: pre-denaturation at 94 ℃ for 5 min; denaturation at 94 ℃ for 30s, annealing at 58 ℃ for 30s, and extension at 72 ℃ for 30s for 35 cycles; final extension at 72 ℃ for 10 min. After amplification, the product was stored at 4 ℃. Sending to Wuhan division of Biotechnology Limited, Beijing Ongke, sequencing the product on NCBI website (https://blast.ncbi.nlm.nih.gov/ Blast.cgi) The above comparative analysis was performed.
The calmodulin gene sequence PCR amplification system is as follows: mu.l of template DNA, 1. mu.l each of 10. mu.M primers (CF1 and CF4), 25. mu.l of PCR Mix, made up to 50. mu.l with double distilled water. The PCR amplification conditions were: pre-denaturation at 94 ℃ for 5 min; denaturation at 94 ℃ for 30s, annealing at 57 ℃ for 30s, and extension at 72 ℃ for 1min for 35 cycles; final extension at 72 ℃ for 10 min. After amplification, the product was stored at 4 ℃. Sending to Wuhan division of Biotechnology Limited, Beijing Ongke, sequencing the product on NCBI website (https:// blast.ncbi.nlm.nih.gov/Blast.cgi) The above comparative analysis was performed.
As shown by sequencing, the nucleotide sequence of the ITS gene of the strain SX0104 is shown in (SEQ ID No. 1):
CGGAGGGCCAACCTTTTCCTCCGGCTTATTGATATGCTTAAGTTCAGCGGGTATCCCTACCTGATCCGAGGTCAACCTGGAAAAGATTGATTTGCGTTCGGCAAGCGCCGGCCGGGCCTACAGAGCGGGTGACAAAGCCCCATACGCTCGAGGATCGGACGCGGTGCCGCCGCTGCCTTTGGGGCCCGTCCCCCCCGGAGAGGGGACGACGACCCAACACACAAGCCGTGCTTGATGGGCAGCAATGACGCTCGGACAGGCATGCCCCCCGGAATACCAGGGGGCGCAATGTGCGTTCAAAGACTCGATGATTCACGGAATTCTGCAATTCACACTAGTTATCGCATTTCGCTGCGTTCTTCATCGATGCCGGAACCAAGAGATCCATTGTTGAAAGTTTTAACTGATTGCGATACAATCAACTCAGACTTCACTAGATCAGACAGAGTTCGTGGTGTCTCCGGCGGGCGCGGGCCCGGGGCTGAGAGCCCCCGGCGGCCATGAATGGCGGGCCCGCCGAAGCAACTAAGGTACAGTAAACACGGGTGGGAGGTTGGGCTCGCTAGGAACCCTACACTCGGTAATGATCCTTCCGCAGGTCACCCTACGGAAGGATCATTACCGAGTGTAGGGTTCCTAGCGAGCCCAACCTCCCACCCGTGTTTACTGTACCTTAGTTGCTTCGGCGGGCCCGCCATTCATGGCCGACGGTGGATCATAGTTA。
as shown by sequencing, the nucleotide sequence of the calmodulin coding gene of the strain SX0104 is shown in SEQ ID No. 2:
CTCGGGACGGCTTTTTTTTGCCTTCCCTAGTGGACAAACTCGTTGTCTAAAATCGGTCAGTATCACCATTTTTACAGCCGCAATGGGTCTGGGTGGGCTTCGCGAAACGTACAGTCAATCCGGCCGTCACCATCCTGATCCGCCTCGCGGATCATCTCATCAACTTCGTCATCGGTAAGCTTCTCGCCGATGGAGGTCATGACGTGACGCAATTCGGCAGCGGAGATGAAGCCGTTGTTATCGCGGTCGAAAACCTTGAAAGCCTCCCGGATCTCCTCCTCAGAGTCGGTATCCTTCATCTTTCTCGCCATCATCGTCAGGAACTCTATTTGAACATTAACAGCTATTTCATTTATGAATCGTACGGAAGCCGTCTCGTACCAGGGAAGTCAATGGTGCCATTGTTGTCGGCGTCAACCTCGTTAATCATGTCCTGGAGTTCCGACTCAGAGGGGTTTTGGCCCAGAGAGCGCATGACAGTGCCCAACTCCTTGGTGGTGATCTGGCCTGCATATCAAGTCAATTCATCAATGCCAAGACTTCAGCCGATCGAACAGAAACTGGATAAAATTATGGCGGCTAAAACATATTGGTCGCATTTGAAGGGAGAATGAATAAAATAAACTGTACTAACCATCACCGTCCTTGTCCTATAGGAAACCCAAGAAAGCCAAGTCAGCTTGTGTTCAAATCATGACGACTAACAAAACCAATTTTCACGAACGACGATAACTACTTACGAATAGGGAGAAGGCCTCCTTGTACTCGGAGACCTGTTCTTCAGTCAAAAAAACCGGCCTAAATAAAACCC。
the ITS amplification Sequence is compared with a BLASTN database at an NCBI website, and the similarity of the ITS gene Sequence of the strain SX0104 and the Sequence of Aspergillus flavus 18S ribosomal RNA gene (Sequence ID: KF221065.1) is 98.65 percent.
The comparison of the calmodulin amplified Sequence in the NCBI website through a BLASTN database shows that the similarity between the calmodulin gene Sequence of the strain SX0104 and the Sequence of Aspergillus flavus calmodulin A gene (Sequence ID: AY974341.1) is 100%.
According to the morphological and molecular biological identification results, the Aspergillus flavus SX0104 is identified as Aspergillus flavus.
Example 2
1. Strain toxin-producing culture
Inoculating the Aspergillus flavus strain SX0104 to be detected to a DG-18 solid culture medium for activation. After culturing for 5 days at 28 +/-1 ℃ in the dark, the obtained aspergillus flavus conidia on the plate are washed by sterilized 0.1% Tween 80 to obtain a conidia suspension.
Conidia suspension concentration was determined using a hemocytometer.
Get oneThe conidia suspension was quantitatively injected into a triangular flask containing 30ml of sterilized liquid Sabouraud's medium to a final concentration of 4X 105One per ml. The flask was placed on a shaker at 28. + -. 1 ℃ and cultured in the dark at 200 rpm.
2. Determination of toxin content in bacterial strains
After 5 days, filtering the mycelium pellet culture solution by using sterile gauze, discarding mycelium pellets, collecting the toxin-producing culture solution, storing the toxin-producing culture solution in a centrifuge tube, standing for 1h, transferring 500 mu l of the toxin-producing culture solution into a 2ml centrifuge tube, adding 500 mu l of methanol, uniformly swirling, centrifuging for 10min at 20000rmp, carefully sucking out supernatant in the tube by using a 1ml syringe (preventing a needle from contacting with the bottom of the tube for precipitation), passing a toxin extracting solution of the syringe through a 0.22 mu m organic system filter membrane, filling the syringe into a sample inlet bottle, and measuring the contents of toxic metabolites such as aflatoxin, variegated aflatoxin and the like by using high performance liquid chromatography-tandem mass spectrometry (HPLC-MS), wherein the chromatographic conditions are as follows: the chromatographic column is C18(100 mm. times.2.1 mm, 3 μm); the column temperature is 40 ℃, the sample injection volume is 2 mu l, and the sample tray temperature is 10 ℃; mobile phase a (hereinafter referred to as a) is methanol to water (V: 5:95), and mobile phase B (hereinafter referred to as B) is methanol to water (V: 5:95), each containing 0.1% formic acid and 10mM ammonium formate at a flow rate of 0.3 ml/min; gradient elution procedure: 85% of A in 0-1 min, 85-50% of A in 1-3 min, 50-30% of A in 3-5 min, 30-0% of A in 5-10 min, 0% of A in 10-13 min, 0% of A in 13-15 min, 0-85% of A in 15-20 min, and 85% of A in 15-20 min; mass spectrum conditions: ESI (+) mode: air curtain air 20 ml/min; the temperature of the atomizer is 450 ℃; atomizer 20 ml/min; auxiliary heating air pressure is 40 ml/min; the quantitative mode is selected ion detection (SIM); analysis software Analyst 1.14; a chromatographic column: waters Symmetry C18Columns (2.1X 150mm, 3.5 μm); the mobile phase A (hereinafter referred to as A) is 10mM acetic acid aqueous solution; the mobile phase B (hereinafter referred to as B) is 100% methanol; the column temperature is 40 ℃; the flow rate is 0.3 ml/min; gradient program: b is 50% in 0min, is increased to 90% in 0-10 min, and is reduced from 90% to 50% in 10-15 min; the results are shown in Table 1.
TABLE 1 toxin production characteristics of Aspergillus flavus SX0104
Note:aAFT is an abbreviation for aflatoxin (aflatoxin B)1Aflatoxins B2Aflatoxin G1And aflatoxin G2Sum of contents of (a);
bST is variegated aflatoxin (Sterigmatocystin);caflatrem is aflatoxin;
dND means not detected.
As can be seen from the experimental data recorded in Table 1, the Aspergillus flavus SX0104 provided by the invention does not produce aflatoxin, aflatoxin and variegated aflatoxin, and is a biocontrol bacterium with high safety.
Example 3
1. Conidial suspension preparation
The Aspergillus flavus strain SX0104 which is not to be tested, the Aspergillus flavus standard strain 3.4408 which is not to be tested and the Aspergillus flavus (Aspergillus flavus) which is to be tested and is separated from different regions, the serial numbers of the two genes are (SCPA-32-12 (Pianan Sichuan), XZCY-24-6 (Tibet corner), LNFX-25-1 (Liaoning funxin), HBHA-129-1 (Hubeihongan), HBYL-12-7 (Hubeiyanghong), HBTS-94-2 (Hebei Tangshan), JXZS-118-9 (Jiangxi camphor tree) and JXZS-69-3 (Jiangxi camphor tree) respectively inoculated in DG-18 solid culture medium for activation, cultured for 5 days under the dark condition of 28 +/-1 ℃, the obtained Aspergillus flavus conidia on the plate were washed with sterilized 0.1% Tween 80 in a 10ml centrifuge tube to obtain a conidia suspension.
The conidia suspension concentration was determined under a microscope using a hemocytometer, and the conidia concentration was diluted to 1X 10 with sterile water6And each ml is ready for use.
2. Competitive inhibition culture
Weigh 10.0g of peanut powder in a sterile petri dish (9cm), set control and treatment groups:
aspergillus flavus standard strain 3.4408 (1X 10) was prepared separately6One/ml), SCPA-32-12 Aspergillus flavus (1X 10)6One/ml), XZCY-24-6 Aspergillus flavus (1X 10)6Per ml), LNFX-25-1 Aspergillus flavus (10)6Seed/ml), HBHA-129-1 Aspergillus flavus (1X 10)6Per ml),HBYL-12-7 Aspergillus flavus (1X 10)6Seed/ml), HBTS-94-2 Aspergillus flavus (1X 10)6One/ml), JXZS-118-9 Aspergillus flavus (1X 10)6One/ml) and JXZS-69-3 Aspergillus flavus (1X 10)6Individuals/ml) of conidia suspension mixed with equal volumes of sterile water (250. mu.l each) and recorded sequentially: control 1 group, control 2 group, control 3 group, control 4 group, control 5 group, control 6 group, control 7 group, control 8 group and control 9 group.
Aspergillus flavus SX0104 (1X 10) was prepared separately6Per ml) of Aspergillus flavus-producing strain 3.4408 and Aspergillus flavus isolated from different peanut producing areas (SCPA-32-12, XZCY-24-6, LNFX-25-1, HBHA-129-1, HBYL-12-7, HBTS-94-2, JXZS-118-9 and JXZS-69-3, 1X 10)6Individuals/ml) equal volume of mixed (250. mu.l each) conidia suspension, sequentially recorded as: treatment 1, treatment 2, treatment 3, treatment 4, treatment 5, treatment 6, treatment 7, treatment 8 and treatment 9.
The mixed conidium suspensions (control 1 group to control 9 group and treatment 1 group to treatment 9 group) are respectively and uniformly inoculated on peanut powder, 3 biological repetitions are carried out for each treatment, and the sample is placed in a constant temperature incubator and continuously cultured in the dark for 14 days at the temperature of 28 +/-1 ℃ and the relative humidity of 90%.
3. Determination of aflatoxin content
After the culture is finished, transferring the peanut powder in the culture dish into a 50ml centrifuge tube, adding 15ml of 70% methanol solution (containing 4% NaCl), uniformly mixing in a vortex manner, placing on an oscillator to shake for 2h, centrifuging at 4500r/min, taking 1ml of supernatant, passing through an organic filter membrane, and detecting aflatoxin B by using High Performance Liquid Chromatography (HPLC)1、B2、G1、G2(AFB1、AFB2、AFG1And AFG2) The total aflatoxin content (AFT) is the sum of the above 4 aflatoxins, and the detection results are shown in Table 2.
HPLC conditions: c18 column (4.6 mm. times.150 mm, 5 μm); the column temperature was 35 ℃; mobile phase: methanol: water (V: V ═ 45: 55); the flow rate is 0.8 mL/min; post-column photochemical derivatization method, photochemical derivatization device 254 nm; fluorescence detector (excitation wavelength 360nm, emission wavelength 440nm), sample volume 10 u l, determination time 22 min.
The toxicity generation inhibition rate calculation formula is as follows: the inhibition rate (%) [1- (treatment group aflatoxin content)/(control group aflatoxin content) ] × 100, formula I.
TABLE 2 inhibition of Aspergillus flavus SX0104 on peanut powder against the production of Aspergillus flavus
As can be seen from Table 2, Aspergillus flavus SX0104 was responsible for AFB of Aspergillus flavus standard strain 3.4408 producing toxin using peanut powder as matrix1The inhibition rate of the produced toxin is 99.54 percent, and the strains AFT and AFB which are separated from different peanut producing areas and produce toxin are separated1、AFB2The toxin production inhibition rates of the aspergillus flavus SX0104 are 77.8-98.2%, 92.5-100% and 10.1-100%, respectively, which shows that the aspergillus flavus SX0104 has the capability of efficiently competitively inhibiting the toxin production of the toxin producing aspergillus flavus, thereby reducing the content of the aflatoxin in the peanuts.
Example 4
1. Conidial suspension preparation
The same as in example 3.
2. Competitive inhibition culture
Selecting mature, full, healthy and normal peanut seeds without insect mouth disease spots and with complete and uniform seed coats.
Soaking peanut seeds in 70% ethanol solution for 2min for surface disinfection, washing with sterile distilled water for 3 times to wash off residual ethanol on the peanut surface, and ensuring that the moisture of the peanut seeds is about 20% within 13 min.
Setting a control group and a treatment group:
aspergillus flavus standard strain 3.4408 (1X 10) was prepared separately6One/ml), XZCY-24-6 Aspergillus flavus (1X 10)6One/ml), JXZS-118-9 Aspergillus flavus (1X 10)6Seed/ml), HBHA-129-1 Aspergillus flavus (1X 10)6One/ml), SCPA-32-12 Aspergillus flavus (1X 10)6Individuals/ml) of conidia suspension mixed with equal volumes of sterile water (12.5 ml each) and recorded sequentially: control 1 group, control 2 group, control 3 group, control 4 group, and control 5 group.
Aspergillus flavus SX0104 (1X 10) was prepared separately6One/ml) of Aspergillus flavus standard strain 3.4408 and Aspergillus flavus producing Aspergillus flavus (XZCY-24-6, JXZS-118-9, HBHA-129-1, SCPA-32-12) (1 × 10)6Pieces/ml) of conidium suspension mixed in equal volumes (12.5 ml each) and designated treatment 1, treatment 2, treatment 3, treatment 4 and treatment 5 in that order.
And (3) putting 10 peanut kernels into the mixed conidium suspension (a control group 1-a control group 5 and a treatment group 1-a treatment group 5) for soaking for 5min, and then clamping the peanut kernels out by using sterile forceps and placing the peanut kernels in a sterile culture dish. 3 biological replicates of each treatment were performed and the samples were placed in a constant temperature incubator and incubated continuously in the dark at 28. + -. 1 ℃ and 90% relative humidity for 7 days.
3. Determination of aflatoxin content
Sterilizing the cultured peanut seeds at high temperature and high pressure (121 ℃, 30min), drying the peanut seeds in a constant-temperature drying oven (110 ℃, 1h), cooling, grinding the peanut seeds into peanut powder by using a coffee machine, weighing 1.0g of peanut powder sample, putting the peanut powder sample into a centrifuge tube, adding 5ml of 70% methanol solution (containing 4% NaCl), uniformly mixing in a vortex manner, placing the peanut powder sample on an oscillator to vibrate for 2h, centrifuging at 4500r/min, passing through an immunoaffinity column and an organic filter membrane, and detecting aflatoxin B by using High Performance Liquid Chromatography (HPLC)1、B2、G1、G2The content of (a). The total aflatoxin Amount (AFT) is the sum of the above 4 aflatoxins, and the detection results are shown in tables 3 and 4.
The chromatographic conditions were as described in example 3.
The formula for calculating the toxicity inhibiting rate is the same as that described in example 3, i.e. formula I.
TABLE 3 inhibition effect of Aspergillus flavus SX0104 on AFT and AFB production of Aspergillus flavus producing toxin on peanut seeds
TABLE 4 Aspergillus flavus SX0104 production of AFG on Aspergillus flavus producing toxin on peanut seed1And AFG2Inhibiting effect
As can be seen from tables 3 and 4, with peanut kernels as the culture medium, Aspergillus flavus SX0104 was responsible for AFT and AFB of Aspergillus flavus standard strain 3.44081、AFB2、AFG1、AFG2The inhibition rates of the production of toxin are respectively 99.2%, 99.3%, 98.8%, 97.0% and 94.4%, and the toxin-producing strains AFT and AFB which are separated from different peanut production areas are subjected to toxin production1、AFB2、AFG1、AFG2The toxin production inhibition rates of the SX0104 strain are respectively 70.8-96.2%, 69.6-95.8%, 69.4-97.6%, 89.5-100% and 66.1-97.6%, which shows that the toxin non-producing strain SX0104 can efficiently compete and inhibit the toxin production capability of the toxin producing aspergillus flavus and remarkably reduce the aflatoxin pollution level in peanuts.
Example 5
Separately preparing conidia with concentration of 1 × 103、1×104、1×105、1×106Aspergillus flavus SX0104 and 1X 10 per ml5A conidia suspension of Aspergillus flavus standard strain 3.4408 was prepared in the same manner as in example 3.
Setting a control group and a treatment group:
preparation of Aspergillus flavus Standard Strain 3.4408 (1X 10)5Individuals/ml) was mixed with equal volume of sterile water (12.5 ml each) to obtain a conidium-containing suspension having a conidium number of 5X 104Aspergillus flavus Standard Strain 3.4408 (control 1 group) at one/ml
Respectively mixing Aspergillus flavus SX0104 and Aspergillus flavus standard strain 3.4408 at different concentrations by volumeMixing at a ratio of 1:1 to obtain conidium concentration ratio of 5 × 1025X 10 pieces/ml4The mixture of Aspergillus flavus SX0104 and Aspergillus flavus standard strain 3.4408 (treatment group 1) at a ratio of conidium concentration of 5 × 10/ml35X 10 pieces/ml4The mixture of Aspergillus flavus SX0104 and Aspergillus flavus standard strain 3.4408 (treated 2 groups) at a ratio of conidium concentration of 5 × 10/ml45X 10 pieces/ml4The mixture of Aspergillus flavus SX0104 and Aspergillus flavus standard strain 3.4408 (treatment 3 groups) at a ratio of conidium concentration of 5 × 10/ml55X 10 pieces/ml4A/ml mixture of Aspergillus flavus SX0104 and standard strain of Aspergillus flavus 3.4408 was prepared (treatment group 4).
Respectively soaking the disinfected and washed peanut seeds in the sterile culture dish for 5min (a control group 1 and a treatment group 1-4), clamping the peanut seeds by using sterile tweezers, placing the peanut seeds in a sterile culture dish, placing the culture dish in a constant-temperature incubator, and continuously culturing the peanut seeds in the dark for 7 days under the conditions of 28 +/-1 ℃ and 90% of relative humidity.
Sterilizing the cultured peanut seeds at high temperature and high pressure (121 ℃, 30min), drying the peanut seeds in a constant-temperature drying oven (110 ℃, 1h), cooling, grinding the peanut seeds into peanut powder by using a coffee machine, weighing 1.0g of peanut powder sample, putting the peanut powder sample into a centrifuge tube, adding 5ml of 70% methanol solution (containing 4% NaCl), uniformly mixing in a vortex manner, placing the peanut powder sample on an oscillator to vibrate for 2h, centrifuging at 4500r/min, passing through an immunoaffinity column and an organic filter membrane, and detecting aflatoxin B by using high performance liquid chromatography1、B2、G1、G2The chromatographic conditions were as described in example 3. The aflatoxin inhibition rate was calculated according to the calculation formula for the toxigenic inhibition rate provided in example 3, and the results are shown in table 5 and fig. 2.
TABLE 5 inhibition of Aspergillus flavus SX0104 concentration on Aspergillus flavus standard strain production of toxin
As is clear from Table 5 and FIG. 2, the inhibition rate of Aspergillus flavus SX0104 against Aspergillus flavus standard strain 3.4408 production of toxin increased with the increase of conidia concentration and was at a lower concentration ratio (treatment group 1, 5X 10)25X 10 pieces/ml4Seed/ml) can reach 52.2 percent of inhibition rate to the aflatoxin content. When the ratio of the concentration of conidium of the Aspergillus flavus SX0104 to the concentration of conidium of the Aspergillus flavus standard strain 3.4408 is 5X 1035X 10 pieces/ml4The inhibition rate of the total amount of aflatoxin in the peanuts is 82.0 percent when the amount is one/ml; concentration ratio of 5X 1045X 10 pieces/ml4The inhibition rate is 91.7% per ml; at a concentration ratio of 5X 1055X 10 pieces/ml4The inhibition rate reaches the highest value of 96.8% at each ml.
Example 6
1. Aflatopsis flavus SX0104 pot culture application method without producing toxin
And (4) transferring the peanut seedlings from the peanut planting field into flowerpots (the peanut seedlings are not damaged, and the roots of the peanut seedlings are covered with soil) for planting. In the flowering and injection period of peanuts, a suspension (1X 10) of aspergillus flavus SX0104 conidia which does not produce toxicity is added5one/mL) at a dosage of 80L/mu (peanut pot area of 0.3 m)24 peanuts per pot, 9ml of peanut consumption per pot) are irrigated at the peanut rhizosphere (test group), the blank control group is sprinkled with the same volume of sterile water, and other daily management test groups are the same as the blank control group. The assay was set up for 3 biological replicates.
2. Collection of peanut samples at harvest stage
Collecting peanut samples in the peanut harvesting period, airing and drying the peanut samples, and detecting the aflatoxin content after the samples are subjected to condensation separation by a quartering method.
3. Cultivation of peanut pod toxigenicity
Harvested and dried peanut pods were placed in petri dishes with 5 pods per petri dish and 3 replicates per sample. Placing into an incubator, culturing at 28 + -1 deg.C and relative humidity of 90%, and detecting aflatoxin content after 20 days.
4. Detection of aflatoxin content in peanuts and toxin production inhibition effect
Drying peanut pods in a constant temperature drying oven (110 deg.C, 1h), cooling, grinding into peanut powder with a coffee machine, weighing 1.0g peanut powder sample, placing into a centrifuge tube, adding 5ml 70% methanol solution (containing 4% NaCl), mixing uniformly by vortex, placing on a vibrator, vibrating for 2h, 4500r & ltwill & gtCentrifuging for min, passing through immunoaffinity column and organic filter membrane, and detecting aflatoxin B by High Performance Liquid Chromatography (HPLC)1、B2、G1、G2The content of (a). The total aflatoxin content (AFT) is the sum of the above 4 aflatoxins.
The chromatographic conditions were as described in example 3.
The toxin detection result shows that aflatoxin is not detected in the harvested and dried peanut control group and the experimental group.
The formula for calculating the toxicity inhibiting rate is the same as that described in example 3, i.e. formula I. The results are shown in Table 6.
TABLE 6 inhibition effect of non-toxigenic Aspergillus flavus SX0104 on peanut aflatoxin content
As shown in Table 6, the Aflatoxin content in the peanut pods of the placebo group was 69.3. mu.g/kg and Aflatoxin B was found to be present in the peanut pods of the placebo group under the toxigenic culture conditions1The content of (A) is 40.3 mu g/kg; the content of aflatoxin in the peanut pods of the test group is 7.6 mug/kg, and the aflatoxin B1The content was 2.6. mu.g/kg. The result shows that the non-toxigenic aspergillus flavus SX0104 has the capabilities of efficiently competing and inhibiting the growth and reproduction of toxigenic bacteria and reducing the proportion of the toxigenic bacteria infecting crops, thereby reducing the mycotoxin pollution content in agricultural products and treating AFT and AFB in peanuts1The inhibition ratios of (A) and (B) were 89.0% and 93.5%, respectively.
Although the present invention has been described with reference to the preferred embodiments, it should be understood that various changes and modifications can be made therein by those skilled in the art without departing from the spirit and scope of the invention as defined in the appended claims.
Sequence listing
<110> institute of oil crop of academy of agricultural sciences of China
<120> aspergillus flavus SX0104 without producing toxicity and application thereof
<160> 6
<170> SIPOSequenceListing 1.0
<210> 1
<211> 724
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
cggagggcca accttttcct ccggcttatt gatatgctta agttcagcgg gtatccctac 60
ctgatccgag gtcaacctgg aaaagattga tttgcgttcg gcaagcgccg gccgggccta 120
cagagcgggt gacaaagccc catacgctcg aggatcggac gcggtgccgc cgctgccttt 180
ggggcccgtc ccccccggag aggggacgac gacccaacac acaagccgtg cttgatgggc 240
agcaatgacg ctcggacagg catgcccccc ggaataccag ggggcgcaat gtgcgttcaa 300
agactcgatg attcacggaa ttctgcaatt cacactagtt atcgcatttc gctgcgttct 360
tcatcgatgc cggaaccaag agatccattg ttgaaagttt taactgattg cgatacaatc 420
aactcagact tcactagatc agacagagtt cgtggtgtct ccggcgggcg cgggcccggg 480
gctgagagcc cccggcggcc atgaatggcg ggcccgccga agcaactaag gtacagtaaa 540
cacgggtggg aggttgggct cgctaggaac cctacactcg gtaatgatcc ttccgcaggt 600
caccctacgg aaggatcatt accgagtgta gggttcctag cgagcccaac ctcccacccg 660
tgtttactgt accttagttg cttcggcggg cccgccattc atggccgacg gtggatcata 720
gtta 724
<210> 2
<211> 811
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
ctcgggacgg cttttttttg ccttccctag tggacaaact cgttgtctaa aatcggtcag 60
tatcaccatt tttacagccg caatgggtct gggtgggctt cgcgaaacgt acagtcaatc 120
cggccgtcac catcctgatc cgcctcgcgg atcatctcat caacttcgtc atcggtaagc 180
ttctcgccga tggaggtcat gacgtgacgc aattcggcag cggagatgaa gccgttgtta 240
tcgcggtcga aaaccttgaa agcctcccgg atctcctcct cagagtcggt atccttcatc 300
tttctcgcca tcatcgtcag gaactctatt tgaacattaa cagctatttc atttatgaat 360
cgtacggaag ccgtctcgta ccagggaagt caatggtgcc attgttgtcg gcgtcaacct 420
cgttaatcat gtcctggagt tccgactcag aggggttttg gcccagagag cgcatgacag 480
tgcccaactc cttggtggtg atctggcctg catatcaagt caattcatca atgccaagac 540
ttcagccgat cgaacagaaa ctggataaaa ttatggcggc taaaacatat tggtcgcatt 600
tgaagggaga atgaataaaa taaactgtac taaccatcac cgtccttgtc ctataggaaa 660
cccaagaaag ccaagtcagc ttgtgttcaa atcatgacga ctaacaaaac caattttcac 720
gaacgacgat aactacttac gaatagggag aaggcctcct tgtactcgga gacctgttct 780
tcagtcaaaa aaaccggcct aaataaaacc c 811
<210> 3
<211> 19
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
tccgtaggtg aacctgcgg 19
<210> 4
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 4
tcctccgctt attgatatgc 20
<210> 5
<211> 19
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 5
aggccgaytc tytgacyga 19
<210> 6
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 6
tttytgcatc atragytgga c 21
Claims (10)
1. A strain of Aspergillus flavus (Aspergillus flavus) SX0104 without producing toxicity is disclosed, wherein the preservation number of the Aspergillus flavus SX0104 is CCTCC NO: M2020520.
2. The Aspergillus flavus SX0104 of claim 1, wherein said Aspergillus flavus SX0104 does not produce aflatoxins, aflatoxins and aflatoxins.
3. The Aspergillus flavus SX0104 of claim 2, wherein said aflatoxin comprises aflatoxin B1Aflatoxins B2Aflatoxin G1And aflatoxin G2。
4. The use of Aspergillus flavus SX0104 as described in any of claims 1-3 for competitive inhibition of aflatoxin production.
5. The use according to claim 4, wherein the toxins include aflatoxins, aflatoxins and aflatoxins.
6. The application of the aspergillus flavus SX0104 as described in any one of claims 1 to 3 in reducing aflatoxin, aflatoxin and aflatoxin pollution in agricultural products.
7. Use according to claim 6, wherein the agricultural products include peanuts, corn and the like.
8. A method for reducing aflatoxin, aflatoxin and aflatoxin contamination in agricultural products, comprising the steps of:
root irrigation treatment is carried out by using the suspension of the aspergillus flavus SX0104 as claimed in any one of claims 1 to 3.
9. The method of claim 8, wherein the suspension of Aspergillus flavus SX0104 has a conidium concentration of 1 x 103～1×106The dosage of the fertilizer is 70-100L/mu.
10. An Aspergillus flavus toxin production inhibitor, which is characterized by comprising the Aspergillus flavus SX0104 as defined in any one of claims 1-3; the concentration of conidium of the aspergillus flavus SX0104 is 1 × 103～1×106One per ml.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110664640.2A CN113355246B (en) | 2021-06-16 | 2021-06-16 | Aspergillus flavus SX0104 without producing toxicity and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110664640.2A CN113355246B (en) | 2021-06-16 | 2021-06-16 | Aspergillus flavus SX0104 without producing toxicity and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN113355246A true CN113355246A (en) | 2021-09-07 |
| CN113355246B CN113355246B (en) | 2022-05-24 |
Family
ID=77534434
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202110664640.2A Active CN113355246B (en) | 2021-06-16 | 2021-06-16 | Aspergillus flavus SX0104 without producing toxicity and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN113355246B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113322189A (en) * | 2021-06-16 | 2021-08-31 | 中国农业科学院油料作物研究所 | Aspergillus flavus HuBXY33 without producing toxicity and application thereof |
Citations (9)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101363006A (en) * | 2008-09-08 | 2009-02-11 | 浙江大学 | Aspergillus flavus strain without producing aspergillus flavus toxin and uses thereof |
| CN103509723A (en) * | 2013-09-25 | 2014-01-15 | 中国农业科学院农产品加工研究所 | Aspergillus flavus producing no aflatoxin and application thereof |
| WO2014191917A1 (en) * | 2013-05-27 | 2014-12-04 | Universita' Cattolica Del Sacro Cuore | Non-toxigenic strain of aspergillus flavus |
| CN105219654A (en) * | 2015-09-25 | 2016-01-06 | 中国农业科学院油料作物研究所 | The aspergillus flavus strain of aflatoxin and the application in aflatoxin pollution of peanuts biological control thereof are not produced in one strain |
| CN107245453A (en) * | 2017-06-02 | 2017-10-13 | 中国农业科学院农产品加工研究所 | One plant is not produced malicious aspergillus flavus and its application in terms of aflatoxin degradation |
| CN109913375A (en) * | 2019-04-03 | 2019-06-21 | 吉林大学 | A kind of Aspergillus flavus of not toxin producing, the composition containing it and its application |
| CN110129212A (en) * | 2019-05-28 | 2019-08-16 | 山东省花生研究所 | One plant of Aspergillus flavus PEAS-10 and application thereof for not producing aflatoxin |
| CN110157626A (en) * | 2019-05-28 | 2019-08-23 | 山东省花生研究所 | One plant of Aspergillus flavus PEASH-12 and application thereof for not producing aflatoxin |
| CN110305796A (en) * | 2019-05-28 | 2019-10-08 | 山东省花生研究所 | One plant of Aspergillus flavus PAF-1 and application thereof for not producing aflatoxin |
-
2021
- 2021-06-16 CN CN202110664640.2A patent/CN113355246B/en active Active
Patent Citations (9)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101363006A (en) * | 2008-09-08 | 2009-02-11 | 浙江大学 | Aspergillus flavus strain without producing aspergillus flavus toxin and uses thereof |
| WO2014191917A1 (en) * | 2013-05-27 | 2014-12-04 | Universita' Cattolica Del Sacro Cuore | Non-toxigenic strain of aspergillus flavus |
| CN103509723A (en) * | 2013-09-25 | 2014-01-15 | 中国农业科学院农产品加工研究所 | Aspergillus flavus producing no aflatoxin and application thereof |
| CN105219654A (en) * | 2015-09-25 | 2016-01-06 | 中国农业科学院油料作物研究所 | The aspergillus flavus strain of aflatoxin and the application in aflatoxin pollution of peanuts biological control thereof are not produced in one strain |
| CN107245453A (en) * | 2017-06-02 | 2017-10-13 | 中国农业科学院农产品加工研究所 | One plant is not produced malicious aspergillus flavus and its application in terms of aflatoxin degradation |
| CN109913375A (en) * | 2019-04-03 | 2019-06-21 | 吉林大学 | A kind of Aspergillus flavus of not toxin producing, the composition containing it and its application |
| CN110129212A (en) * | 2019-05-28 | 2019-08-16 | 山东省花生研究所 | One plant of Aspergillus flavus PEAS-10 and application thereof for not producing aflatoxin |
| CN110157626A (en) * | 2019-05-28 | 2019-08-23 | 山东省花生研究所 | One plant of Aspergillus flavus PEASH-12 and application thereof for not producing aflatoxin |
| CN110305796A (en) * | 2019-05-28 | 2019-10-08 | 山东省花生研究所 | One plant of Aspergillus flavus PAF-1 and application thereof for not producing aflatoxin |
Non-Patent Citations (2)
| Title |
|---|
| 魏丹丹: "不产毒黄曲霉菌不产毒的分子机制及其抑制产毒菌产毒的研究", 《中国优秀博硕士学位论文全文数据库(硕士)工程科技Ⅰ辑》 * |
| 魏丹丹等: "不产毒黄曲霉菌对产毒黄曲霉菌产毒抑制效果分析", 《现代食品科技》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113322189A (en) * | 2021-06-16 | 2021-08-31 | 中国农业科学院油料作物研究所 | Aspergillus flavus HuBXY33 without producing toxicity and application thereof |
| CN113322189B (en) * | 2021-06-16 | 2022-03-11 | 中国农业科学院油料作物研究所 | Aspergillus flavus HuBXY33 without producing toxicity and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN113355246B (en) | 2022-05-24 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN108315267B (en) | Short dense trichoderma GSAAMLSHU-1 and application thereof | |
| CN110527630B (en) | Aleurites lutescens mutant strain bred by ARTP mutagenesis technology and application thereof | |
| CN113388526B (en) | Endophytic fungus FO-R20 and application thereof | |
| CN110093283B (en) | Beauveria bassiana strain and culture method thereof | |
| CN110157625B (en) | Composite microbial inoculum for inhibiting toxigenic aspergillus flavus, preparation method and application thereof | |
| CN112342173B (en) | Bacillus belgii and application thereof | |
| Abdel-Kareem et al. | Novel marine yeast strains as plant growth-promoting agents improve defense in wheat (Triticum aestivum) against Fusarium oxysporum | |
| US12010999B2 (en) | Application of endophytic Falciphora oryzae FO-R20 in controlling panicle blast | |
| CN111733080A (en) | Trichoderma solid preparation, preparation method and application thereof | |
| CN110305796B (en) | Aspergillus flavus PAF-1 incapable of producing aflatoxin and application thereof | |
| CN110129212B (en) | Aspergillus flavus PEAS-10 without producing aflatoxin and application thereof | |
| CN110157626B (en) | Aspergillus flavus PEASH-12 without producing aflatoxin and application thereof | |
| CN113897317B (en) | Bacillus amyloliquefaciens A-1 and application thereof | |
| CN113355246B (en) | Aspergillus flavus SX0104 without producing toxicity and application thereof | |
| JP7500100B2 (en) | Bipolaris yamadai strains, screening and identification methods thereof and their uses | |
| CN107541468B (en) | Trichoderma brachiatum, microbial inoculum, method and application of trichoderma brachiatum in degradation of imazethapyr | |
| CN111139186B (en) | Trichoderma viride with disease prevention and growth promotion functions and application thereof | |
| CN113846020B (en) | Aspergillus flavus XZCY1805 without toxicity production and application thereof | |
| WO2023083372A1 (en) | Microbial agent with functions of preventing and controlling aflatoxin and toxin-producing bacteria thereof and promoting yield increase of crops and application thereof | |
| CN109735457B (en) | Mutant eurotium cristatum and application thereof in preventing and controlling barnyard grass | |
| CN113322189B (en) | Aspergillus flavus HuBXY33 without producing toxicity and application thereof | |
| CN113832038B (en) | Fusarium equisetum (Fusarium equiseti) K2017-696 and application thereof | |
| CN112899170A (en) | Short dense trichoderma and application thereof | |
| CN110669819A (en) | Method for identifying pathogenicity of peanut rot pathogenic fungi | |
| CN117143747B (en) | Plant endophytic fungus epicocconopsis J4-3 and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |