CN107541468B - Trichoderma brachiatum, microbial inoculum, method and application of trichoderma brachiatum in degradation of imazethapyr - Google Patents

Abstract

The invention belongs to the technical field of microorganisms, and particularly discloses trichoderma brevicompactum, a microbial inoculum, a method and application of the trichoderma brevicompactum in degradation of imazethapyr. The preservation number of the trichoderma brevicompactum in the China general microbiological culture collection management center is CGMCC No.14123, and the preservation date is 2017, 05 and 10 days. The trichoderma brevicompactum and trichoderma brevicompactum can effectively degrade imazethapyr in soil, the degradation rate of trichoderma brevicompactum to the imazethapyr in a liquid culture medium reaches 65.3 percent, and the degradation rate of the trichoderma brevicompactum to the imazethapyr in the soil containing 500mg/kg of the imazethapyr reaches 78.38 percent.

Description

Trichoderma brachiatum, microbial inoculum, method and application of trichoderma brachiatum in degradation of imazethapyr

Technical Field

The invention belongs to the technical field of microorganisms, and particularly relates to trichoderma brevicompactum, a microbial inoculum, a method and application in degradation of imazethapyr.

Background

With the extensive use of chemical pesticides, particularly herbicides, problems such as soil pollution, water pollution and inhibition of growth of succeeding crops have come into the fore. Imazethapyr is one of the representatives. Although the imazalil herbicide has the advantages of high efficiency and broad spectrum, the imazalil herbicide has a long residual half-life period, is not easy to decompose, can cause phytotoxicity on succeeding crops after long-term use, and causes a lot of troubles to crop rotation.

Imazethapyr is called one of four king of bean field herbicides, and has unique charm which other herbicides can not replace. Since the nineties, the imidazole acetonicotinate is imported in China and popularized and used in a large area in Heilongjiang province, and the consumption amount is continuously increased. Particularly, because of the low price and good weeding effect of the related domestic herbicides on the market, the imidazotic nicotinic acid herbicide is rapidly popularized and used in northeast regions, and becomes a main herbicide variety in inner Mongolia regions and soybean fields of Heilongjiang province.

Imazethapyr is generally not easy to be degraded chemically or physically in soil, so the residual removal mainly depends on the degradation of microorganisms. At present, bacteria belonging to Propionibacterium, Streptococcus, Arthrobacter, Bacillus, Acidomonas, Alcaligenes, Achromobacter, etc. have been found to have a degrading effect on imazethapyr.

The degradation of the residual pesticide in the soil is accelerated by separating and screening the microorganisms capable of efficiently degrading the imazethapyr residual substances, so that the microbial remediation of the polluted soil is realized, and the method has important significance for maintaining ecological balance, protecting the environment and improving the economic value of a soybean field.

Disclosure of Invention

The trichoderma brevicompactum, the microbial inoculum and the method provided by the invention and the application of the trichoderma brevicompactum in degradation of imazethapyr are provided, and the trichoderma brevicompactum has a good degradation effect on the imazethapyr and a good application prospect.

The first purpose of the invention is to provide Trichoderma brevicompactum, the preservation number of the Trichoderma brevicompactum in the China general microbiological culture collection management center is CGMCC No.14123, the preservation date is 2017, 05 and 10 days, and the Trichoderma brevicompactm is classified and named.

The second purpose of the invention is to provide a trichoderma brevicompactum agent prepared by applying the trichoderma brevicompactum, which is prepared by mixing trichoderma brevicompactum conidium powder, humic acid and vermiculite according to the proportion of 10: 1-5: 85-90, and adding water until the water content is 10-15% to obtain the trichoderma brevicompactum.

The third purpose of the invention is to provide a preparation method of the trichoderma brevicompactum microbial inoculum, which comprises the following steps:

(1) preparing a first-level strain: inoculating original strains of short dense trichoderma on an MEA (membrane electrode assembly) flat plate, culturing in an incubator at 28 ℃, and obtaining primary strains after the short dense trichoderma spores are full of the primary strains;

(2) preparing a secondary strain: inoculating the first-stage strain into a triangular flask filled with MEA liquid culture medium, culturing at 28 deg.C and 160r/min under shaking for 7 days;

(3) solid fermentation: preparing a solid culture medium, wherein the solid culture medium comprises the following components in percentage by mass: corn grit: rice hull: wheat number 3: 20: 15, adding water until the water content of the solid culture medium is 50%; inoculating the secondary strain, wherein the inoculation amount is 7g of secondary strain per 100g of solid culture medium; fermenting and culturing for 7 days at 28 deg.C in a greenhouse;

(4) taking the cultured solid culture medium, and drying in a drying oven at 30 ℃; grinding by a grinder to prepare short dense trichoderma conidium powder, adding sterile water which is 8 times of the weight of the conidium powder into the short dense trichoderma conidium powder, and uniformly mixing to prepare spore liquid for later use;

(5) crushing vermiculite, controlling the fineness of the crushed vermiculite to be 40-60 meshes, adding water to adjust the water content to be 8-12%, adding humic acid into the vermiculite, uniformly blending to obtain a matrix mixture, uniformly spraying the spore liquid in the step (4) onto the matrix mixture, and uniformly mixing, wherein the weight ratio of the conidium powder of the trichoderma brevicompactum to the humic acid to the vermiculite is 10: 1-5: 85-90, and finally drying at 30 ℃ until the water content is 10-15% to obtain the trichoderma brevicompactum microbial inoculum.

The fourth purpose of the invention is to provide an application of the trichoderma brevicompactum in degrading imazethapyr in soil.

The fifth purpose of the invention is to provide an application of the trichoderma brevicompactum microbial agent in degrading imazethapyr in soil.

Compared with the prior art, the trichoderma brevicompactum, the microbial inoculum, the method and the application in degrading imazethapyr provided by the invention have the following beneficial effects:

the degradation of residual pesticides in soil is accelerated by separating and screening the microorganism trichoderma brevicompactum pf3 capable of efficiently degrading imazethapyr residual substances, so that the microbial remediation of the polluted soil is realized, and the method has important significance for maintaining ecological balance, protecting the environment and improving the economic value of a soybean field. The trichoderma brevicompactum and trichoderma brevicompactum can effectively degrade imazethapyr in soil, the degradation rate of trichoderma brevicompactum to the imazethapyr in a liquid culture medium reaches 65.3 percent, and the degradation rate of the trichoderma brevicompactum to the imazethapyr in the soil containing 500mg/kg of the imazethapyr reaches 78.38 percent.

Drawings

FIG. 1 is a control liquid chromatography chromatogram assay chromatogram for pf3 screening;

FIG. 2 is a high performance liquid chromatogram of the medium after degradation of pf 3;

FIG. 3 is a colony map of pf 3;

FIG. 4 is a pf3 microscopic spore structure;

FIG. 5 shows the effect of degradation of different imazethapyr initial concentrations;

FIG. 6 is a high performance liquid chromatogram of initial concentration of imazethapyr in experiment group C;

FIG. 7 is a high performance liquid chromatogram of imazethapyr concentration after the experiment of experiment group C.

Biological material preservation information description

Trichoderma brachiatum has been deposited in China general microbiological culture Collection center (CGMCC) at 10.05.2017 with the deposition number of CGMCC No.14123, No. 3 Homew No.1, Kyowa, Yangyo, China academy of sciences, zip code 100101, and is classified and named as Trichoderma brachiatum.

Detailed Description

The invention is described in detail below with reference to the figures and the specific embodiments, but the invention should not be construed as being limited thereto. The experimental methods in the following examples are conventional methods unless otherwise specified, and materials, reagents and the like used in the following examples are commercially available unless otherwise specified.

Example 1

1. Isolation of Trichoderma brevicompactum strains

Removing fallen leaves, surface soil and the like before collecting a soil sample, collecting soil 2-10cm away from the ground as a sample, collecting 5 sample points with each part being not less than 50g according to a biological statistical method, filling the soil sample into a sealed bag, and storing the sample in a refrigerator at 4 ℃ for later use.

Respectively weighing 10g of soil sample to be measured, placing the soil sample in an oven to be dried at 105 ℃ until the weight is constant, weighing the mass after cooling, and calculating the water content of the soil.

The soil water content is (wet soil mass-dry soil mass)/wet soil mass x 100%

Weighing phaseWhen 5g (based on the dry weight of the soil, not counting the water content) of soil sample is put into 45ml of sterile water, 160r/min of glass beads are added, and the mixture is shaken for 30min to prepare the soil leaching solution. Transferring 1ml of the obtained soil leaching solution into a test tube containing 9ml of sterile water, diluting by 10 times, and sucking uniformly; transferring 1ml of 10-fold diluent into another test tube containing 9ml of sterile water, and diluting 10²Doubling, sucking and beating uniformly; circulating operation until bacterial liquid is diluted to 10³And (4) doubling. Will dilute to 10²And 10³Mu.l of the multiplied bacterial solution was transferred to a plate containing Bengal red medium and spread evenly with a spreader. Sealing, and culturing in 25 deg.C constant temperature incubator.

After 3-7 days of culture, each colony is picked up by an inoculating needle to be purified on a PDA culture medium. Sealing, and culturing in a constant-temperature incubator at 25 ℃. After 3-7 days, single colonies were streaked and purified until purified single colonies were obtained. Storing in slant test tube made of PDA culture medium, and storing in refrigerator at 4 deg.C.

Preparing fungus cakes from the separated and purified fungus strains by using a puncher, respectively inoculating 10 fungus cakes of each strain into conical flasks filled with 100ml of PD culture medium, and performing shake culture at 25 ℃ at 160r/min for 7 days to obtain enriched bacterial liquid.

Adding 10ml of the enriched bacterial liquid into a 250ml conical flask containing 90ml of an inorganic salt culture medium (the imazethapyr is the only carbon source) with the imazethapyr content of 100mg/kg, and taking the medium (the imazethapyr is the only carbon source) which is free of any bacterial strain and is added with 10ml of sterile water and has the imazethapyr content of 100mg/kg as a blank control. The Erlenmeyer flask was then placed on a shaker at 25 ℃ and a rotation speed of 160r/min for 7 days. And (5) carrying out high performance liquid chromatography detection on the shake culture solution.

Through strain separation and degradation rate detection, 14 strains of fungi are obtained by separating soil samples at a water outlet of a pharmaceutical factory in Heilongjiang province and are respectively named as pf 1-14. Wherein, the highest degradation efficiency in the fungi is pf3, FIG. 1 is a control group liquid chromatography detection chromatogram, and FIG. 2 is a high performance liquid chromatography chromatogram of the culture medium after pf3 is degraded. As can be seen from comparison of FIGS. 1-2, the content of imazethapyr in the culture medium after degradation by pf3 was significantly reduced, with a degradation rate of 45.93%.

Acclimatization culture of pf3

Inoculating the enriched bacterial solution into a 250ml conical flask containing 90ml of an inorganic salt culture medium (the imazethapyr is the only carbon source) with the imazethapyr content of 100mg/kg, carrying out shake culture at 25 ℃ and 160r/min for 72h, transferring 10ml of the culture solution into a 250ml conical flask containing 90ml of an inorganic salt culture medium (the imazethapyr is the only carbon source) with the imazethapyr content of 200mg/kg, increasing the concentration of the imazethapyr to 300mg/L, and carrying out shake culture at 25 ℃ and 160r/min for 72 h. The steps are operated circularly until the concentration of the imazethapyr is 500 mg/kg.

10ml of bacterial suspension in a culture medium with the concentration of the imazethapyr being 500mg/kg are respectively inoculated into 90ml of basic salt carbon source-free culture medium with the known concentration of the imazethapyr being 100 mg/L. Inorganic salt medium without any added strain (imazethapyr is the sole carbon source) was used as a blank. Shaking-culturing at 25 deg.C and 160r/min for 7 days. Then, the degradation rate after domestication is 65.30% and is improved by nearly 20% by detecting and calculating by using a high performance liquid chromatography. This indicates that repeated stimulation of the degrading bacteria helps to enhance the degradation of imazethapyr. The preservation number of the pf3 after acclimatization culture is CGMCC No. 14123.

3. Identification of high-efficiency degrading bacteria

Molecular method identification:

after domesticated pf3 is shake-cultured for 7 days, 8 layers of sterile gauze are used for filtering bacteria liquid to obtain hyphae, then a DNA quick Plant System rapid Plant genome DNA extraction System (non-centrifugal column type) kit method is used for extracting fungus total DNA, fungus universal primers ITS1 and ITS4 are used for carrying out PCR amplification on ITS sequences, agarose gel electrophoresis detection is carried out, then PCR products are sent to Shanghai biological company for bidirectional sequencing, the obtained sequencing result is as follows, and comparison is carried out on NCBI nets to obtain the identification result that fungus strain pf3 is Trichoderma brachiocephalum.

The ITS sequence of pf3 is as follows:

GCGAATTGGGTTCCTCCAACCCCATGTGACGTTACCAAACTGTTGCCTCGGCGGGATTTCTGCCCCGGGCGCGTCGCAGCCCCGGACCAAGGCGCCCGCCGGAGGACCAATTTACAAACTCTTTTGTATATCCCATCGCGGATTCTTTACATTCTGAGCTTTCTCGGCGCTCCTAGCGAGCGTTTCGAAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTCCGAGCGTCATTTCAACCCTCGAACCCCTCCGGGGGGTCGGCGTTGGGGATCGGCACTTACCTGCCGGCCCCGAAATACAGTGGCGGTCTCGCCGCAGCCTCTCCTGCGCAGTAGTTTGCACACTCGCACCGGGAGCGCGGCGCGTCCACGGCCGTAAAACAACCCAAACTTCTGAAATGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAA

strain morphology identification of pf 3:

taking out the culture dish in a constant temperature incubator at 25 ℃ for observing the characteristics of bacterial colonies, picking out the mycelium of the fungus under a dissecting mirror to prepare a temporary slide, and placing the temporary slide under a microscope for observation. Mainly observe the hypha type, spore-forming structure, carrier and spore form of each fungus, and then combine the relevant information of the fungus taxonomy to identify.

According to the morphological observation shown in FIG. 3 and FIG. 4, FIG. 3 is a colony map of pf3, and pf3 has a colony diameter of 6-8cm, spider-like shape, white color, under scattered light, green color due to sporulation, and colorless back surface, when cultured on MEA medium at 25 ℃ for 5 days. FIG. 4 shows pf3 microscopic spore structure, multi-branched tree-like conidiophores are colorless, and relatively loose flora is formed. 3-5 side-growing phialides are formed in a rotation manner, the basal part of the phialides is slightly constricted, the middle part of the phialides is expanded, the phialides are gradually narrowed upwards to form a bottleneck, and the diameter is 4-6 multiplied by 2-3 mu m. The phialides spores are spherical conidium heads, the conidium is nearly spherical or inverted egg-shaped, the wall is smooth and green, and the diameter is 1.9-3.2 mu m multiplied by 2.2-2.7 mu m. Thus, the fungal strain pf3 conforms to the morphological characteristics of trichoderma brevicompactum.

4. Preparation of short dense trichoderma

The bacterial fertilizer for degrading imazethapyr is prepared by using pf3, and the specific steps are as follows:

(1) preparing a first-level strain: inoculating original strains of the short dense trichoderma on an MEA (membrane electrode assembly) flat plate, culturing in an incubator at 28 ℃, and obtaining primary strains after the culture dish is full of short dense trichoderma spores;

(2) preparing a secondary strain: inoculating the first-stage strain into a triangular flask filled with MEA liquid culture medium, culturing at 28 deg.C and 160r/min under shaking for 7 days;

(3) solid fermentation: preparing a solid culture medium, wherein the solid culture medium comprises the following components in percentage by mass: corn grit: rice hull: wheat number 3: 20: 15, adding water until the water content of the solid culture medium is 50%; inoculating the second-level strain according to the inoculation amount of 7% (w/w); fermenting and culturing in a greenhouse at 28 ℃ for 7 days until the solid culture medium is fully loaded with short-density trichoderma conidia;

(4) taking out the solid culture medium fully loaded with the short dense trichoderma conidium, and putting the solid culture medium into a drying oven at 30 ℃ for drying; grinding with a universal grinder to obtain short-density trichoderma conidium powder, adding sterile water with the weight 8 times that of the conidium powder into the short-density trichoderma conidium powder, and mixing uniformly to obtain spore liquid for later use;

(5) crushing vermiculite (serving as a carrier), controlling the fineness of the vermiculite to be 40-60 meshes, adding water to adjust the water content to be 8-12%, adding an ultraviolet protective agent humic acid into the vermiculite carrier, uniformly blending to obtain a matrix mixture for later use, uniformly spraying the spore liquid in the step (4) onto the matrix mixture, and uniformly mixing, wherein the weight ratio of conidium powder of trichoderma brevicompactum, humic acid and vermiculite is 10: 1-5: 85-90, finally drying at 30 ℃ until the water content is 10-15%, sealing, packaging and storing to obtain the short dense trichoderma fungicide.

It should be noted that the moisture content described in the present specification and claims refers to the content of moisture by mass percentage.

5. Experiment of potting

200g of the prepared trichoderma brevicompactum microbial inoculum is uniformly stirred and mixed into 28kg of black soil which is not applied with imazethapyr, the uniformly mixed soil is divided into 3 parts on average, and different amounts of Douqianle (5%, w/w, imazethapyr aqua) are added to prepare the polluted soil with the content of the imazethapyr of 100mg/kg, 300mg/kg and 500mg/kg respectively. 3kg of soil with different imazethapyr concentrations are filled into flowerpots with a specification of 75 multiplied by 60 multiplied by 30cm and provided with pot supports (for preventing the imazethapyr from losing). Imazethapyr also has a certain inhibiting effect on soybeans, and weak and dead seedlings are easy to occur, so that 10 soybeans are planted (full soybean seeds are selected, soaked for 5 hours in warm water at 40 ℃, accelerated germination is carried out in the dark at 25 ℃, and seeds with consistent germination are selected and sown in a seedling container after the seeds germinate). The experimental set-up is as in table 1, with 3 replicates per experimental group.

Table 1 brief table of experimental design of soils with different imazethapyr concentrations

And (3) after planting and culturing the three-assembly pots for 30 days, respectively taking soil samples of the pots by using a five-point sampling method, drying and grinding the soil samples, sieving the ground soil samples with a 20-mesh sieve, performing liquid chromatography sample pretreatment, detecting the content of imazethapyr by using a high performance liquid chromatograph, and calculating the degradation rate. The obtained results are shown in FIG. 5. The imidazole acetic niacin can be effectively degraded before and after experiments. It can be seen from the figure that A, B, C experimental group soil has degradation effect when the initial concentration of imazethapyr is 100mg/kg, 300mg/kg and 500mg/kg respectively. In the experiment group C, when the initial concentration of the imazethapyr is 500mg/kg, the degradation rate is 78.38 percent, and the degradation rate is the highest. FIG. 6 is the high performance liquid chromatogram of initial concentration of imazethapyr in experiment group C, and FIG. 7 is the high performance liquid chromatogram of concentration of imazethapyr after experiment in experiment group C. It can be seen that the concentration of imazethapyr changes obviously before and after the trichoderma brevicompactum is degraded.

Most importantly, the residue of the imazethapyr in the farmland is not as high as 500 mg/kg. The degradation rate at an initial concentration of imazethapyr of 100mg/kg was 72.68%. The short dense trichoderma preparation has effective degradation effect on imazethapyr residue in soil, and has practical value for degrading the imazethapyr residue in farmland and avoiding the phytotoxicity of afterculture crops.

While preferred embodiments of the present invention have been described, additional variations and modifications in those embodiments may occur to those skilled in the art once they learn of the basic inventive concepts. Therefore, it is intended that the appended claims be interpreted as including preferred embodiments and all such alterations and modifications as fall within the scope of the invention.

It will be apparent to those skilled in the art that various changes and modifications may be made in the present invention without departing from the spirit and scope of the invention. Thus, if such modifications and variations of the present invention fall within the scope of the claims of the present invention and their equivalents, the present invention is also intended to include such modifications and variations.

Claims (5)

1. The Trichoderma brevicompactum is characterized in that the preservation number of the Trichoderma brevicompactum in China general microbiological culture collection center is CGMCC No.14123, the preservation date is 2017, 05 and 10 days, and the Trichoderma brevicompactum is named as Trichoderma brevicompactum in a classified mode and is used for degrading imazethapyr.

2. The trichoderma brevicompactum agent prepared from trichoderma brevicompactum of claim 1 is characterized by comprising conidium powder of trichoderma brevicompactum, humic acid and vermiculite according to the ratio of 10: 1-5: 85-90, and adding water until the water content is 10-15% to obtain the trichoderma brevicompactum.

3. The method for preparing trichoderma brevicompactum according to claim 2, comprising the following steps:

(1) preparing a first-level strain: inoculating original strains of short dense trichoderma on an MEA (membrane electrode assembly) flat plate, culturing in an incubator at 28 ℃, and obtaining primary strains after the short dense trichoderma spores are full of the primary strains;

(2) preparing a secondary strain: inoculating the first-stage strain into a triangular flask filled with MEA liquid culture medium, culturing at 28 deg.C and 160r/min under shaking for 7 days;

(3) solid fermentation: preparing a solid culture medium, wherein the solid culture medium comprises the following components in percentage by mass: corn grit: rice hull: wheat number 3: 20: 15, adding water until the water content of the solid culture medium is 50%; inoculating the secondary strain, wherein the inoculation amount is 7g of secondary strain per 100g of solid culture medium; fermenting and culturing for 7 days at 28 deg.C in a greenhouse;

(4) taking the cultured solid culture medium, and drying in a drying oven at 30 ℃; grinding by a grinder to prepare short dense trichoderma conidium powder, adding sterile water which is 8 times of the weight of the conidium powder into the short dense trichoderma conidium powder, and uniformly mixing to prepare spore liquid for later use;

(5) crushing vermiculite, controlling the fineness of the crushed vermiculite to be 40-60 meshes, adding water to adjust the water content to be 8-12%, adding humic acid into the vermiculite, uniformly blending to obtain a matrix mixture, uniformly spraying the spore liquid in the step (4) onto the matrix mixture, and uniformly mixing, wherein the weight ratio of the conidium powder of the trichoderma brevicompactum to the humic acid to the vermiculite is 10: 1-5: 85-90, and finally drying at 30 ℃ until the water content is 10-15% to obtain the trichoderma brevicompactum microbial inoculum.

4. The use of trichoderma brevicompactum according to claim 1 for degrading imazethapyr in soil.

5. The use of trichoderma brevicompactum agent of claim 2 for degrading imazethapyr in soil.