CN113337607A

CN113337607A - Molecular marker for detecting or evaluating curative effect of liver cancer and application thereof

Info

Publication number: CN113337607A
Application number: CN202110720315.3A
Authority: CN
Inventors: 缪辉来; 梁浩凡; 叶志荣; 程海兵; 杨子毅
Original assignee: Second Affiliated Hospital Of Guangdong Medical University; LIAOBU HOSPITAL OF DONGGUAN
Current assignee: Second Affiliated Hospital Of Guangdong Medical University; LIAOBU HOSPITAL OF DONGGUAN
Priority date: 2021-06-28
Filing date: 2021-06-28
Publication date: 2021-09-03
Anticipated expiration: 2041-06-28
Also published as: CN115851931A; CN116042819A; CN115261480A; CN113337607B

Abstract

The invention discloses a molecular marker for detecting or evaluating the curative effect of liver cancer and application thereof, wherein the molecular marker comprises at least one of hsa _ circ _0002490, hsa _ circ _0005197 and hsa _ circ _0101802, and the nucleic acid sequence of hsa _ circ _0002490 is shown as SEQ ID NO: 1; the nucleic acid sequence of hsa _ circ _0005197 is shown in SEQ ID NO 2; the nucleic acid sequence of hsa _ circ _0101802 is shown in SEQ ID NO 3. The molecular marker has a correlation with liver cancer, can quickly, simply and accurately realize auxiliary diagnosis of the liver cancer, and provides a basis for diagnosis of the liver cancer and selection of treatment effect evaluation indexes; in addition, the molecular marker can also be used as a liver cancer drug treatment target.

Description

Molecular marker for detecting or evaluating curative effect of liver cancer and application thereof

Technical Field

The invention relates to the technical field of biology, in particular to a molecular marker for detecting or evaluating curative effect of liver cancer and application thereof.

Background

The Primary Liver Cancer (PLC) is listed as the seventh most common cancer in the world, wherein hepatocellular carcinoma (HCC) caused by malignant transformation of liver cells accounts for about 75 percent of the Primary Liver Cancer (PLC). Intrahepatic cholangiocarcinoma is another major PLC, originating in bile duct cells, accounting for 12-15% of liver malignant tumors. Due to the aggressiveness of these liver malignant tumors, primary liver cancer has become the fourth most common cause of cancer death. It is statistically estimated that more than 90% of HCC cases occur in the context of chronic liver disease, and cirrhosis of the liver by any etiology is a high risk factor for HCC, including chronic alcohol consumption, non-alcoholic steatohepatitis (NASH) associated with diabetes or obesity, and HBV or HCV infection. HCC is the leading cause of death in patients with cirrhosis, with an incidence of HCC of 1-6% per year. The risk factors for liver cancer are currently shifting due to improvements in public health measures, the prevalence of chronic HBV and HCV infection is decreasing in many regions, and diseases associated with obesity, diabetes, and metabolic syndrome have become major factors that contribute to an increase in the incidence of liver cancer in many low-risk countries. Some socio-demographic characteristics are associated with liver cancer, where aging is a strong risk factor and reports indicate that the highest incidence of the relevant population is those over the age of 70. In addition, liver cancer has a strong male dominance (male-female ratio of 2-3: 1), which may be related to the accumulation of risk factors and sex hormone differences in men. Despite advances in diagnosis, surgical techniques and liver transplantation, long-term survival of liver cancer patients has remained poor to date. The relevant data show that the prognosis of liver cancer is closely related to the stage of disease progression: after the very early (Barcelona stage 0, BCLC 0) and early (BCLC A) liver cancer patients receive active surgical treatment, the 5-year survival rate is respectively close to 90 percent and 50 to 70 percent; however, the five-year survival rate of the middle and late stage liver cancer patients is only 14%. Therefore, effective early diagnosis and early treatment measures of liver cancer are one of the key factors for improving the prognosis of liver cancer patients.

Although early diagnosis and early treatment of liver cancer are necessary, in clinical practice, early diagnosis still faces a number of difficult dilemmas. First, early liver cancer lacks specific symptoms, resulting in low hospitalization rates for patients with early liver cancer. About 2/3 liver cancer patients are diagnosed as advanced liver cancer for the first time, and the chance of surgical treatment is lost; secondly, the existing liver cancer screening means in clinic has defects. The diagnosis efficiency of liver ultrasound is affected by factors such as tumor size, subjective judgment of an operator, review frequency, instrument accuracy and the like, so that only less than half of early liver cancer patients can be found in the ultrasound examination. Alpha-fetoprotein (AFP) is a liver cancer marker widely used in clinic, but the detection rate of early liver cancer is only 66%. Although most HCCs have characteristic features in imaging, about 10% of tumors (up to 30% of tumors up to 1-2cm in diameter) have atypical manifestations, lacking the imaging characteristics of HCC. In addition, the prognosis after radical resection of liver cancer is still unsatisfactory due to the high incidence of postoperative recurrence. Identification of early diagnostic and prognostic biomarkers for metastatic liver cancer is therefore crucial to overcome these ongoing challenges for human health.

Disclosure of Invention

The invention aims to provide a molecular marker for detecting or evaluating the curative effect of liver cancer and application thereof, and the molecular marker can quickly, simply and accurately realize auxiliary diagnosis of the liver cancer.

In order to achieve the above purpose of the present invention, the following technical solutions are adopted:

the invention provides a molecular marker for detecting or evaluating the curative effect of liver cancer, which is characterized by comprising at least one of hsa _ circ _0002490, hsa _ circ _0005197 and hsa _ circ _0101802, wherein the nucleic acid sequence of hsa _ circ _0002490 is shown as SEQ ID NO. 1; the nucleic acid sequence of hsa _ circ _0005197 is shown in SEQ ID NO 2; the nucleic acid sequence of hsa _ circ _0101802 is shown in SEQ ID NO 3.

The second aspect of the invention provides an application of the molecular marker in preparation of a liver cancer detection or treatment effect evaluation product.

Preferably, the product includes, but is not limited to, a kit.

The third aspect of the present invention provides a product for detecting or evaluating the therapeutic effect of liver cancer, wherein the product comprises an amplification primer for amplifying cDNA complementary to a molecular marker;

the molecular marker comprises at least one of hsa _ circ _0002490, hsa _ circ _0005197 and hsa _ circ _0101802, and the nucleic acid sequence of hsa _ circ _0002490 is shown as SEQ ID NO: 1; the nucleic acid sequence of hsa _ circ _0005197 is shown in SEQ ID NO 2; the nucleic acid sequence of hsa _ circ _0101802 is shown in SEQ ID NO 3.

Preferably, the product further comprises an RNA extraction reagent.

Preferably, the upstream amplification primer and the downstream amplification primer corresponding to hsa _ circ _0002490 are shown as SEQ ID NO. 4 and SEQ ID NO. 5 respectively;

the upstream amplification primer and the downstream amplification primer corresponding to hsa _ circ _0005197 are respectively shown as SEQ ID NO. 6 and SEQ ID NO. 7;

the upstream amplification primer and the downstream amplification primer corresponding to hsa _ circ _0101802 are shown as SEQ ID NO. 8 and SEQ ID NO. 9 respectively.

The fourth aspect of the invention also provides an application of SiRNA of hsa _ circ _0005197 and/or hsa _ circ _0101802 in preparing a medicament for treating liver cancer.

Preferably, the SiRNA sequence of hsa _ circ _0101802 is as follows:

the sequence of the sense strand is shown as SEQ ID NO. 10, and the sequence of the antisense strand is shown as SEQ ID NO. 11; or, the sequence of the sense strand is shown as SEQ ID NO. 12, and the sequence of the antisense strand is shown as SEQ ID NO. 13.

In a fifth aspect, the invention provides a medicament comprising sirnas hsa _ circ _0005197 and/or hsa _ circ _0101802 for use in the treatment of liver cancer.

Preferably, the SiRNA sequence of hsa _ circ _0101802 is as follows:

Compared with the prior art, the invention has the beneficial effects that at least:

the molecular marker has a correlation with liver cancer, can quickly, simply and accurately realize auxiliary diagnosis of the liver cancer, and provides a basis for diagnosis of the liver cancer and selection of treatment effect evaluation indexes; in addition, the molecular marker can also be used as a liver cancer drug treatment target.

The amplification primer adopted by the invention has excellent specificity, can stably amplify the molecular marker, and improves the detection accuracy of the molecular marker.

Drawings

In order to more clearly illustrate the detailed description of the invention or the technical solutions in the prior art, the drawings that are needed in the detailed description of the invention or the prior art will be briefly described below. Throughout the drawings, like elements or portions are generally identified by like reference numerals. In the drawings, elements or portions are not necessarily drawn to scale.

FIG. 1 is a bar graph showing the expression level of circPNN in liver cancer cells in example 1 of the present invention;

FIG. 2 is a bar graph showing the expression level of circPTPN12 in hepatoma cells in example 1 of the present invention;

FIG. 3 is a bar graph showing the expression level of circFCHO2 in hepatoma cells in example 1 of the present invention;

FIG. 4 shows the results of successful transfection observed under a fluorescence microscope after silencing of CircpNN expression in example 2 of the present invention;

FIG. 5 is a bar graph of PCR assay of the expression level of CircPNN after silencing of CircPNN expression in example 2 of the present invention;

FIG. 6 is a bar graph of cell proliferative capacity following silencing of CircPNN expression in example 2 of the invention;

FIG. 7 shows the result of the flow analysis of SK-HEP-1 apoptosis after silencing the expression of CircPNN in example 2;

FIG. 8 is a bar graph of the rate of apoptosis of SK-HEP-1 cells following silencing of CircPNN expression in example 2 of the invention;

FIG. 9 shows the results of the Western Blot detection of Caspase-3 protein in example 2 of the present invention;

FIG. 10 is a bar graph of the detection of Caspase-3 protein expression level by Western Blot in example 2 of the present invention.

Detailed Description

The following describes embodiments of the present invention in detail with reference to the following embodiments. The following examples are only for illustrating the technical solutions of the present invention more clearly, and therefore are only examples, and the protection scope of the present invention is not limited thereby.

It is to be noted that, unless otherwise specified, technical or scientific terms used herein shall have the ordinary meaning as understood by those skilled in the art to which the invention pertains.

At present, the diagnosis efficiency of liver ultrasound is influenced by factors such as tumor size, subjective judgment of operators, review frequency, instrument precision and the like, so that only less than half of early liver cancer patients can be found in the ultrasound examination. Alpha-fetoprotein (AFP) is a liver cancer marker widely used in clinic, but the detection rate of early liver cancer is only 66%. Although most HCCs have characteristic features in imaging, about 10% of tumors (up to 30% of tumors up to 1-2cm in diameter) have atypical manifestations, lacking the imaging characteristics of HCC. In addition, the prognosis after radical resection of liver cancer is still unsatisfactory due to the high incidence of postoperative recurrence. Identification of early diagnostic and prognostic biomarkers for metastatic liver cancer is therefore crucial to overcome these ongoing challenges for human health.

In view of the above, the present invention provides a molecular marker for detecting or evaluating the therapeutic effect of liver cancer, wherein the molecular marker comprises at least one of hsa _ circ _0002490, hsa _ circ _0005197 and hsa _ circ _0101802,

wherein, the nucleic acid sequence of hsa _ circ _0002490 is shown in SEQ ID NO:1, and specifically comprises:

GUGUGUCACGGGGUCCCAGCCCUGUCAGCCUUGGAAAUCAGGAUACCUUACCUGUGGCAGUUGCCCUUACAGAAUCUGUUAAUGCCUACUUUAAAGGAGCAGAUCCCACCAAGUGUAUUGUGAAGAUCACUGGUGAUAUGACAAUGUCAUUUCCAAGUGGAAUUAUUAAAGUCUUCACCAGCAAUCCAACUCCAGCUGUGUUGUGCUUCAGGGUGAAAAAUAUCAGCAGACUAGAGCAGAUUCUUCCAAAUGCACAGCUUGUGUUCAG；

the nucleic acid sequence of hsa _ circ _0005197 is shown in SEQ ID NO:2, and specifically comprises:

UUGAUCACAGCCGAGUUAAAUUGACAUUAAAGACUCCUUCACAAGAUUCAGACUAUAUCAAUGCAAAUUUUAUAAAGGGCGUCUAUGGGCCAAAAGCAUAUGUAGCAACUCAAGGACCUUUAGCAAAUACAGUAAUAGAUUUUUGGAGGAUGAUAUGGGAGUAUAAUGUUGUGAUCAUUGUAAUGGCCUGCCGAGAAUUUGAGAUGGGAAGGAAAAAAUGUGAGCGCUAUUGGCCUUUGUAUGGAGAAGACCCCAUAACGUUUGCACCAUUUAAAAUUUCUUGUGAGGAUGAACAAGCAAGAACAGACUACUUCAUCAGGACACUCUUACUUGAAUUUCAAAAU；

the nucleic acid sequence of hsa _ circ _0101802 is shown in SEQ ID NO:3, and specifically comprises:

CAAAAGCGGCGCCAGGAAAUUGAACAAAAACUUGAAGUUCAGGCAGAAGAAGAGAGAAAGCAGGUUGAAAAUGAAAGGAGAGAACUGUUUGAAGAGAGGCGUGCUAAACAGACAGAACUGCGGCUUUUGGAACAGAAAGUUGAGCUUGCGCAGCUGCAAGAAGAAUGGAAUGAACAUAAUGCCAAAAUAAUUAAAUAUAUAAGAACUAAGACAAAGCCCCAUUUGUUUUAUAUUCCUGGAAGAAUGUGUCCAGCUACCCAAAAACUAAUAGAAGAGUCACAGAGAAAAAUGAACG。

the molecular marker has a correlation with liver cancer, wherein hsa _ circ _0005197 and hsa _ circ _0101802 are positively correlated with liver cancer, and hsa _ circ _0002490 is negatively correlated with liver cancer; the molecular marker can quickly, simply and accurately realize the auxiliary diagnosis of the liver cancer and provide a basis for the diagnosis of the liver cancer and the selection of the evaluation index of the curative effect; in addition, the molecular marker can also be used as a liver cancer drug treatment target.

The invention also provides application of the molecular marker in preparation of liver cancer detection or curative effect evaluation products.

Further, the above products include, but are not limited to, kits.

In another embodiment, the present invention provides a product for detecting or evaluating the efficacy of liver cancer, which comprises an amplification primer for amplifying cDNA complementary to a molecular marker;

the molecular marker comprises at least one of hsa _ circ _0002490, hsa _ circ _0005197 and hsa _ circ _0101802, wherein the nucleic acid sequence of hsa _ circ _0002490 is shown as SEQ ID NO: 1.

Further, the product also comprises an RNA extraction reagent.

Further, the upstream amplification primer corresponding to hsa _ circ _0002490 is shown as SEQ ID NO. 4, specifically CTGTGTTGTGCTTCAGGGTG; the downstream amplification primer is shown as SEQ ID NO. 5, specifically TGACACACCTGAACACAAGC;

the upstream amplification primer corresponding to hsa _ circ _0005197 is shown as SEQ ID NO. 6, specifically CAAAATTTGATCACAGCCGAGT; the downstream amplification primer is shown as SEQ ID NO. 7, specifically GCCCATAGACGCCCTTTATAA;

the upstream amplification primer corresponding to hsa _ circ _0101802 is shown as SEQ ID NO. 8, specifically AGAATGTGTCCAGCTACCCA; the downstream amplification primer is shown as SEQ ID NO. 9, specifically CAAAAGCCGCAGTTCTGTCT.

The amplification primer disclosed by the invention has excellent specificity, can stably amplify the molecular marker, and further effectively improves the detection accuracy of the molecular marker.

The embodiment of the invention also provides application of SiRNA of hsa _ circ _0005197 and/or hsa _ circ _0101802 in preparation of a medicament for treating liver cancer.

Further, the SiRNA sequence of hsa _ circ _0101802 is as follows:

the sequence of the sense strand is shown as SEQ ID NO. 10, specifically GAGAAAAAUGAACGCAAAATT, and the sequence of the antisense strand is shown as SEQ ID NO. 11, specifically UUUUGCGUUCAUUUUUCUCTT; or, the sequence of the sense strand is shown as SEQ ID NO. 12, specifically AAUGAACGCAAAAGCGGCGTT, and the sequence of the antisense strand is shown as SEQ ID NO. 13, specifically CGCCGCUUUUGCGUUCAUUTT.

The SiRNA can inhibit the expression level of hsa _ circ _0101802 in cells, further can inhibit the proliferation of liver cancer cells, and achieves the purpose of treating liver cancer.

The embodiment of the invention also provides a medicament for treating liver cancer, which comprises SiRNA of hsa _ circ _0005197 and/or hsa _ circ _ 0101802.

Further, the SiRNA sequence of hsa _ circ _0101802 is as follows:

The technical solution of the present invention is further described in detail by the following specific examples.

Example 1

This example shows the expression of circPNN (hsa _ circ _0101802), circFCHO2(hsa _ circ _0002490) and circPTPN12(hsa _ circ _0005197) in human hepatoma cell lines and human normal hepatoma cell lines:

human normal liver cell line HL-7702 cells were cultured in RPMI-1640 medium + 10% FBS Fetal Bovine Serum (FBS); and Huh-7 uses DMEM medium + 10% FBS; SK-HEP-1 uses a special culture medium purchased from the cell bank of the Committee for the preservation of type cultures of the Chinese academy of sciences (Shanghai). The cells are cultured in a cell incubator with 37 ℃ and 5% of CO2 saturated humidity and grow in an adherent manner.

(1) Cell resuscitation

From a liquid nitrogen tank or an ultra-low temperature refrigerator at minus 80 ℃, the cell is quickly shaken back and forth in a water bath kettle at 37 ℃ to quickly melt the cells. And transferring the cell suspension of the cryopreserved tube into a 15ml centrifuge tube in a super clean bench by using a 1ml pipette gun, blowing, uniformly mixing, and centrifuging at 1000rpm for 5 min. The supernatant was discarded in a clean bench and 1ml of culture medium was added to resuspend the cells and blow them well. The cell suspension was transferred to a flask, 5ml of culture medium was added, and the cells were evenly distributed at the bottom of the flask by gentle shaking. The cell state was observed under an inverted microscope. Marking cell information, date and culture person information, and placing the cells in a carbon dioxide incubator for culture.

(2) Cell exchange liquid

Observing the growth state of the cells under a mirror, and changing the cell culture medium once according to 1-3 days. In a clean bench, cells were washed 2-3 times with 1ml of medium in a pipette cell vial and 1 × PBS buffer, and then 5ml of fresh cell medium containing 10% FBS was added.

(3) Cell passage

Cells were observed under the mirror and subcultured when 80% -90% was reached. In a clean bench, the old medium was aspirated with a 1ml pipette, followed by washing the cells 2-3 times with 1 × PBS, and then adding 1.5ml of 0.25% trypsin solution. The flask was then tipped, shaken gently to bring the pancreatin into full contact with the cells, and digested in a carbon dioxide incubator for 3 minutes. When the cells were completely digested into spheres and changed from adherent to floating, 2.0ml of the culture medium was added to terminate the digestion. Centrifuging at 1000rpm for 5 minutes at room temperature by using a low-speed centrifuge, removing supernatant, adding 1ml of complete culture medium, blowing, resuspending cells, inoculating into a new culture flask according to the proportion of 1:3, supplementing culture solution to 5ml, and culturing in a cell incubator after marking.

(4) Cell cryopreservation

Prophase manipulations such as cell passaging. And mixing the FBS and the DMSO in a volume ratio of 4:1 to prepare a cell freezing medium. The digested cells were placed in a 10ml centrifuge tube and centrifuged at 1000rpm for 5 min. After centrifugation, adding cell freezing solution for resuspension, blowing, uniformly mixing and transferring to a cell sterile freezing tube with 1.6ml per tube, sealing the tube opening, and clearly marking the cell types and the freezing date. And (3) freezing the tube at 4 ℃ for 30min, at-20 ℃ for 30min, in a refrigerator at-80 ℃ for 24h, performing gradient cooling and freezing, and finally putting the tube into liquid nitrogen for long-term freezing.

(5) Cellular RNA extraction

After aspirating the medium, the medium was washed 1 time with PBS, 500. mu.l of Trizol was added thereto and allowed to stand at room temperature for 5 minutes, and after transferring the Trizol to a new 1.5ml EP tube, 100. mu.l of chloroform was added thereto and sufficiently mixed to form a chyle state and allowed to stand for 10 minutes. Centrifuging at 4 ℃ and 12000g for 15 minutes, taking the upper clear liquid and putting the upper clear liquid into a new 1.5ml centrifuge tube; adding isopropanol (same volume as the supernatant and precooled at-20 deg.C), standing at room temperature for 20min (or overnight at-80 deg.C), centrifuging at 4 deg.C for 10 min, and discarding the supernatant; adding 500 μ l precooled 75% ethanol, mixing well, centrifuging at 4 deg.C 8500g for 5 minutes, discarding the supernatant, drying at room temperature for 5 to 10 minutes, adding 10 μ l RNase-, DNase-free Water after the ethanol is completely volatilized, and measuring the RNA concentration and purity.

(6) Reverse transcription reaction

Based on the RNA concentration measurements, total RNA was diluted to 500 ng/. mu.l with enzyme-free water, and the reverse transcription reaction solution was prepared on ice throughout the course of the procedure of the TAKARA RR037A reverse transcription kit (Table 1). After preparation, the solution is immediately put into a PCR instrument for reverse transcription, and the conditions of reverse transcription are 37 ℃ for 15min and 85 ℃ for 5 s. The total cDNA concentration is obtained after the reaction is finished, and the total cDNA concentration can be stored in a refrigerator at-80 ℃ or immediately subjected to real-time fluorescent quantitative PCR.

TABLE 1 preparation of reverse transcription reaction solution

(7) Real-time fluorescent quantitative PCR

Light shielding, the whole process is carried out on ice, according to TAKARA RR820A kit instruction, real-time fluorescence quantitative PCR (qRT-PCR) reaction solution is prepared according to table 2, and can be diluted properly according to cDNA concentration, and the reaction system is 20 mu l per well and at least 3 multiple wells.

TABLE 2 formulation of qRT-PCR reaction solution

The conditions of the amplification reaction are as follows: melting curves were obtained by fluorescence melting at 95 ℃ for 30s (pre-denaturation) → (95 ℃ for 5s, 60 ℃ for 30 s). times.40 cycles → fluorescence melting. At the end of each cycle in Stage 2, the instrument will automatically collect and analyze the fluorescence intensity of each sample.

(8) Real-time fluorescent PCR data processing

After the reaction is completed, information such as the melting curve and melting temperature of the target gene is checked. And (3) extracting the Ct value of the sample, performing relative quantitative analysis on the gene differential expression level by using a log 2-delta Ct (delta Ct ═ Ct target gene-Ct reference gene, delta Ct ═ delta Ct hepatocyte-delta Ct normal human hepatocyte) method, and simultaneously setting U6 as the reference gene. Data analysis using GraphPad Premier 9 software, statistical analysis using a one-way variance test.

(9) Results

The expression results of circPNN (hsa _ circ _0101802), circFCHO2(hsa _ circ _0002490) and circPTPN12(hsa _ circ _0005197) in human hepatoma cell lines and human normal hepatoma cell lines are shown in tables 3-5; the expression histogram is shown in FIGS. 1-3;

TABLE 3 expression of circPNN in hepatoma cells (X native SD, n ═ 3)

VS HL-7702，*P<0.05，**P<0.01；

TABLE 4 expression of circPTPN12 in hepatoma cells (X native SD, n ═ 3)

VS HL-7702，***P<0.001

TABLE 5 expression of circFCHO2 in hepatoma cells (X native SD, n ═ 3)

VS HL-7702，*P<0.05,**P<0.01

As can be seen from tables 3 to 5 and FIGS. 1 to 3:

compared with a human normal liver cell line HL7702 (the FC value is 1.000 +/-0.045), the circFCH02 shows low expression in liver cancer cells (the FC values are 0.785 +/-0.039, 0.036 +/-0.004 and p is less than 0.05); the circPNN shows high expression in the liver cancer cell line (FC values are HL-77020.950 +/-0.010, Huh-78.206 +/-0.118, SK-HEP-120.822 +/-0.288 and p is less than 0.05); circPTPN12 was also up-regulated in liver cancer cells (FC values HL-7702: 1.100 + -0.027, Huh-7: 1288.420 + -13.664, SK-HEP-1: 1321.599 + -15.921, p <0.05, respectively); it can be seen that the molecular markers have a correlation with liver cancer, and can be used as markers for liver cancer examination and therapeutic effect evaluation.

Example 2

This example is to silence the effect of circPNN (hsa _ circ _0101802) in the liver cancer cell SK-HEP-1 on the cell biological behavior:

(1) experiment grouping

(ii) siRNA-1 group: circPNN-siRNA-1 (SEQ ID NO:10 and SEQ ID NO:11) was added to the lentiviral complex at the time of transfection. ② group 2 siRNA: circPNN-siRNA-2 (SEQ ID NO:12 and SEQ ID NO:13) lentiviral complexes were added at the time of transfection. ③ blank control group: hepatoma carcinoma cells without any intervention.

(2) Cell transfection

Collecting SK-HEP-1 hepatocarcinoma cells with good growth state and logarithmic growth phase, digesting with trypsin, centrifuging, resuspending in culture medium, counting, adjusting cell concentration to 1.0 × 10⁵Inoculating to 6-well plate at density of one/ml, and placing in CO₂Culturing in an incubator until the cell density reaches 70-80%; old media was aspirated and cells were washed 2 times with PBS. Using complete medium, 25 Xvirus infection solution is diluted to 1 ×, and 500. mu.l of diluted 1 Xvirus infection solution is added to each well. Transfection was performed with MOI 30 according to the instructions and 15 μ l circPNN-siRNA-virus complex was added per well at a concentration of 1 × 108 TU/ml. And (4) slightly shaking the culture plate, fully and uniformly mixing, placing in an incubator, incubating for 8 hours, then replacing fresh culture solution, and continuing to culture for 24 hours until needed by the next experiment.

(3) Detection of transfection efficiency

After 24h of transfection, the cells are placed under a fluorescence microscope to observe transfection efficiency, the observation result is shown in figure 4, then total RNA of the cells is extracted, reverse transcription is carried out on the extracted total RNA, and the expression level of circPNN is detected by qRT-PCR.

As can be seen from FIG. 4, under the fluorescence microscope, green fluorescent cells were observed after successful transfection of the SiRNA-1 and SiRNA-2 groups.

The results of the expression level measurements of circPNN are shown in table 6, and the bar graph is shown in fig. 5;

TABLE 6 PCR detection of changes in the expression level of CircpNN after silencing: (

n＝3)

VS Control group，*P<0.05，**P<0.01

As can be seen from table 6 and fig. 5:

after SiRNA-1 and SiRNA-2 are transfected to a human liver cancer cell SK-HEP-1, the PCR result indicates that the SK-HEP-1 cell inner Control group is 1.005 soil 0.386; SiRNA-1 group 0.366 soil 0.041, the expression level was decreased compared to Control group (P < 0.01); SiRNA-2 group 0.449 soil 0.023, compared with Control group the expression level was decreased (P <0.01), compared with SiRNA-1 group the expression level was increased (P > 0.05).

(4) CCK8 detection of cell proliferation after transfection

Taking SK-HEP-1 cells after successful transfection, digesting with pancreatin, centrifuging, and preparing into the product with the concentration of 2.0 × 10⁴Cell suspension per ml. The 96-well plate was divided into experimental groups and 100. mu.l of cell suspension was added to each well, and each group was emptied in 3 replicates. To prevent cell culture medium evaporation from interfering with the results of the experiment, PBS was added to the surrounding blank wells. The 96-well plate was placed in a cell incubator, incubated for 24 hours and then removed, and 10. mu.l of CCK8 reagent was added to each well. The 96-well plate was returned to the cell incubator, and the absorbance of each well was measured on a microplate reader after 2 hours. Cell proliferation rate (experimental OD/control OD);

the results are shown in Table 7, and the bar graph is shown in FIG. 6;

TABLE 7 cell proliferation potency Change following silencing of Circpnn: (

n＝3)

VS Control group，*P<0.05，**P<0.01；VS SiRNA-1group，^#P<0.05，^##P<0.01

As can be seen from table 7 and fig. 6:

control group 102.280 soil 5.399; SiRNA-1 group 49.259 soil 2.272, and the cell proliferation rate is reduced compared with that of Control group (P < 0.01); SiRNA-2 group 82.628 soil 4.013 showed a decrease in cell growth rate (P <0.01) compared with Control group and an increase in cell growth rate (P <0.01) compared with SiRNA-1 group.

(5) Detection of apoptosis by flow cytometry

Taking SK-HEP-1 cells transfected by siRNA of a blank control group and an experimental group to prepare single cell suspension, adjusting the cell density to be 2 multiplied by 10⁵Inoculating each cell/ml in a 6-well plate, culturing for 48h by using serum-free DMEM culture solution, digesting the cells by using trypsin, stopping digestion by using complete culture medium, collecting cell digestion solution, centrifuging, collecting by centrifuging, discarding supernatant, then re-suspending by using PBS, centrifuging the cell suspension, discarding supernatant, adding 100 mu l of 1 × loading buffer solution, gently re-suspending the cells and transferring the cells to a flow tube; adding 5 μ l Annexin V and 5 μ l 7-AAD, mixing gently, incubating for 15min (on ice) in the dark at room temperature, adding 400 μ l1 × loading buffer solution, and detecting and analyzing by using a flow cytometer; and (4) judging a result: the lower left quadrant Q3 shows viable cells, the upper left quadrant Q1 as necrotic cells, the upper right quadrant Q2 as late apoptotic cells, and the lower right quadrant Q4 as early apoptotic cells. The total apoptosis rate of the cells is (Q2+ Q4)%.

The result of the SK-HEP-1 cell apoptosis flow analysis after the CircPNN expression is silenced is shown in figure 7; the rate of SK-HEP-1 apoptosis following silencing of CircPNN expression is shown in Table 8, and the bar graph is shown in FIG. 8;

TABLE 8 SK-HEP-1 apoptosis Rate following silencing of CircpNN expression (II) ((III))

n＝3)

VS Control group，*P<0.05，**P<0.01；VS SiRNA-1group，^#P<0.05，^##P<0.01

As can be seen from Table 8 and FIGS. 7-8, Control group 4.800 soil 0.608; SiRNA-1 group 27.133 soil 0.751, compared with Control group, the apoptosis rate is increased (P < 0.01); SiRNA-2 group 16.633 soil 0.404, the apoptosis rate was higher than that of Control group (P <0.01), and the apoptosis rate was lower than that of SiRNA-1 group (P < 0.01).

(6) Western blot for detecting protein expression in cells

Preparation of protein sample and determination of content

Collecting cells with good growth state, culturing and passaging the cells, inoculating the cells into a 6-hole cell culture plate, observing that the cells have good growth state and the confluence degree is about 80%, rinsing the cells twice by using precooled PBS (phosphate buffer solution), collecting the cells by conventional digestion, and transferring the cells into 3 1.5ml EP tubes in groups. ② 300 mul of the compound cell lysate (25 multiplied by 12 mul of protease inhibitor, 100 multiplied by 3 mul of PMSF, 10 multiplied by 30 mul of phosphatase inhibitor and RIPA to complement the volume to 300 mul) is added into each EP tube, and the mixture is shaken and cracked for 30min on ice. ③ moving the EP tube to a high-speed refrigerated centrifuge for centrifugation, at 4 ℃, 12000rpm, for 20min, absorbing the supernatant in the EP tube, and abandoning the precipitate to obtain the total cell protein.

Preparation of SDS-PAGE gels

According to the molecular weight of the protein required by the experiment and the instruction of the kit, separating gel and concentrated gel with proper concentration are prepared, and during gel preparation, the phenomenon of gel leakage is noticed, and bubbles are prevented from being generated between the separating gel and the concentrated gel.

Sample loading

Putting an electrophoresis device into an electrophoresis tank, adding electrophoresis liquid to exceed a glue plane, pulling out a comb, taking protein samples with the same mass according to the measured protein concentration, adding the protein samples into each hole in sequence, wherein the sample loading amount is generally 25 mu l, the samples are added to the bottoms of the holes during sample loading, so that bubbles are prevented from being generated, overflowing protein into the electrophoresis liquid to influence an experimental result is avoided, and pre-dyed protein molecule markers with proper types are added into two holes at the outermost side according to the molecular weight of target protein.

Electrophoresis

Adopting a constant pressure method: setting the voltage at 80V for 30min during gel concentration electrophoresis; the gel was separated by setting 120V and the electrophoresis stopped when bromophenol blue reached the bottom of the gel.

Rotary film

Selecting a PVDF membrane with a proper pore size, shearing the membrane with a proper size according to the width of the glue with the protein molecular weight, marking, and soaking in methanol; and (3) taking out the separated protein gel plate from the electrophoresis tank, separating the target protein from the internal reference according to the molecular weight markers of the pre-dyed protein, placing the protein gel plate on a membrane transferring plate, covering the membrane transferring plate with a corresponding PVDF membrane, and completely covering the PVDF membrane on the surface of the separation gel to avoid generating bubbles in the covering process. Putting the film into a film transferring groove according to the principle of 'red to red and black to black', and paying attention to the placing direction of the film transferring plate. The membrane is rotated by using constant voltage and 120V voltage for 90 min. The film rotating tank is placed in ice water, and the continuous low temperature is kept.

Sealing of

Washing the PVDF membrane in TBST for 5min, blocking with 5% BSA solution, placing the PVDF membrane in a blocking solution, and blocking for 1h at room temperature on a shaking table;

anti-incubation

Taking out the PVDF membrane from the confining liquid, putting the PVDF membrane into TBST for washing for 5min X3 times, after washing, putting the PVDF membrane into the diluted primary antibody solution, and shaking overnight at 4 ℃;

incubation with secondary antibody

Placing the PVDF membrane and the diluted primary anti-solution on a shaking table for room temperature rewarming for 1h, taking out the PVDF membrane from the primary anti-dilution solution, placing the PVDF membrane in TBST, shaking the table for 5minx4 times at room temperature, selecting a secondary antibody of horseradish peroxidase-labeled goat anti-rabbit or goat anti-mouse, adding the secondary antibody into TBS containing 5% according to a certain proportion, shaking uniformly, placing the PVDF membrane in a secondary antibody dilution solution, and incubating for 1h on the shaking table at room temperature

Development

After the secondary antibody is incubated, the strips are placed in TBST and washed for 5minx3 times, ECL developing solution is prepared by luminous solution and stabilizing solution according to the proportion of 1:1, and the membrane is placed in Tanon5200 for development and is photographed for storage; the photographing result is shown in fig. 9;

the expression level of Caspase-3 protein detected by Western Blot is shown in Table 9, and a bar chart is shown in FIG. 10;

TABLE 9 Western Blot to detect Caspase-3 protein expression level ((S))

n＝3)

VS Control group，*P<0.05，**P<0.01；VS SiRNA-1group，^#P<0.05，^##P^<0.01

As can be seen from Table 9 and FIGS. 9 to 10:

control group 0.553 soil 0.067; SiRNA-1 group 1.237 soil 0.110, compared with Control group, C3 protein expression level is increased (P < 0.01); SiRNA-2 group 0.957 and 1.102, C3 protein expression level was increased compared with Control group (P <0.01), and C3 protein expression level was decreased compared with SiRNA-1 group (P < 0.05).

Statistical analysis

All data were the results of 3 independent experiments, statistical analysis using SPSS 25.0 software. Normal distribution data results are expressed as mean. + -. standard error (X. + -. SD), differences between groups are compared by one-way anova, and differences with P <0.05 are considered to be statistically significant.

In conclusion, the molecular marker has a correlation with liver cancer, can quickly, simply and accurately realize auxiliary diagnosis of the liver cancer, and provides a basis for diagnosis of the liver cancer and selection of treatment effect evaluation indexes; in addition, the molecular marker can also be used as a liver cancer drug treatment target.

Finally, it should be noted that: the above embodiments are only used to illustrate the technical solution of the present invention, and not to limit the same; while the invention has been described in detail and with reference to the foregoing embodiments, it will be understood by those skilled in the art that: the technical solutions described in the foregoing embodiments may still be modified, or some or all of the technical features may be equivalently replaced; such modifications and substitutions do not depart from the spirit and scope of the present invention, and they should be construed as being included in the following claims and description.

SEQUENCE LISTING

<110> Dongguan City small huh-Gudong medical university Hospital Guangdong medical university affiliated second Hospital

<120> molecular marker for detecting or evaluating curative effect of liver cancer and application thereof

<130> 2021

<160> 13

<170> PatentIn version 3.3

<210> 1

<211> 268

<212> RNA

<213> Artificial

<400> 1

gugugucacg gggucccagc ccugucagcc uuggaaauca ggauaccuua ccuguggcag 60

uugcccuuac agaaucuguu aaugccuacu uuaaaggagc agaucccacc aaguguauug 120

ugaagaucac uggugauaug acaaugucau uuccaagugg aauuauuaaa gucuucacca 180

gcaauccaac uccagcugug uugugcuuca gggugaaaaa uaucagcaga cuagagcaga 240

uucuuccaaa ugcacagcuu guguucag 268

<210> 2

<211> 344

<212> RNA

<213> Artificial

<400> 2

uugaucacag ccgaguuaaa uugacauuaa agacuccuuc acaagauuca gacuauauca 60

augcaaauuu uauaaagggc gucuaugggc caaaagcaua uguagcaacu caaggaccuu 120

uagcaaauac aguaauagau uuuuggagga ugauauggga guauaauguu gugaucauug 180

uaauggccug ccgagaauuu gagaugggaa ggaaaaaaug ugagcgcuau uggccuuugu 240

auggagaaga ccccauaacg uuugcaccau uuaaaauuuc uugugaggau gaacaagcaa 300

gaacagacua cuucaucagg acacucuuac uugaauuuca aaau 344

<210> 3

<211> 295

<212> RNA

<213> Artificial

<400> 3

caaaagcggc gccaggaaau ugaacaaaaa cuugaaguuc aggcagaaga agagagaaag 60

cagguugaaa augaaaggag agaacuguuu gaagagaggc gugcuaaaca gacagaacug 120

cggcuuuugg aacagaaagu ugagcuugcg cagcugcaag aagaauggaa ugaacauaau 180

gccaaaauaa uuaaauauau aagaacuaag acaaagcccc auuuguuuua uauuccugga 240

agaauguguc cagcuaccca aaaacuaaua gaagagucac agagaaaaau gaacg 295

<210> 4

<211> 20

<212> DNA

<213> Artificial

<400> 4

ctgtgttgtg cttcagggtg 20

<210> 5

<211> 20

<212> DNA

<213> Artificial

<400> 5

tgacacacct gaacacaagc 20

<210> 6

<211> 22

<212> DNA

<213> Artificial

<400> 6

caaaatttga tcacagccga gt 22

<210> 7

<211> 21

<212> DNA

<213> Artificial

<400> 7

gcccatagac gccctttata a 21

<210> 8

<211> 20

<212> DNA

<213> Artificial

<400> 8

agaatgtgtc cagctaccca 20

<210> 9

<211> 20

<212> DNA

<213> Artificial

<400> 9

caaaagccgc agttctgtct 20

<210> 10

<211> 21

<212> DNA

<213> Artificial

<400> 10

gagaaaaaug aacgcaaaat t 21

<210> 11

<211> 21

<212> DNA

<213> Artificial

<400> 11

uuuugcguuc auuuuucuct t 21

<210> 12

<211> 21

<212> DNA

<213> Artificial

<400> 12

aaugaacgca aaagcggcgt t 21

<210> 13

<211> 21

<212> DNA

<213> Artificial

<400> 13

cgccgcuuuu gcguucauut t 21

Claims

1. A molecular marker for detecting or evaluating the curative effect of liver cancer, which is characterized by comprising at least one of hsa _ circ _0002490, hsa _ circ _0005197 and hsa _ circ _0101802, wherein the nucleic acid sequence of hsa _ circ _0002490 is shown as SEQ ID NO: 1; the nucleic acid sequence of hsa _ circ _0005197 is shown in SEQ ID NO 2; the nucleic acid sequence of hsa _ circ _0101802 is shown in SEQ ID NO 3.

2. The use of the molecular marker of claim 1 in the preparation of a product for detecting or evaluating the efficacy of liver cancer.

3. Use according to claim 2, wherein said product comprises but is not limited to a kit.

4. A product for detection or evaluation of therapeutic efficacy of liver cancer, comprising an amplification primer for amplifying cDNA complementary to a molecular marker;

5. The product of claim 4, further comprising an RNA extraction reagent.

6. The product of claim 4, wherein the upstream and downstream amplification primers of hsa _ circ _0002490 are shown in SEQ ID NO. 4 and SEQ ID NO. 5, respectively;

Application of SiRNA of hsa _ circ _0005197 and/or hsa _ circ _0101802 in preparing a medicament for treating liver cancer.

8. The use of claim 7, wherein the SiRNA sequence of hsa _ circ _0101802 is as follows:

9. A medicament for the treatment of liver cancer comprising SiRNA of hsa _ circ _0005197 and/or hsa _ circ _ 0101802.

10. The pharmaceutical of claim 9, wherein the SiRNA sequence of hsa _ circ _0101802 is as follows: