CN116064767B

CN116064767B - LncRNA marker related to osteoarthritis and application thereof

Info

Publication number: CN116064767B
Application number: CN202211009871.0A
Authority: CN
Inventors: 陈璐璐; 王婵; 苗登顺; 王懿涵
Original assignee: Nanjing Medical University
Current assignee: Nanjing Medical University
Priority date: 2022-08-23
Filing date: 2022-08-23
Publication date: 2024-06-04
Anticipated expiration: 2042-08-23
Also published as: CN116064767A

Abstract

The invention belongs to the fields of diagnosis, treatment and prognosis detection of osteoarthritis, and particularly discloses an LncRNA marker related to osteoarthritis and application thereof. The gene sequence of the LncRNA marker HOXC-AS3 is shown AS SEQ NO.3, and the primer for amplifying the LncRNA marker HOXC-AS3 is HOXC-AS3-F:5'-GTGGAGTAACAGCGCCATCT-3'; HOXC-AS3-R:5'-CGGGTTTTGTTGCGTCTTGT-3'. Studies have shown that reduced LncRNA HOXC-AS3 expression levels can be used AS biomarkers for diagnosis, treatment and prognosis of osteoarthritis.

Description

LncRNA marker related to osteoarthritis and application thereof

Technical Field

The invention belongs to the fields of diagnosis, treatment and prognosis detection of osteoarthritis, and relates to an osteoarthritis LncRNA marker and application thereof.

Background

Osteoarthritis (Osteoarthritis, OA) is a chronic progressive disease of the active joint, mainly manifested by breakdown of articular cartilage matrix, chondrocyte depletion, and reduced activity. The Chinese guidelines for diagnosis and treatment of osteoarthritis report that osteoarthritis has a prevalence of 50% in people over 60 years old and 80% in people over 75 years old, with disability rate of 53%. Therefore, early screening diagnosis and prevention of osteoarthritis are of great significance to improving the quality of life of people.

LncRNAs is a class of RNA molecules with transcripts exceeding 200 nucleotides in length, which do not encode proteins due to the lack of efficient open reading frames, but regulate gene expression at multiple levels, such as epigenetic, transcriptional and post-transcriptional levels, in the form of RNA, thereby affecting disease development and progression. As high throughput sequencing technologies develop, more and more LncRNAs are annotated. Therefore, we aimed at looking for effective LncRNA as a marker for clinical diagnosis, treatment and prognostic detection of osteoarthritis, thereby improving the quality of life of osteoarthritis patients.

Disclosure of Invention

The invention provides an LncRNA marker HOXC-AS3 related to osteoarthritis and application thereof, and researches prove that the expression of LncRNA HOXC-AS3 in osteoarthritis articular chondrocytes is obviously lower than that of normal articular chondrocytes. Specifically, reduced expression levels of LncRNA HOXC-AS3 can be used AS a biomarker for diagnosing the occurrence and prognosis of osteoarthritis.

Use of a substance for detecting HOXC-AS3 for the preparation of an assisted diagnosis or prognosis evaluation agent for osteoarthritis. As a preferable aspect of the present invention, the substance for detecting HOXC-AS3 is a primer or probe specific to HOXC-AS 3.

As a further preferred aspect of the present invention, the specific primers for HOXC-AS3 are shown in SEQ ID NO.1 and SEQ ID NO. 2.

An osteoarthritis aiding diagnostic or prognostic assessment agent comprising a substance that detects HOXC-AS 3.

As a preferable aspect of the present invention, the substance for detecting HOXC-AS3 is a primer or probe specific to HOXC-AS 3.

Application of HOXC-AS3 or substances for increasing HOXC-AS3 expression level in preparing medicines for treating or adjunctively treating osteoarthritis is provided. The nucleotide sequence of HOXC-AS3 is shown AS SEQ NO. 3.

The beneficial effects are that: the invention discovers that the LncRNA marker HOXC-AS3 related to osteoarthritis has the expression in the articular chondrocytes of osteoarthritis obviously lower than that of corresponding normal articular chondrocytes, and can be used AS an early-stage screening, auxiliary screening diagnosis or prognosis evaluation index of osteoarthritis. The invention finds that compared with a control group, the expression level of HOXC-AS3 is obviously reduced in an OA cell model (figure 5), the proliferation capacity of chondrocytes is reduced after the HOXC-AS3 is knocked down (figure 7), edu positive chondrocyte expression is obviously reduced (figure 8), chondrocytes are blocked in the G0/G1 phase (figures 9-10), and the clonality of chondrocytes is reduced (figures 11-12); whereas chondrocyte proliferation capacity (FIG. 14) and cell clone formation capacity (FIGS. 15-16) increased after over-expression of OXC-AS 3. As can be seen, HOXC-AS3 can be used AS a molecular marker of OA and applied to preparing a diagnostic kit of OA or become a candidate drug for treating OA.

Drawings

FIG. 1 is a gene sequencing analysis of genes differentially expressed by normal articular chondrocytes and OA chondrocytes.

FIG. 2 shows the RT-qPCR assay of LncHOXC-AS3 expression in clinical normal articular chondrocytes and chondrocytes from patients with OA.

Fig. 3 is a ROC curve verification graph.

FIG. 4 shows the Western Blot detection of protein expression in normal control and OA chondrocyte model after construction of OA cell model with IL-1. Beta.

FIG. 5 shows the expression of LncRNA HOXC-AS3 in normal control and OA chondrocyte models by RT-qPCR after construction of OA cell models with IL-1. Beta.

FIG. 6 shows the mRNA level expression levels after specific knockdown of HOXC-AS3 with siRNA in human chondrocytes.

FIG. 7 shows cell proliferation following specific knockdown of HOXC-AS3 in chondrocytes.

FIG. 8 shows Edu positive cell expression after specific knockdown of HOXC-AS3 in chondrocytes.

FIG. 9 is a flow chart of cell cycle assays following specific knockdown of HOXC-AS3 in chondrocytes.

FIG. 10 is a flow chart of cell cycle detection statistics after specific knockdown of HOXC-AS3 in chondrocytes.

FIG. 11 shows cell clone formation after specific knockdown of HOXC-AS3 in chondrocytes.

FIG. 12 is a statistical plot of cell clones following specific knockdown of HOXC-AS3 in chondrocytes.

FIG. 13 shows the expression level of mRNA after the human chondrocyte overexpresses HOXC-AS 3.

FIG. 14 shows cell proliferation after overexpression of HOXC-AS3 in chondrocytes.

FIG. 15 shows cell clone formation after overexpression of HOXC-AS3 in chondrocytes.

FIG. 16 is a statistical plot of cell clones after overexpression of HOXC-AS3 in chondrocytes.

Detailed Description

Example 1 clinical sample analysis

The clinical samples adopted by the invention are all from a first hospital in Nanjing city. The project solicits consent from the patient and is approved by the ethical committee of the university of south Beijing medical science.

(1) Tissue specimen source and collection

Cartilage specimens were from patients receiving knee arthroplasty or hip arthroplasty at first hospital in Nanjing, 2019 through 2021. Of these, 16 patients who underwent hip replacement due to femoral neck fracture were included in the normal control group. An additional 16 cases were included in the OA group due to severe knee osteoarthritis and knee arthroplasty.

After the tissue of the sample is isolated in the operation, the tissue is placed in a sterile 50mL centrifuge tube under the sterile condition, and then immediately placed in liquid nitrogen for quick freezing, and then stored in a refrigerator at the temperature of minus 80 ℃ for subsequent use in gene sequencing or gene sequencing.

(2) Gene sequencing and data analysis

We sent 5 pairs of normal control samples and OA samples harvested in clinical surgery to the shanghai-sky biotechnology company for lncRNAs sequencing analysis and annotated differentially expressed lncRNAs (see figure 1 for results). (3) Real-time PCR

A) Total chondrocyte RNA extraction: trizol method extracts total RNA from normal control chondrocytes and OA chondrocytes. Mu.l Trizol was added. 100ul of chloroform was added, and the mixture was vigorously shaken to mix the upper and lower phases thoroughly, and after 10 minutes of standing at room temperature, the mixture was centrifuged at 12000Xg for 15 minutes at 4 ℃. 160ul of the upper aqueous phase was carefully aspirated into a fresh RNASE FREE EP tube, an equal volume of isopropanol (160 ul) was added, mixed upside down, left on ice for 20min, centrifuged at 12000Xg for 15min at 4℃and after centrifugation white RNA precipitation was seen in the tube. The supernatant was discarded, and the pellet was washed once with pre-chilled 75% ethanol (DEPC water dilution), 70000 g and centrifuged at 5min at 4 ℃. Discarding the supernatant, standing at room temperature, and airing (10-15 min) to volatilize the alcohol completely. Then, 15. Mu.l of DEPC water was added for dissolution and the concentration was measured for later use.

B) RNA inversion into cDNA: reverse transcription of RNA was performed using reverse transcription kit (de-genomic DNA) from Nanjinopran (vazyme) according to the kit instructions, the reverse transcription system was as follows:

Reagent(s)	Dosage of
		RNA	1μg
4×gDNA wiper Mix	4μl
		RNase free ddH₂O	To 16 μl

Mixing the above mixture, reacting at 42 ℃ for 2min by a PCR instrument, and continuing the second step of reversion:

Reagent(s)	Dosage of
		The above mixture	16μl
5×HiScriptⅡqRT SuperMixⅡ	4μl

After mixing, reverse transcription PCR was performed under the following conditions: 50 ℃ for 15min; the cDNA product obtained at 85℃for 5s can be used for Real-time PCR

C) Real-time PCR: the final-time PCR was performed using the cDNA of the previous step as a template, and was performed using SYBR Green Mix from Novain (vazyme) according to the kit instructions. 10 μl system:

After the above mixture was mixed, real-time PCR was performed under the following reaction conditions: 95 ℃ for 5min;95 ℃,10 s-60 ℃ and 30s;40 cycles

The primer sequences were as follows:

Primers	Sequence(5’-3’)
		β-actin-F	TCATGAAGTGTGACGTGGACAT
β-actin-R	CTCAGGAGGAGCAATGATCTTG
		HOXC-AS3-F	GTGGAGTAACAGCGCCATCT
HOXC-AS3-R	CGGGTTTTGTTGCGTCTTGT

d) Results: the invention detects the expression level of HOXC-AS3 in the clinical OA cartilage and normal control cartilage cells by using Real-time PCR technology, and discovers that the expression level of HOXC-AS3 is obviously reduced in the OA cartilage cells (the result is shown in figure 2).

(4) ROC Curve verification

ROC curve verification was performed on 5 pairs of OA group and control group HOXC-AS3 expression level differences using pROC R package. The cut-off value of the predictive variable HOXC-AS3 is 5.568, the positive predictive value and the negative predictive value are both 1, the about sign index is 1, the AUC of the predictive outcome of the control group and the OA group by using the HOXC-AS3 is 1, the confidence interval is 1.000-1.000, and the result proves that the selected index has high accuracy in predicting the outcome (the result is shown in figure 3).

Example 2OA cell model experiment

Human chondrocyte cell line C28/I2 was purchased from Shanghai Yu Biotech Co.

(1) Cell culture

C28/I2 cell cultures were performed in sterile incubator at 37℃with 5% CO ₂ using DMEM medium (Gibco) containing 10% fetal bovine serum (Gibco), 1% tri-antibody (i.e., 100U/mL penicillin, 100mg/mL streptomycin, and 25. Mu.g/mL amphotericin B) (Gibco), medium was changed every 2-3 days, and pancreatin digested at 1 when 80% -90% of cells were fused: 2 or 1: 3.

(2) Construction of OA cell model

C28/I2 cells were cultured in DMEM medium containing IL-1β (Sigma) at 10ng/ml or 20ng/ml for 24 hours, and OA cell models were constructed, and untreated cells were used as a control group.

(3)Western Blot

A) Total cell protein extraction

Adding 200 μl RIPA containing 10% PI and 10% PMSF into the adherent cells, shaking the culture plate lightly to make the cells fully contacted with liquid, shaking on ice for 5min, scraping the cells in the culture plate from the bottom of the plate by using a clean and sterile cell scraper, transferring the cells into a sterile and enzyme-free 1.5mL EP tube, placing the EP tube on ice obliquely, incubating under shaking for 15-20min to completely lyse the sample, and centrifuging at 4 ℃ for 10min; sucking the supernatant into a new EP pipe, and temporarily storing on ice;

the protein concentration was determined according to the Biyundian BCA protein concentration assay kit, and the sample protein was diluted to 300. Mu.g/80. Mu.l with ddH ₂ O, and 20. Mu.l of 5 x loading buffer was added to the solution at 100℃for 10min.

Cooling at room temperature;

b) Preparing 10% separating gel and concentrating gel

Reagent(s)	Release adhesive (mu l)	Concentrated glue (mu l)
			ddH₂O	1900	680
30% AA solution	1700	166
			1MTris-HCl(pH＝8.8)	1300	\
1M Tris-HCl(pH＝6.8)	\	126
			10％SDS	50	10
10％APS	50	10
			TEMED	4	1

C) Preparing SDS-PAGE gel, firstly pouring the prepared separating gel into a glass plate, preventing and treating bubbles, slowly adding ddH ₂ O to the position which is 1.5cm away from the upper edge of the glass plate, pressing gel to isolate air, standing for 30min, wherein a gel surface and a water phase have obvious interfaces, namely the separating gel is solidified, pouring out upper liquid, preparing upper concentrated gel, adding a comb immediately after adding the glass plate, and standing for solidification;

d) Mounting the gel plate in an electrophoresis tank, pouring 1 x electrophoresis liquid into the inner tank and the outer tank, adding sample by a sample loading gun, starting electrophoresis at a constant voltage of 80V until a marker is separated, and adjusting the voltage to 110V until the electrophoresis is completed;

e) After electrophoresis, taking out gel, putting the gel in ddH ₂ O, putting the PVDF membrane in methanol for activating for 30s, and transferring the PVDF membrane into precooled membrane transferring liquid; putting sponge and filter paper in a film transfer clamp plate, putting gel and PVDF film in the current direction (from black to red), putting the gel on one side of a black plate, discharging bubbles between each layer by light pressure, closing the clamp plate, putting the film transfer clamp plate into a film transfer groove, putting the gel surface (black side) facing the negative electrode of the film transfer groove, putting the PVDF film facing the positive electrode, pouring precooling film transfer liquid, putting an ice box, putting the film transfer groove into a refrigerator at 4 ℃, keeping the film transfer at low temperature, and transferring the film at constant current of 0.28A for 90min;

f) And after the film transfer is finished, taking out the PVDF film, cleaning the PVDF film twice by ddH ₂ O, putting ponceau for dyeing, observing whether protein strips exist, and judging whether the film transfer is successful. After washing ponceau, sealing with 5% milk-TBST, and standing for 2h at room temperature;

g) Placing the blocked membrane into an antibody incubation box, adding a primary antibody diluted with 5% BSA/TBST according to the ratio of 1:10000, and standing overnight at 4 ℃;

h) The next day, the membrane is washed by TBST, and the membrane is washed by a shaking table for 3 times, each time for 5min; adding the diluted secondary antibody 1:10000, and incubating for 2 hours at room temperature;

i) TBST is used for washing the membrane for three times, each time for 5min;

j) Preparing ECL developing solution, placing the film, performing exposure imaging with a chemiluminescent imaging system, photographing and archiving;

Results: western Blot experiments showed (see FIG. 4 for results) that we successfully constructed OA chondrocyte models using either 10ng/ml or 20ng/ml IL-1β.

(4)Real-time PCR

A) Total cell RNA extraction: the Trizol method extracts cellular RNA. Mu.l Trizol was added. 100ul of chloroform was added, and the mixture was vigorously shaken to mix the upper and lower phases thoroughly, and after 10min of standing on ice, the mixture was centrifuged at 12000Xg for 15min at 4 ℃. 160ul of the upper aqueous phase was carefully aspirated into a new RNASE FREE EP tube, an equal volume of isopropanol (160 ul) was added, mixed upside down, and after 10min at room temperature, 12000Xg,15min were centrifuged at 4℃and white RNA precipitation was seen in the tube after centrifugation. The supernatant was discarded, and the pellet was washed once with pre-chilled 75% ethanol (DEPC water dilution), 70000 g and centrifuged at 5min at 4 ℃. Discarding the supernatant, standing at room temperature, and airing (10-15 min) to volatilize the alcohol completely. Then, 15. Mu.l of DEPC water was added for dissolution and the concentration was measured for later use.

Reagent(s)	Dosage of
		The above mixture	16μl
5×HiScriptⅡqRT SuperMixⅡ	4μl

After the above mixture was mixed, real-time PCR was performed under the following reaction conditions: 95 ℃ for 5min;95 ℃,10s-60 ℃ and 30s;40 cycles

The primer sequences were as follows:

d) Results: real-time PCR results showed that HOXC-AS3 expression levels were significantly reduced in OA cell models compared to control (see fig. 5 for results).

Example 3 specific knockdown of HOXC-AS3 effect on chondrocyte proliferation and clonogenic Capacity

(1) Specific knockdown of HOXC-AS3

The HOXC-AS3 was knocked down in human chondrocyte line C28/I2 with small interfering RNA (siRNA), and the knockdown efficiency was detected AS follows:

the company "Ruibo RiboBio" designed to synthesize small interfering RNAs (siRNAs). The sequence is as follows:

Name of the name	Target sequence
		si-HOXC-AS3 1#	CAGAGUGGAGUAACAGCGCCAUCUA
si-HOXC-AS3 2#	CGGUCAGUUUGGAGGAGUCACGUAU

1X 10 ⁵ cells were seeded in six well plates, each well was transfected with 5. Mu.l of transfection reagent Lipofectamine 3000 (Invitrogen) plus 100pmol of siRNA after adherence, and cells were harvested after 48 h.

(2)Real-time PCR

A) Total cell RNA extraction: RNA was extracted by Trizol method. About 1X10 ⁶ cells were collected and 500. Mu. lTrizol was added. 100ul of chloroform was added, and the mixture was vigorously shaken to mix the upper and lower phases thoroughly, and after 10min of standing on ice, the mixture was centrifuged at 12000Xg for 15min at 4 ℃. 160ul of the upper aqueous phase was carefully aspirated into a new RNASE FREE EP tube, an equal volume of isopropanol (160 ul) was added, mixed upside down, and after 10min at room temperature, 12000Xg,15min were centrifuged at 4℃and white RNA precipitation was seen in the tube after centrifugation. The supernatant was discarded, and the pellet was washed once with pre-chilled 75% ethanol (DEPC water dilution), 70000 g and centrifuged at 5min at 4 ℃. Discarding the supernatant, standing at room temperature, and airing (10-15 min) to volatilize the alcohol completely. Then, 15. Mu.l of DEPC water was added for dissolution and the concentration was measured for later use.

Reagent(s)	Dosage of
		The above mixture	16μl
5×HiScriptⅡqRT SuperMixⅡ	4μl

Reagent(s)	Dosage of
		cDNA	1μl
H₂O	3.6μl
		Upstream primer	0.2μl
Downstream primer	0.2μl
		SYBR Green Mix	5μl

The primer sequences were as follows:

d) Results: real-time PCR results showed that expression of HOXC-AS3 in human chondrocytes could be effectively knocked down using small interfering RNAs (see figure 6 for results).

(3) Cell proliferation potency assay-MTT

A) Respectively inoculating cartilage cells transfected with si-NC and si-HOXC-AS3 into 96-well plates according to the number of 3000 cells/well, and placing the cartilage cells into a cell culture box for more than 8 hours until the cells adhere to the walls; adding 20 mu L MTT reagent into each hole, and continuously culturing in an incubator for 4 hours; detecting absorbance at 490nm by using an enzyme-labeled instrument as a growth degree of 0h, and performing the same operation every 24 hours until 96 hours; fold increase indicates cell proliferation capacity by comparison with 0h absorbance.

B) Results: chondrocyte proliferation was decreased upon knockout of HOXC-AS3 (see figure 7 for results).

(4) Cell proliferation ability detection- - -Edu cell immunofluorescence

A) Cells were counted 24h after transfection and seeded at 2 x 10 ⁴ cells/well into 24 well plates containing cell slide;

b) Removing the culture medium when the cells are fused to 60% -70%, preparing 50 mu M EdU culture medium according to a ratio of 1:1000, adding 300 mu L of the EdU culture medium into each hole, incubating for 3h, and washing with PBS for 5min each time;

c) 500 mu L of PBS containing 4% paraformaldehyde is added into each hole, the mixture is incubated for 30min at room temperature, and the fixing solution is sucked off;

d) Adding 300 mu L glycine (2 mg/mL) into each hole, and incubating for 5min by a shaking table, and sucking out glycine solution;

e) Adding 500 μl of PBS into each well, washing with shaking table for 5min, and discarding;

f) 300 mu L of 0.5% TritonX-100 PBS is added to each well, the mixture is incubated for 10min by a shaker, and the mixture is washed for 5min by PBS;

g) Preparing 1 XApollo staining reaction liquid according to the specification, adding 300 mu L of the Apollo staining liquid into each hole, incubating for 30min at room temperature in a dark place, and absorbing and removing the staining liquid;

h) 300 mu L of 0.5% TritonX-100 PBS is added to each well, and the mixture is incubated for 3 times by a shaker for 10min each time;

i) Adding 300 mu L of methanol into each hole for cleaning for 3 times, and cleaning for 5min in PBS (phosphate buffered saline);

j) Deionized water was used according to 1:100 preparing 1 Xhoechst 33342 reaction liquid, adding 300 mu L of 1 Xhoechst 33342 reaction liquid into each hole, and incubating for 30min at room temperature in a dark place;

k) Adding 500 mu L of PBS into each hole, and cleaning for 3 times; photographs were taken using a fluorescence microscope, and the positive spot ratio was counted.

L) results: following knockdown of HOXC-AS3, edu-positive chondrocyte expression was significantly reduced (see figure 8 for results).

(5) Cell cycle detection

A) Collecting cells, washing with pre-chilled PBS;

b) Fixing with pre-cooled 75% ethanol at-20deg.C overnight;

c) Centrifugation at 1500Xg for 5min at 4℃and removal of supernatant, re-suspension of each sample with 450. Mu.L PBS; d) Cells were stained with 50 μl PI in the dark for 15min at room temperature;

e) FACS Calibur flow cytometer (BD) cell cycle flow detection and analysis;

f) Results: after knocking down HOXC-AS3, chondrocytes were arrested in the G0/G1 phase (see FIGS. 9-10 for results).

(6) Cloning formation experiments

A) The cells transfected with si-NC and si-HOXC-AS for 3 hours are digested and inoculated into a six-hole plate in the quantity of 500 cells/hole, and a culture plate is gently shaken to evenly spread the cells and put into an incubator for culture;

b) Every 3 days, the new medium was changed until colony formation was visible to the naked eye on day 10;

c) Discarding the culture medium, washing twice with PBS, adding 1ml paraformaldehyde, standing and fixing for 15min;

d) Sucking the paraformaldehyde, adding ddH ₂ O, and washing for 3 times each for 2min;

e) Adding 1ml of 1-crystal violet reagent, standing in a dark place, dyeing for 15min, washing for multiple times by using ddH ₂ O until excessive crystal violet is washed, and airing;

f) And taking pictures by a camera, and counting the number of clones.

G) Results: upon knocking down HOXC-AS3, the chondrocyte clonogenic capacity was reduced (see fig. 11-12 for the results).

Example 4 Effect of over-expression of HOXC-AS3 on chondrocyte proliferation and clonogenic Capacity

(1) Overexpression of HOXC-AS3

The transfection plasmid overexpresses HOXC-AS3 in human cartilage cell C28/I2 and the overexpression efficiency is detected by the following steps: 1X 10 ⁵ cells were seeded in six well plates, each well was transfected with transfection complex of transfection reagent X-TREMEGENE DNA Transfection Reagent. Mu.l+4. Mu.g plasmid after adherence, and after 48h the cells were harvested and RNA was extracted.

(2)Real-time PCR

A) Total cell RNA extraction: RNA was extracted by Trizol method. About 1X10 ⁶ cells/group were collected and 500. Mu.l Trizol was added. 100ul of chloroform was added, and the mixture was vigorously shaken to mix the upper and lower phases thoroughly, and after 10min of standing on ice, the mixture was centrifuged at 12000Xg for 15min at 4 ℃. 160ul of the upper aqueous phase was carefully aspirated into a new RNASE FREE EP tube, an equal volume of isopropanol (160 ul) was added, mixed upside down, and after 10min at room temperature, 12000Xg,15min were centrifuged at 4℃and white RNA precipitation was seen in the tube after centrifugation. The supernatant was discarded, and the pellet was washed once with pre-chilled 75% ethanol (DEPC water dilution), 70000 g and centrifuged at 5min at 4 ℃. Discarding the supernatant, standing at room temperature, and airing (10-15 min) to volatilize the alcohol completely. Then, 15. Mu.l of DEPC water was added for dissolution and the concentration was measured for later use.

Reagent(s)	Dosage of
		The above mixture	16μl
5×HiScriptⅡqRT SuperMixⅡ	4μl

The primer sequences were as follows:

d) Results: the Real-time PCR results showed a significant increase in expression of HOXC-AS3 in human chondrocytes (see fig. 13 for results).

(3) Cell proliferation potency assay-MTT

A) Respectively inoculating chondrocytes of an NC group, an IL-1β group, an IL-1β+empty vector group and an IL-1β+HOXC-AS3 group into 96-well plates according to the number of 3000 cells/well, and placing the cells into a cell incubator for more than 8 hours until the cells adhere to the wall; adding 20 mu L MTT reagent into each hole, and continuously culturing in an incubator for 4 hours; detecting absorbance at 490nm by using an enzyme-labeled instrument as a growth degree of 0h, and performing the same operation every 24 hours until 96 hours; fold increase indicates cell proliferation capacity by comparison with 0h absorbance.

B) Results: after overexpression of HOXC-AS3, chondrocyte proliferation capacity was significantly increased (see figure 14 for results).

(4) Cloning formation experiments

A) The method comprises the steps of (1) inoculating chondrocytes of an NC group, an IL-1 beta group, an IL-1 beta+empty vector group and an IL-1 beta+HOXC-AS 3 group into a six-hole plate in the number of 500 cells/hole after digestion, and putting the cells into an incubator for culture by shaking the culture plate slightly to uniformly spread the cells;

f) And taking pictures by a camera, and counting the number of clones.

G) Results: after overexpression of HOXC-AS3, chondrocyte clonality was increased (see fig. 15-16 for results).

By combining clinical samples and in vitro cell experiments, it can be found that the expression of HOXC-AS3 in OA is significantly lower than that of normal control. The expression of the HOXC-AS3 of the cartilage cells is knocked down, so that the proliferation of the cartilage cells can be inhibited, and the cloning capacity of the cartilage cells is reduced; and the over-expression of HOXC-AS3 can promote the proliferation of chondrocytes and increase the clonogenic capacity of the chondrocytes. The HOXC-AS3 can be used AS a molecular marker of OA and applied to preparing diagnostic kits of OA.

In the foregoing, the protection scope of the present invention is not limited to the preferred embodiments of the present invention, and any simple changes or equivalent substitutions of the technical solutions that can be obviously obtained by those skilled in the art within the technical scope of the present invention disclosed in the present invention fall within the protection scope of the present invention.

Claims

1. The application of a substance for detecting LncRNA HOXC-AS3 expression quantity in preparing an osteoarthritis auxiliary diagnostic reagent.

2. The use according to claim 1, wherein the substance for detecting the expression level of LncRNA HOXC-AS3 is a specific primer or probe of LncRNA HOXC-AS 3.

3. The use according to claim 2, characterized in that the specific primers of LncRNA HOXC-AS3 are shown in SEQ ID No.1 and SEQ ID No. 2.

4. Use of a plasmid overexpressing LncRNA HOXC-AS3 for the preparation of a medicament for the treatment of osteoarthritis.