CN115252637B

CN115252637B - Gene inhibitor with liver cancer metastasis inhibiting function

Info

Publication number: CN115252637B
Application number: CN202210428795.0A
Authority: CN
Inventors: 曹爱华
Original assignee: Sheng Ke Reagent Apparatus Co ltd
Current assignee: Sheng Ke Reagent Apparatus Co ltd
Priority date: 2020-03-20
Filing date: 2020-03-20
Publication date: 2023-10-24
Anticipated expiration: 2040-03-20
Also published as: CN111349706B; CN115252637A; CN111349706A

Abstract

The invention provides a gene inhibitor with a liver cancer metastasis inhibiting function, and belongs to the technical field of biomedicine. Experiments show that the LINC01988 gene can effectively inhibit the EMT transformation, the cell migration and the invasion of liver cancer cells, thereby effectively inhibiting the metastasis of liver cancer. Therefore, the LINC01988 gene inhibitor can be used for preparing medicaments for treating liver cancer metastasis, thereby providing possibility for reducing liver cancer metastasis.

Description

Gene inhibitor with liver cancer metastasis inhibiting function

The scheme is a divisional application, and the name of the original application is: the application of the gene inhibitor in preparing the medicine for treating liver cancer is as follows: 2020-06-30, the application number of the original application is: cn202010200300.X.

Technical Field

The invention belongs to the technical field of biomedicine, and particularly relates to application of a gene inhibitor in preparation of a medicine for treating liver cancer.

Background

Liver cancer is one of the most common cancers in clinic at present. The annual mortality rate of liver cancer is the third in malignant tumors worldwide, the new incidence rate is the fifth in malignant tumors worldwide, and the occurrence of liver cancer has a tendency to increase rapidly. Liver cancer is associated with viral infections, nonalcoholic fatty liver disease, alcoholic hepatitis, genetic and environmental factors, and the like. Most liver cancer patients are diagnosed and treated in an advanced stage, so the survival rate of the patients is low. Early diagnosis and early treatment are key to improving survival rate of liver cancer patients.

While only a small number of genes in the human genome encode proteins, 98% of genes can be transcribed to form RNA, these RNA cannot be further ultimately formed into proteins, and RNA transcribed from these genes is known as non-coding RNA. However, recent studies have shown that these non-coding RNAs have gene regulatory functions. Long non-coding RNAs refer to non-coding RNAs greater than 200 bases in length, and are widely found in a variety of tissues, and can participate in a variety of vital function regulatory pathways such as cellular development and metabolism, including gene recombination, gene imprinting, cell cycle regulation, chromatin modification, transcription, translation, mRNA degradation, and the like. Existing studies indicate that differences in expression of long non-coding RNAs are often closely linked to the occurrence, progression, and postoperative recovery of patients. Some abnormally expressed long-chain non-coding RNA can be used as a gene diagnosis target of cancer, and can be used as early diagnosis of cancer patients and provide a new basis for judging the type of the cancer. Therefore, searching for a new liver cancer related LncRNA gene marker has important significance for realizing early diagnosis and treatment of liver cancer patients, and is also beneficial to development and utilization of liver cancer medicaments.

Disclosure of Invention

The invention aims to provide long-chain non-coding RNA which is highly expressed in liver cancer tissues and has diagnostic value, and simultaneously, the invention aims to provide a long-chain non-coding RNA gene inhibitor for preparing medicaments for treating liver cancer.

In order to achieve the above purpose, the present invention provides the following technical solutions:

the invention provides a liver cancer related biomarker, wherein the biomarker is LINC01988, and LINC01988 is highly expressed in liver cancer.

Preferably, the transcript of LINC01988 is NR_144436.1, and the sequence of LINC01988 is shown in SEQ ID NO. 1.

Secondly, the invention provides application of LINC01988 in preparation of a kit for diagnosing liver cancer.

Preferably, the kit is a real-time fluorescent quantitative PCR kit; the real-time fluorescence quantitative PCR kit comprises a primer pair for detecting the LINC01988 expression quantity; the forward primer sequence of the primer pair is shown as SEQ ID NO.2, and the reverse primer sequence of the primer pair is shown as SEQ ID NO. 3.

In addition, the invention provides application of the LINC01988 gene inhibitor in preparing a pharmaceutical composition for treating liver cancer.

Preferably, the gene inhibitor is one of siRNA, chemically modified siRNA and shRNA.

Preferably, the gene inhibitor is an siRNA, the sense strand of the siRNA is SEQ ID NO.6, and the antisense strand of the siRNA is SEQ ID NO.7.

Preferably, the pharmaceutical composition further comprises a pharmaceutically acceptable pharmaceutical carrier.

In addition, the invention provides a LINC01988 gene inhibitor which is used for preparing a pharmaceutical composition for treating liver cancer.

The invention has the beneficial effects that:

the invention proves for the first time that the long-chain non-coding RNA LINC01988 is highly expressed in liver cancer tissues, and the detection of differential expression of LINC01988 beside cancer and in liver cancer tissues has excellent diagnostic value, so that the LINC01988 detection kit can be used for early diagnosis of liver cancer patients.

Secondly, according to the invention, through a cell scratch experiment, a Transwell laboratory experiment and a Western Blot experiment, the LINC01988 gene inhibitor can effectively inhibit the EMT transformation of liver cancer cells, thereby effectively inhibiting the metastasis of liver cancer. Therefore, the LINC01988 gene inhibitor can be used for preparing medicaments for treating liver cancer, thereby opening up a new way for developing the medicaments for treating liver cancer.

Drawings

FIG. 1 shows the expression of LINC01988 in liver cancer tissue and in paracancestor tissue.

FIG. 2 is a ROC curve showing the expression of LINC01988 in liver cancer tissue and in paracancestral tissue.

FIG. 3 is the effect of LINC01988 transfected LINC01988 siRNA on LINC01988 expression in liver cancer HepG2 cells.

Fig. 4 is a scratch test for detecting the influence of the interference LINC01988 on liver cancer HepG2 cell migration.

FIG. 5 is a graph showing the effect of Transwell experiments to detect the interference LINC01988 on liver cancer HepG2 cell migration and cell invasion.

FIG. 6 is a graph showing the effect of LINC01988 on expression of liver cancer HepG2 cell EMT related proteins N-cadherein and Vimentin proteins.

Detailed Description

The invention will now be described in further detail with reference to the drawings and examples. The following examples are only illustrative of the present invention and are not intended to limit the scope of the invention. Unless otherwise indicated, the techniques of the present invention are conventional techniques of molecular biology or cell biology, wherein the enzymes, reagents and reaction conditions involved can be reasonably selected according to the experience of the skilled person, wherein the reagent consumables involved belong to the commercial common products, and the detection means and instruments involved are well known and well known to the skilled person.

Example 1

Detection of LINC01988 expression in liver cancer tissue and paracancerous tissue

1. Study object

And selecting 20 liver cancer tissues and corresponding tissues beside the cancer for experiments, wherein the tissues are derived from Qingdao tumor hospitals, all tissue specimens are inspected and approved by the ethical committee of the hospitals, and all patients from the tissue specimens sign informed consent. The liver cancer tissue is proved to be liver cancer by pathological detection (when the liver cancer tissue is resected, the patient is not treated by chemotherapy, radiotherapy and the like).

The specific samples are as follows:

2. tissue RNA extraction

(1) Taking out a tissue sample from a refrigerator at the temperature of minus 80 ℃, putting about 50mg of the tissue sample into a mortar, adding a small amount of liquid nitrogen, rapidly grinding, adding a small amount of liquid nitrogen again for grinding after the tissue becomes soft, and repeating the steps for three times;

(2) Adding 1mL Trizol, homogenizing for 2 min by using an automatic homogenizer, transferring the tissue sample into a centrifuge tube after homogenization is finished, and standing at room temperature for 5min;

(3) Centrifuging at 12000rpm for 5min, collecting supernatant, and removing precipitate;

(4) Adding 0.2mL of chloroform, shaking and uniformly mixing, and standing at room temperature for 15 minutes;

(5) Centrifuging at 12000rpm at 4deg.C for 15min;

(6) Transferring the supernatant to another centrifuge tube, adding isopropyl alcohol precooled in equal volume, mixing uniformly, and standing on ice for 8 minutes;

(7) Centrifuging at 12000rpm at 4deg.C for 10min, removing supernatant, and retaining precipitate;

(8) Adding 1ml of 75% ethanol into the sediment, gently shaking the centrifuge tube, and suspending the sediment;

(9) Centrifugation was performed at 8000rpm at 4℃for 5 minutes, and the supernatant was carefully removed using a pipette;

(10) Standing at room temperature for 10min to dry RNA, and then dissolving the precipitate with 50. Mu.L DEPC water;

(11) The purity and concentration of total RNA of the tissue was determined using a micro-UV spectrophotometer.

3. Reverse transcription to obtain cDNA

The reverse transcription reaction is referred to the instructions of TaKaRa reverse transcription kit

(1) Removal of genomic DNA

The reaction reagent: 5X gDNA Eraser Buffer 2.0.0. Mu.L,

gDNA Eraser 1.0μL，

Total RNA 1.0μg，

RNase Free dH2O up to 10.0μL。

reaction conditions: 42℃for 2 min and 4 ℃.

(2) Reverse transcription reaction

The reaction reagent: 10.0 mu L of the reaction liquid in the step (1),

PrimeScript RT Enzyme Mix I 1.0μL，

RT Primer Mix 1.0 μL，

5×PrimeScript Buffer 2 4.0 μL，

RNase Free dH2O 4.0 μL。

reaction conditions: 37℃for 15 minutes, 85℃for 5 seconds, 4 ℃.

4. Fluorescent quantitative PCR detection

SYBR Green Premix Ex Taq (2X) 10.0. Mu.l of the reaction reagent,

forward primer: 0.4. Mu.L of the total amount,

reverse primer: 0.4. Mu.L of the total amount,

2.0. Mu.L of cDNA template,

ddH2O 7.2μL。

reaction conditions: 95 ℃ for 10min; 15s at 95 ℃ and 60s at 60 ℃ for 40 cycles; and 75 ℃ for 5min.

By 2 ^-△△Ct The method processes real-time quantitative PCR data and calculates the expression change of LINC 01988.

LINC01988 primer sequence

Forward primer 5'-GGACAGCTGCCAGAGAATGA-3' (SEQ ID NO. 2)

5’‐ GCTCAGTGGCATAGGGAGTG-3’ (SEQ ID NO.3)

GAPDH primer sequence

Forward primer 5'-ACAACTTTGGTATCGTGGAAGG-3' (SEQ NO: 4)

Reverse primer 5'-GCCATCACGCCACAGTTTC-3' (SEQ NO: 5)

Experimental results

As shown in the results of the relative expression amounts of LINC01988 in the liver cancer tissue and the cancer side tissue in FIG. 1, the relative expression amount of LINC01988 in the liver cancer tissue (4.75+ -0.57) is obviously higher than that in the cancer side tissue, and the difference has statistical significance (P < 0.0001).

The ROC curve of LINC01988 relative expression was plotted using GraphPad prism5, and the results are shown in fig. 2. The ACU value of LINC01988 is 0.9088 (Std. Error 0.05008; 95% confidence interval 0.8106 to 1.007;P < 0.0001), which shows that the detection of LINC01988 expression difference in liver cancer tissue and cancer tissue has a useful diagnostic value.

Example 2

LINC01988 siRNA interference efficiency detection

The si-LINC01988 sequence is

Sense strand: CACCGUGUUUCUUACUGAAGA (SEQ ID NO. 6)

Antisense strand: UUCAGUAAGAAACACGGUGGA (SEQ ID NO. 7)

2. Cell culture

Human hepatoma cells HepG2 were cultured in high-sugar DMEM medium (10% fetal bovine serum), under the following conditions: cell constant temperature incubator 37 ℃,5% CO ₂ 。

siRNA transfection

(1) The day before transfection will be 2X 10 ⁵ Inoculating HepG2 cells of (2) to a 6-hole cell culture plate, culturing in a 5% CO2 cell constant temperature incubator at 37 ℃ for 24 hours, and transfecting the cells according to Lipofectamine 2000 instruction;

(2) The experiments were grouped into control groups (Lipofectamine 2000, idle stain), si-NC, si-LINC01988, each with 3 replicates.

4. Interference efficiency of LINC01988 by fluorescence quantitative PCR detection

(1) Total RNA extraction from cells

Adding 500 mu L of Trizol into each well of a 6-well cell culture plate, standing at room temperature for 5 minutes, fully lysing, and transferring to a centrifuge tube;

the remaining steps are identical to the tissue RNA extraction step of example 1 (corresponding addition is scaled by half).

(2) The reverse transcription reaction procedure and conditions were the same as in example 1.

(3) The fluorescent quantitative PCR detection procedure and conditions were the same as in example 1.

Experimental results

The experimental results are shown in fig. 3, and it can be seen that si-LINC01988 can significantly inhibit the expression of LINC01988 with an inhibition rate of 82.3%.

Example 3

Cell scratch assay

(1) HepG2 cells transfected with si-NC and si-LINC01988 were seeded into 6-well plates;

(2) When the cell density reached 85%, the adherent cell layer was gently slid in the vertical direction of the culture well using a 200 μl gun head, and the detached cells were washed off using PBS;

(3) Scratches were photographed under an inverted microscope at 0h and 24h, respectively.

Experimental results

As shown in fig. 4, the migration distance of the si-LINC01988 group is significantly smaller than that of the si-NC group, which indicates that inhibition of LINC01988 can inhibit the cell migration ability of liver cancer cell HepG 2.

Example 4

Transwell cell migration experiments

(1) Digestion of HepG2 cells transfected with si-NC and si-LINC01988, washing the cells with PBS, then suspending the cells with serum-free medium, and cell counting;

(3) 600. Mu.L of a medium containing 10% serum was placed in the lower chamber of the Transwell chamber, and 100. Mu.L of a medium containing 2.5X10 were placed in the upper chamber ⁴ The cell suspension of each cell is continuously cultured in a cell culture box for 24 hours;

(4) Carefully remove the Transwell chamber with forceps, blot the upper chamber liquid, transfer the Transwell chamber to a culture plate with 800 μl methanol added, and fix at room temperature for 30 min;

(5) Taking out the Transwell chamber, sucking up the upper chamber fixing solution, transferring the upper chamber fixing solution into a hole with 800 mu L of Giemsa dye solution added in advance, and dyeing for 20 minutes at room temperature;

(6) The Transwell chamber was taken out, soaked 3 times with clear water, the upper chamber liquid was aspirated, the cells on the surface of the membrane at the bottom of the upper chamber were carefully wiped off with a cotton swab, and photographed under a microscope.

As shown in the cell migration of FIG. 5, it can be seen that the number of cells passing through the Transwell chamber in the si-LINC01988 group is smaller than the number of cells passing through the Transwell chamber in the si-NC group, indicating that inhibition of LINC01988 can inhibit migration of liver cancer cells.

Example 5

(1) The solid Matrigel glue is placed at 4 ℃ overnight to be melted into a liquid state;

(2) Sucking 200 mu L of serum-free culture medium by a pipette, adding 40 mu L of Matrigel, uniformly mixing on ice, adding 100 mu L of Matrigel after uniform mixing into the upper chamber of a Transwell chamber, and placing into an incubator for incubation for 4 hours until the Matrigel is completely solid;

(3) HepG2 cells transfected with si-NC and si-LINC01988 were digested and the cells were washed with PBS, after which the cells were suspended using serum-free medium and counted;

(4) 600. Mu.L of a medium containing 10% serum was placed in the Transwell lower chamber, and 100. Mu.L of a medium containing 2.5X10 were placed in the upper chamber ⁴ Cell suspensions of individual cells were cultured in a cell incubator for a further 24 hours;

(5) Carefully remove the Transwell chamber with forceps, blot the upper chamber liquid, then transfer the Transwell chamber to a culture plate with 800 μl methanol added, and fix at room temperature for 30 min;

(6) Taking out the Transwell chamber, sucking up the upper chamber fixing solution, transferring the upper chamber fixing solution into a hole with 800 mu L of Giemsa dye solution added in advance, and dyeing for 20 minutes at room temperature;

(7) Washing with clear water for 3 times, taking out the Transwell chamber, sucking the liquid in the upper chamber, carefully wiping the cells on the surface of the bottom membrane of the upper chamber with a cotton stick, and taking a picture under a microscope.

As shown in the cell invasion of FIG. 6, the cell number of the si-LINC01988 group passing through Matrigel gel and the Transwell chamber was smaller than that of the si-NC group, which indicates that inhibition of LINC01988 can inhibit migration of liver cancer cells.

Example 6

Western Blot experiments

(1) The day before transfection will be 2X 10 ⁵ HepG2 cells of (C) were seeded on 6-well plates at 37℃with 5% CO ₂ After 24h of culture in a cell incubator, cells were transfected with reference to Lipofectamine 2000 instructions, the experiments were grouped into si-NC groups, si-LINC01988 groups, each repeated 3 times;

(2) After 48h transfection, the cells were washed with PBS, 100 μl of RIPA cell lysate was added to each well, and lysed for 30 min;

(3) After full pyrolysis, transferring the pyrolysis liquid into a centrifuge tube, centrifuging for 10 minutes at 4 ℃ at 10000g/min, and taking the supernatant to a new centrifuge tube;

(4) Sucking 2 μl, quantifying protein by BCA method, adding 5 Xloading buffer to adjust protein sample to 2 μg/μl, and boiling in boiling water bath for 5min;

(5) Centrifuging at 12000rpm/min for 5 minutes to obtain a prepared protein sample;

(6) Assembling an electrophoresis tank, and configuring 5% of upper glue and 10% of lower glue;

(7) Adding 20 mug of protein sample and protein Marker indicator into each hole;

(8) Adding a newly configured electrophoresis buffer solution into the electrophoresis tank, starting electrophoresis under the condition of the upper glue voltage of 80v and the lower glue voltage of 120v, and ending electrophoresis when the bromophenol blue indicator moves to the bottom of the glue;

(9) Assembling a film transferring clamp, loading the film transferring clamp into a transfer tank filled with transfer liquid, and transferring the film for 1.5h at 250 mA;

(10) Transferring the PVDF film after film transfer to 5% skimmed milk powder, and sealing for 1h at room temperature;

(11) TBST membrane washing is carried out for 3 times, each time is carried out for 5min, beta-actin, E-cadherin, N-cadherin and Vimentin primary anti-dilution liquid are incubated, and shaking table incubation is carried out at 4 ℃ overnight;

(12) Washing the membrane by TBST for 3 times, each time for 5min, incubating the secondary antibody, and incubating for 1h at room temperature in a shaking table;

(13) In the darkroom, the luminescent liquid is rapidly dripped on the PVDF film to carry out imaging.

Experimental results

As shown in FIG. 6, it can be seen from the graph that the protein expression levels of tumor EMT promoting proteins N-cadherein and Vimentin were down-regulated and the protein expression level of EMT inhibiting protein E-cadherein was up-regulated in the si-LINC1988 group compared to the si-NC group. The inhibition of LINC1988 can effectively inhibit the EMT transformation of liver cancer cells, thereby effectively inhibiting the metastasis of liver cancer.

In conclusion, the invention proves that the long-chain non-coding RNA LINC01988 is highly expressed in liver cancer tissues, so that the long-chain non-coding RNA LINC01988 can be used as a liver cancer marker for diagnosing liver cancer patients. Secondly, according to the invention, through a cell scratch experiment, a Transwell laboratory experiment and a Western Blot experiment, the LINC01988 gene inhibitor can effectively inhibit the EMT transformation of liver cancer cells, thereby effectively inhibiting the metastasis of liver cancer. Therefore, the LINC01988 gene inhibitor can be used for preparing medicaments for treating liver cancer.

SEQUENCE LISTING

<110> Qingdao Si Tuo New Source cytomedicine Co., ltd

<120> Gene inhibitor having liver cancer metastasis inhibiting function

<160> 7

<170> PatentIn version 3.5

<210> 1

<211> 866

<212> DNA

<213> Human source (Human)

<400> 1

gtcacaaagg tcagggacag ctgccagaga atgaagcaga gggctgtggg gtgaagggac 60 tgccagtctt ctgccactcc ttttcgtggt ccttcccttc actgccttcc ttctcccaga 120 cagactgggc atccagttcc aatccaaagg ctgccccttt gaccaggccc atcttctcca 180 cctcacatca gacagccaat cggctgccca gacctcgaaa cctcagtaac ctagaaggaa 240 atggaccttg gcaaacgtgt gtcaggagag gatgacttgg aggtgtccac cgtgtttctt 300 actgaagatg tctaaaagtc aattggggtc aaggaacaag cctctactca catgcatgtg 360 ggcaaatgaa gtcacagaac aaataaccta ccctgcatcc aggcacggag tccagggaca 420

ccccctgctg ctgcctaaga gaaagtggcc caagaagcac tggcccggtg cctgctgatg 480 ccaggagccc tctgctactg cctgacacaa gcatcctgcg cttccccctc ccaggccctc 540 cccgaaagcg tgggccacag gtaccactcc ctatgccact gagccccaca tttcccatcc 600 cccaagccac tcccaccagc cccagagctt tcctacattt atgatttgtc caaaaatgtg 660 atgcccttca gcccccagaa ggtcatcctc caggctgtga tcgtcacaca gggggtccca 720 catggggtcc tcacaggcct tcaacccagc acaaatcgtg gcctggtttg acctttgaaa 780 tatctcaaca tctaaaattc agagcttttt tggaatattt attttccata gatataattc 840

tttcaaataa attccttaga aaacaa 866

<210> 2

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 2

ggacagctgc cagagaatga 20

<210> 3

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 3

gctcagtggc atagggagtg 20

<210> 4

<211> 22

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 4

acaactttgg tatcgtggaa gg 22

<210> 5

<211> 19

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 5

gccatcacgc cacagtttc 19

<210> 6

<211> 21

<212> RNA

<213> Artificial sequence (Artificial Sequence)

<400> 6

caccguguuu cuuacugaag a 21

<210> 7

<211> 21

<212> RNA

<213> Artificial sequence (Artificial Sequence)

<400> 7

uucaguaaga aacacggugg a 21

Claims

The application of the LINC01988 gene inhibitor in preparing medicines for inhibiting liver cancer cell metastasis is characterized in that the sequence of LINC01988 is shown as SEQ ID NO.1, the gene inhibitor is siRNA, the sense strand of the siRNA is SEQ ID NO.6, and the antisense strand of the siRNA is SEQ ID NO.7.
2. The use of claim 1, wherein the medicament further comprises a pharmaceutically acceptable pharmaceutical carrier.
3. The use according to claim 2, wherein the pharmaceutical carrier is a mixture of one or more of a binder, a diluent, a surfactant or a filler.
4. The use according to claim 1, wherein the gene inhibitor is capable of inhibiting the expression of N-cadherein and Vimentin proteins in liver cancer cells.
5. The use according to claim 1, wherein the gene inhibitor is capable of promoting expression of E-cadherein protein in liver cancer cells.