CN115252637A

CN115252637A - Gene inhibitor with liver cancer metastasis inhibiting function

Info

Publication number: CN115252637A
Application number: CN202210428795.0A
Authority: CN
Inventors: 曹爱华
Original assignee: Qingdao Situo Xinyuan Cell Medicine Co ltd
Current assignee: Sheng Ke Reagent Apparatus Co ltd
Priority date: 2020-03-20
Filing date: 2020-03-20
Publication date: 2022-11-01
Anticipated expiration: 2040-03-20
Also published as: CN111349706B; CN111349706A; CN115252637B

Abstract

The invention provides a gene inhibitor with a function of inhibiting liver cancer metastasis, belonging to the technical field of biomedicine. Experiments show that the invention can effectively inhibit EMT transformation, cell migration and invasion of liver cancer cells by inhibiting the LINC01988 gene, thereby effectively inhibiting the transfer of liver cancer. Therefore, the LINC01988 gene inhibitor can be used for preparing a medicament for treating liver cancer metastasis, so that the possibility of reducing liver cancer metastasis is provided.

Description

Gene inhibitor with function of inhibiting liver cancer metastasis

The scheme is a divisional application, and the original application name is as follows: the application of a gene inhibitor in the preparation of a medicament for treating liver cancer is as follows: 2020-06-30, the application number of the original application is: cn202010200300.X.

Technical Field

The invention belongs to the technical field of biomedicine, and particularly relates to application of a gene inhibitor in preparation of a medicament for treating liver cancer.

Background

Liver cancer is one of the most common cancers in clinical practice at present. The annual mortality rate of liver cancer is the third place of malignant tumors all over the world, the new morbidity rate of liver cancer is the fifth place of malignant tumors all over the world, and the occurrence of liver cancer shows a rapidly increasing trend. The incidence of liver cancer is related to viral infection, non-alcoholic fatty liver, alcoholic hepatitis, genetic and environmental factors, etc. The majority of liver cancer patients are diagnosed and treated at an advanced stage, so the survival rate of the patients is low. Early diagnosis and early treatment are the key points for improving the survival rate of liver cancer patients.

In the human genome, only a few genes encode proteins, and 98% of the genes can be transcribed to form RNA, but the RNA cannot further form proteins, and the RNA formed by transcription of the genes is called non-coding RNA. However, recent studies have shown that these non-coding RNAs have gene regulatory functions. The long non-coding RNA refers to non-coding RNA with the length of more than 200 basic groups, and the long non-coding RNA is widely present in various tissues, and can participate in various vital function regulation and control ways such as cell development and metabolism, including gene recombination, gene imprinting, cell cycle regulation and control, chromatin modification, transcription, translation, mRNA degradation and the like. Existing studies indicate that differences in expression of long non-coding RNAs are often closely linked to the development, progression, and post-operative recovery of patients. Some abnormally expressed long non-coding RNAs can be used as gene diagnosis targets of cancers, and can be used as early diagnosis of cancer patients and provide new bases for judging the types of cancers. Therefore, the search for a new LncRNA gene marker related to liver cancer has important significance for realizing early diagnosis and treatment of liver cancer patients, and is also beneficial to development and utilization of liver cancer drugs.

Disclosure of Invention

The invention aims to provide a long-chain non-coding RNA which is highly expressed in liver cancer tissues and has diagnostic value, and simultaneously aims to provide a long-chain non-coding RNA gene inhibitor for preparing a medicament for treating liver cancer.

In order to achieve the purpose, the invention provides the following technical scheme:

the invention provides a biomarker related to liver cancer, wherein the marker is LINC01988, and the LINC01988 is highly expressed in the liver cancer.

Preferably, the transcript of LINC01988 is NR _144436.1, and the sequence of LINC01988 is shown in SEQ ID No. 1.

Secondly, the invention provides application of LINC01988 in preparing a kit for diagnosing liver cancer.

Preferably, the kit is a real-time fluorescent quantitative PCR kit; the real-time fluorescent quantitative PCR kit comprises a primer pair for detecting the LINC01988 expression quantity; the forward primer sequence of the primer pair is shown as SEQ ID NO.2, and the reverse primer sequence of the primer pair is shown as SEQ ID NO. 3.

In addition, the invention provides application of the LINC01988 gene inhibitor in preparing a pharmaceutical composition for treating liver cancer.

Preferably, the gene inhibitor is one of siRNA, chemically modified siRNA and shRNA.

Preferably, the gene inhibitor is siRNA, the sense strand of the siRNA is SEQ ID NO.6, and the antisense strand of the siRNA is SEQ ID NO.7.

Preferably, the pharmaceutical composition further comprises a pharmaceutically acceptable pharmaceutical carrier.

In addition, the invention provides a LINC01988 gene inhibitor which is used for preparing a pharmaceutical composition for treating liver cancer.

The invention has the beneficial effects that:

the invention proves that the long-chain non-coding RNA LINC01988 is highly expressed in the liver cancer tissue for the first time, and the detection of the differential expression beside the LINC01988 and in the liver cancer tissue has excellent diagnosis value, so that the LINC01988 detection kit can be used for early diagnosis of liver cancer patients.

Secondly, the cell scratching experiment, the Transwell chamber experiment and the Western Blot experiment prove that the LINC01988 gene inhibitor can effectively inhibit the EMT transformation of the liver cancer cells, thereby effectively inhibiting the transfer of liver cancer. Therefore, the LINC01988 gene inhibitor can be used for preparing a liver cancer treatment drug, so that a new way is opened for the development of the liver cancer treatment drug.

Drawings

FIG. 1 shows the expression of LINC01988 in liver cancer tissue and tissue adjacent to the cancer.

FIG. 2 is a ROC curve of LINC01988 expression in liver cancer tissue and paracancerous tissue.

FIG. 3 shows the effect of LINC01988 transfected LINC01988 siRNA on LINC01988 expression in liver cancer HepG2 cells.

FIG. 4 shows the effect of interference LINC01988 on liver cancer HepG2 cell migration in a scratch test.

FIG. 5 shows the effect of interference LINC01988 on liver cancer HepG2 cell migration and cell invasion detected by Transwell experiment.

FIG. 6 shows the interference of LINC01988 on the expression of EMT-related protein N-cadherin and Vimentin in HepG2 cells of liver cancer.

Detailed Description

The present invention will be described in further detail with reference to the accompanying drawings and examples. The following examples are intended to illustrate the invention only and are not intended to limit the scope of the invention. Unless otherwise indicated, the techniques of the present invention are all conventional techniques in molecular biology or cell biology, wherein the enzymes, reagents and reaction conditions involved can be reasonably selected according to the experience of those skilled in the art, wherein the reagent consumables are common products on the market, and the detection means and instruments involved are all well known and well-understood by those skilled in the art.

Example 1

Detecting the expression condition of LINC01988 in liver cancer tissues and tissues beside the cancer

1. Study object

20 liver cancer tissues and corresponding tissues beside the cancer are selected for experiments, the tissues are from tumor hospitals in Qingdao city, all tissue specimens are examined and approved by ethical committees of hospitals, and patients from all tissue specimens sign informed consent. Pathological examination of liver cancer tissue proves that the liver cancer is liver cancer (when the liver cancer tissue is removed, patients are not treated by chemotherapy, radiotherapy and the like).

The concrete samples are as follows:

2. tissue RNA extraction

(1) Taking out the tissue specimen from a refrigerator at the temperature of-80 ℃, putting about 50mg of the tissue specimen into a mortar, adding a small amount of liquid nitrogen, quickly grinding, adding a small amount of liquid nitrogen again for grinding after the tissue becomes soft, and repeating for three times;

(2) Adding 1mL of Trizol, homogenizing for 2 minutes by using an automatic homogenizer, transferring the tissue specimen into a centrifuge tube after the homogenization is finished, and standing for 5 minutes at room temperature;

(3) Centrifuging at 12000rpm for 5min, collecting supernatant, and removing precipitate;

(4) Adding 0.2mL of chloroform, shaking and mixing uniformly, and standing for 15 minutes at room temperature;

(5) Centrifuging at 12000rpm at 4 deg.C for 15min;

(6) Transferring the supernatant into another centrifuge tube, adding equal volume of precooled isopropanol, mixing uniformly, and standing for 8 minutes on ice;

(7) Centrifuging at 12000rpm at 4 deg.C for 10min, removing supernatant, and retaining precipitate;

(8) Adding 1ml of 75% ethanol into the precipitate, gently shaking the centrifuge tube, and suspending the precipitate;

(9) Centrifuging at 8000rpm at 4 ℃ for 5 minutes, and carefully removing supernatant by using a pipette;

(10) The RNA was dried by standing at room temperature for 10 minutes, and then the precipitate was dissolved with 50. Mu.L of DEPC water;

(11) The purity and concentration of total RNA from the tissue was determined using a micro uv spectrophotometer.

3. Reverse transcription to obtain cDNA

Reverse transcription reaction is referred to TaKaRa reverse transcription kit instruction

(1) Removal of genomic DNA

Reaction reagents: 5 XgDNA Eraser Buffer 2.0. Mu.L,

gDNA Eraser 1.0μL，

Total RNA 1.0μg，

RNase Free dH2O up to 10.0μL。

reaction conditions are as follows: 42 ℃ for 2 minutes, 4 ℃.

(2) Reverse transcription reaction

Reaction reagents: 10.0. Mu.L of the reaction solution in the step (1),

PrimeScript RT Enzyme Mix I 1.0μL，

RT Primer Mix 1.0 μL，

5×PrimeScript Buffer 2 4.0 μL，

RNase Free dH2O 4.0 μL。

reaction conditions are as follows: 15 minutes at 37 ℃,5 seconds at 85 ℃ and 4 ℃.

4. Fluorescent quantitative PCR detection

SYBR Green Premix Ex Taq (2X) 10.0. Mu.l,

a forward primer: the volume of the solution is 0.4 mu L,

reverse primer: 0.4 mu L of the suspension liquid is prepared,

the cDNA template was 2.0. Mu.L,

ddH2O 7.2μL。

reaction conditions are as follows: 10min at 95 ℃; 40 cycles of 95 ℃ 15s,60 ℃ 60s; 5min at 75 ℃.

By using 2^-△△CtThe method processes real-time quantitative PCR data and calculates the expression change of LINC 01988.

The primer sequence of LINC01988 is

Forward primer 5 'GGACAGCTGCTGCCAGAGAATGA-3' (SEQ ID NO. 2)

5’‐ GCTCAGTGGCATAGGGAGTG-3’ (SEQ ID NO.3)

The GAPDH primer sequence is

Forward primer 5 'ACAACTTTGGTATCGTGGAAGG-3' (SEQ NO: 4)

Reverse primer 5 'GCCATCACGCCACAGTTC-3' (SEQ NO: 5)

Results of the experiment

The results of the relative expression level of LINC01988 in the liver cancer tissue and the tissue beside the cancer are shown in FIG. 1, and it can be seen that the relative expression level (4.75 +/-0.57) of LINC01988 in the liver cancer tissue is significantly higher than that in the tissue beside the cancer, and the difference has statistical significance (P < 0.0001).

A ROC curve of relative expression of LINC01988 was plotted using GraphPad prism5, and the results are shown in FIG. 2. The ACU value of LINC01988 is 0.9088 (Std. Error 0.05008; 95% confidence interval 0.8106 to 1.007; P < 0.0001), which indicates that the detection of the difference of the expression level of LINC01988 in the liver cancer tissue and the tissue beside the cancer has a beneficial diagnostic value.

Example 2

Detection of interference efficiency of LINC01988 siRNA

si-LINC01988 sequence is

Sense strand: CACCGGUGUUCUUACUGAAGA (SEQ ID NO. 6)

Antisense strand: UUCAGUAAAACACGGUGGA (SEQ ID NO. 7)

2. Cell culture

The human liver cancer cell HepG2 is cultured by adopting a high-glucose DMEM culture solution (10% fetal calf serum), and the culture conditions are as follows: cell constant temperature incubator 37 deg.C, 5% CO₂。

siRNA transfection

(1) 2X 10 day before transfection⁵The HepG2 cells are inoculated on a 6-hole cell culture plate, cultured for 24 hours in a constant-temperature incubator with 5% CO2 cells at 37 ℃, and then transfected according to the specification of Lipofectamine 2000;

(2) The experiments were grouped into control (Lipofectamine 2000, idle stain), si-NC, si-LINC01988, with 3 replicates per group.

4. Fluorescent quantitative PCR detection of interference efficiency of LINC01988

(1) Total RNA extraction from cells

Adding 500 mu L Trizol into each hole of a 6-hole cell culture plate, standing at room temperature for 5 minutes, fully cracking, and transferring to a centrifuge tube;

the remaining steps were identical to the tissue RNA extraction step of example 1 (the respective amounts added were halved in proportion).

(2) The reverse transcription reaction procedure and conditions were the same as in example 1.

(3) The fluorescent quantitative PCR detection procedure and conditions were the same as in example 1.

Results of the experiment

The experimental result is shown in figure 3, and it can be seen that si-LINC01988 can significantly inhibit the expression of LINC01988, and the inhibition rate is 82.3%.

Example 3

Cell scratch test

(1) Inoculating the si-NC and si-LINC01988 transfected HepG2 cells into a 6-well plate;

(2) When the cell density reaches 85%, lightly sliding the adherent cell layer in the vertical direction of the culture hole by using a 200-microliter gun head, and washing off the fallen cells by using PBS;

(3) Scratches were photographed under an inverted microscope at 0h and 24h, respectively.

Results of the experiment

The experimental result is shown in figure 4, and it can be seen from the figure that the migration distance of the si-LINC01988 group is significantly smaller than that of the si-NC group, which indicates that the cell migration capability of the liver cancer cell HepG2 can be inhibited after the LINC01988 is inhibited.

Example 4

Transwell cell migration assay

(1) Digestion of si-NC and si-LINC01988 transfected HepG2 cells, washing of the cells with PBS, followed by suspension of the cells in serum-free medium and cell counting;

(3) 600. Mu.L of medium containing 10% serum was added to the lower chamber of the Transwell chamber and 100. Mu.L of medium containing 2.5X 10 serum was added to the upper chamber⁴Continuously culturing the cell suspension of each cell in a cell culture box for 24 hours;

(4) Carefully remove the Transwell chamber with forceps, blott the upper chamber, transfer the Transwell chamber to a plate containing 800. Mu.L of methanol, and fix at room temperature for 30 minutes;

(5) Taking out the Transwell chamber, sucking the upper chamber fixing solution, transferring the upper chamber fixing solution into a hole in which 800 mu L of Giemsa dye solution is added in advance, and dyeing for 20 minutes at room temperature;

(6) The Transwell chamber was removed, rinsed with clear water and soaked 3 times, the upper chamber liquid was aspirated, the cells on the membrane surface of the bottom of the upper chamber were carefully wiped off with a cotton swab, and the image was taken under a microscope.

The results of the experiment are shown in FIG. 5 for cell migration, and it can be seen that the number of cells passing through the Transwell chamber is smaller in the si-LINC01988 group than in the si-NC group, indicating that inhibition of LINC01988 inhibits migration of hepatoma cells.

Example 5

(1) Melting the solid Matrigel gel into liquid at 4 ℃ overnight;

(2) Sucking 200 mu L of serum-free medium by a pipette, adding 40 mu L of Matrigel glue, uniformly mixing on ice, adding 100 mu L of uniformly mixed Matrigel glue into the upper chamber of a Transwell chamber, putting the mixture into an incubator and incubating for 4 hours until the Matrigel glue is completely changed into a solid state;

(3) Digestion of si-NC and si-LINC01988 transfected HepG2 cells and washing of cells with PBS followed by suspension of cells with serum-free medium and cell counting;

(4) 600. Mu.L of medium containing 10% serum was added to the lower chamber of a Transwll and 100. Mu.L of medium containing 2.5X 10 serum was added to the upper chamber⁴Continuously culturing the cell suspension of each cell in a cell culture box for 24 hours;

(5) Carefully remove the Transwell chamber with forceps, blot the upper chamber liquid, then transfer the Transwell chamber to a plate containing 800. Mu.L of methanol and fix for 30 minutes at room temperature;

(6) Taking out the Transwell chamber, sucking the fixing solution in the upper chamber, transferring the fixing solution into a hole in which 800 mu L of Giemsa dye solution is added in advance, and dyeing for 20 minutes at room temperature;

(7) The cells were washed with clear water and soaked 3 times, the Transwell chamber was removed, the upper chamber liquid was aspirated, the cells on the membrane surface of the bottom of the upper chamber were carefully wiped off with a cotton swab, and the images were taken under a microscope.

The results of the experiment are shown in FIG. 6, which shows that the number of cells passing through Matrigel and Transwell chamber in si-LINC01988 group was less than that in si-NC group, indicating that the inhibition of LINC01988 could inhibit the migration of hepatoma cells.

Example 6

Western Blot experiment

(1) 2X 10 day before transfection⁵The HepG2 cells were seeded on 6-well plates at 37 ℃ with 5% CO₂After culturing for 24h in a cell incubator, transfecting cells according to Lipofectamine 2000 instructions, and grouping experiments into a si-NC group and a si-LINC01988 group, wherein each group is repeated for 3 times;

(2) After 48h of transfection, the cells were washed with PBS, 100. Mu.l of RIPA cell lysate was added to each well, and lysis was performed for 30 min;

(3) After full cracking, transferring the cracking solution into a centrifuge tube, centrifuging at 10000g/min and 4 ℃ for 10 minutes, and taking the supernatant to a new centrifuge tube;

(4) Sucking 2 mul, carrying out protein quantification by using a BCA method, adding 5 Xloading buffer solution to adjust the protein sample to be 2 mug/mul, and boiling in a boiling water bath for 5 minutes;

(5) Centrifuging at 12000rpm/min for 5 minutes to obtain a prepared protein sample;

(6) Assembling an electrophoresis tank, and preparing 5% of upper layer glue and 10% of lower layer glue;

(7) Adding 20 micrograms of protein sample and protein Marker indicator into each hole;

(8) Adding a newly configured electrophoresis buffer solution into the electrophoresis tank, starting electrophoresis under the conditions that the voltage of the upper layer gel is 80v and the voltage of the lower layer gel is 120v, and finishing electrophoresis when the bromophenol blue indicator moves to the bottom of the gel;

(9) Assembling a film transferring clamp, loading the film transferring clamp into a transferring groove filled with transferring liquid, and transferring the film for 1.5 hours at 250 mA;

(10) Transferring the PVDF membrane after membrane conversion into 5% skimmed milk powder, sealing for 1h at room temperature;

(11) Washing the membrane for 3 times by TBST, incubating beta-actin, E-cadherin, N-cadherin and Vimentin primary antibody diluent for 5min each time, and incubating overnight in a shaking table at 4 ℃;

(12) Washing the membrane for 3 times by TBST, each time for 5min, incubating the secondary antibody, and incubating for 1h in a shaking table at room temperature;

(13) In a dark room, the luminescent solution is quickly dripped on the PVDF membrane for developing.

Results of the experiment

The results of the experiments are shown in FIG. 6, from which it can be seen that the expression levels of the tumor EMT promoting proteins N-cadherin and Vimentin are down-regulated, while the expression level of the EMT inhibiting protein E-cadherin is up-regulated, in the si-NC group, in the si-LINC1988 group, as compared to the si-NC group. Therefore, the inhibition of LINC1988 can effectively inhibit the EMT transformation of the liver cancer cells, thereby effectively inhibiting the metastasis of the liver cancer.

In conclusion, the invention proves that the long-chain non-coding RNA LINC01988 is highly expressed in liver cancer tissues, and therefore, the long-chain non-coding RNA LINC01988 can be used as a liver cancer marker to diagnose liver cancer patients. Secondly, the cell scratch experiment, the Transwell chamber experiment and the Western Blot experiment prove that the LINC01988 gene inhibitor can effectively inhibit the EMT transformation of the liver cancer cells, thereby effectively inhibiting the transfer of the liver cancer. Therefore, the LINC01988 gene inhibitor can be used for preparing a medicament for treating liver cancer.

SEQUENCE LISTING

<110> Sino Situo New cell medicine Limited

<120> a gene inhibitor having a function of inhibiting liver cancer metastasis

<160> 7

<170> PatentIn version 3.5

<210> 1

<211> 866

<212> DNA

<213> Human source (Human)

<400> 1

gtcacaaagg tcagggacag ctgccagaga atgaagcaga gggctgtggg gtgaagggac 60

tgccagtctt ctgccactcc ttttcgtggt ccttcccttc actgccttcc ttctcccaga 120

cagactgggc atccagttcc aatccaaagg ctgccccttt gaccaggccc atcttctcca 180

cctcacatca gacagccaat cggctgccca gacctcgaaa cctcagtaac ctagaaggaa 240

atggaccttg gcaaacgtgt gtcaggagag gatgacttgg aggtgtccac cgtgtttctt 300

actgaagatg tctaaaagtc aattggggtc aaggaacaag cctctactca catgcatgtg 360

ggcaaatgaa gtcacagaac aaataaccta ccctgcatcc aggcacggag tccagggaca 420

ccccctgctg ctgcctaaga gaaagtggcc caagaagcac tggcccggtg cctgctgatg 480

ccaggagccc tctgctactg cctgacacaa gcatcctgcg cttccccctc ccaggccctc 540

cccgaaagcg tgggccacag gtaccactcc ctatgccact gagccccaca tttcccatcc 600

cccaagccac tcccaccagc cccagagctt tcctacattt atgatttgtc caaaaatgtg 660

atgcccttca gcccccagaa ggtcatcctc caggctgtga tcgtcacaca gggggtccca 720

catggggtcc tcacaggcct tcaacccagc acaaatcgtg gcctggtttg acctttgaaa 780

tatctcaaca tctaaaattc agagcttttt tggaatattt attttccata gatataattc 840

tttcaaataa attccttaga aaacaa 866

<210> 2

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

ggacagctgc cagagaatga 20

<210> 3

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

gctcagtggc atagggagtg 20

<210> 4

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

acaactttgg tatcgtggaa gg 22

<210> 5

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

gccatcacgc cacagtttc 19

<210> 6

<211> 21

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

caccguguuu cuuacugaag a 21

<210> 7

<211> 21

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

uucaguaaga aacacggugg a 21

Claims

The application of the LINC01988 gene inhibitor in preparing the medicine for inhibiting the metastasis of the hepatoma cells is characterized in that the LINC01988 has a sequence shown in SEQ ID No.1, the gene inhibitor is siRNA, a sense strand of the siRNA is SEQ ID No.6, and an antisense strand of the siRNA is SEQ ID No.7.
2. The use of claim 1, wherein the medicament further comprises a pharmaceutically acceptable pharmaceutical carrier.
3. The use according to claim 2, wherein the pharmaceutical carrier is a mixture of one or more of a binder, a diluent, a surfactant or a filler.
4. The use of claim 1, wherein the gene inhibitor is capable of inhibiting the expression of N-cadherin and Vimentin proteins in liver cancer cells.
5. The use of claim 1, wherein the gene inhibitor is capable of promoting the expression of E-cadherin protein in liver cancer cells.