CN111254146B - Application of LINC01331 gene inhibitor in preparation of medicine for treating lung cancer - Google Patents

Application of LINC01331 gene inhibitor in preparation of medicine for treating lung cancer Download PDF

Info

Publication number
CN111254146B
CN111254146B CN202010174969.6A CN202010174969A CN111254146B CN 111254146 B CN111254146 B CN 111254146B CN 202010174969 A CN202010174969 A CN 202010174969A CN 111254146 B CN111254146 B CN 111254146B
Authority
CN
China
Prior art keywords
linc01331
lung cancer
gene
gene inhibitor
lung
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Expired - Fee Related
Application number
CN202010174969.6A
Other languages
Chinese (zh)
Other versions
CN111254146A (en
Inventor
黄海森
张菁
刘玉敏
刘改丽
刘卡花
于淼林
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Sichuan Novoser Biotechnology Co ltd
Original Assignee
Sichuan Novoser Biotechnology Co ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Sichuan Novoser Biotechnology Co ltd filed Critical Sichuan Novoser Biotechnology Co ltd
Priority to CN202010174969.6A priority Critical patent/CN111254146B/en
Publication of CN111254146A publication Critical patent/CN111254146A/en
Application granted granted Critical
Publication of CN111254146B publication Critical patent/CN111254146B/en
Expired - Fee Related legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088—Compounds having three or more nucleosides or nucleotides
    • A61K31/713—Double-stranded nucleic acids or oligonucleotides
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K45/00—Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1135—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against oncogenes or tumor suppressor genes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/14—Type of nucleic acid interfering N.A.
    • C12N2310/141—MicroRNAs, miRNAs

Abstract

The invention provides application of a LINC01331 gene inhibitor in preparation of a medicine for treating lung cancer. The invention discovers that the LINC01331 gene is highly expressed in the lung cancer, so the LINC01331 gene can be used as an action target spot for treating the lung cancer; the LINC01331 gene inhibitor can inhibit lung cancer cell proliferation, inhibit lung cancer cell migration, and inhibit lung cancer cell invasion. The invention has the beneficial effects that the LINC01331 gene is found to be used as a treatment target of lung cancer for the first time, and the corresponding LINC01331 gene inhibitor is designed, so that a new direction is opened up for the development of lung cancer medicaments.

Description

Application of LINC01331 gene inhibitor in preparation of medicine for treating lung cancer
Technical Field
The invention belongs to the technical field of biomedicine, and particularly relates to application of a LINC01331 gene inhibitor in preparation of a medicine for treating lung cancer.
Background
Worldwide, the mortality rate of lung cancer is the first of all malignant tumors, and seriously threatens the health and life of human beings. Currently, the incidence and mortality of lung cancer is on the rise year by year trend in china. According to the clinical types of cases, lung cancer is classified into small cell lung cancer and non-small cell lung cancer. Among them, non-small cell lung cancer accounts for about 85% of lung cancer, and small cell lung cancer accounts for about 15%. Non-small cell lung cancer is further classified into adenocarcinoma of the lung, squamous carcinoma of the lung, and large cell carcinoma of the lung. Due to the lack of effective screening means, most lung cancer patients are diagnosed at an advanced stage of lung cancer, so that the survival time of the patients is only 15%. Currently, the main focus of lung cancer research is to find more efficient cancer coding and regulatory genes, and through the research on the gene action mechanism, the expression of the genes is regulated and controlled to effectively inhibit the development of lung cancer.
Long non-coding RNA refers to a molecule that is transcribed by RNA polymerase II, with a transcript length of more than 200nt, located in the nucleus or cytoplasm. Long non-coding RNAs generally cannot encode proteins because they lack meaningful open reading frames. In the past, it was generally believed that long non-coding RNAs were dark substances without any biological function, and were byproducts of the transcription process. However, with the progress of research, scientists have found that long-chain non-coding RNA plays a role in regulating in vivo as an important regulatory molecule of human genome, and the functional disorder is closely related to the occurrence and development of gastric cancer, lung cancer, liver cancer and other diseases. Some abnormally expressed long non-coding RNAs can be used as gene diagnosis targets of cancers, and can be used as early diagnosis of cancer patients and provide new bases for judging the types of cancers. Therefore, further elucidating the molecular basis of the long-chain non-coding RNA in lung cancer to search for a new therapeutic target and develop a new drug is the key for improving the effective prevention and treatment of lung cancer.
At present, the role of LINC01331 in lung cancer has not been reported.
Disclosure of Invention
The invention aims to provide a LINC01331 gene inhibitor for preparing a medicine for treating lung cancer.
In order to achieve the purpose, the invention provides a long-chain non-coding RNA, wherein the long-chain non-coding RNA is LINC01331, the sequence of the LINC01331 is shown as SEQ ID NO.1, the gene ID of the LINC01331 in Genebank is 104310351, and the transcript number of the gene is NR _ 126354.1.
Preferably, said LINC01331 is highly expressed in lung cancer.
In addition, the invention provides an application of a LINC01331 gene inhibitor in preparation of a lung cancer treatment drug, wherein the LINC01331 gene inhibitor is a molecule which is obtained by taking LINC01331 as an action target and has an inhibition effect on LINC 01331.
Preferably, the LINC01331 gene inhibitor is a nucleic acid molecule.
Preferably, the LINC01331 gene inhibitor is siRNA;
preferably, the sequence of the sense strand of the siRNA is shown as SEQ ID NO.10, and the sequence of the antisense strand of the siRNA is shown as SEQ ID NO. 11.
In addition, the invention provides siRNA, wherein the siRNA is an LINC01331 gene inhibitor; the siRNA inhibits the expression of LINC01331 in lung cancer; the sequence of the sense strand of the siRNA is shown as SEQ ID NO.10, and the sequence of the antisense strand of the siRNA is shown as SEQ ID NO. 11.
In addition, the invention provides a pharmaceutical composition for inhibiting and treating lung cancer, which is characterized in that the medicament comprises the LINC01331 gene inhibitor disclosed in claim 3, and the LINC01331 gene inhibitor is the only effective component or one of the effective components of the pharmaceutical composition for treating lung cancer.
Preferably, the pharmaceutical composition further comprises other pharmaceutically acceptable carriers and/or dressings.
Preferably, the carrier and/or dressing comprises one or more of an adhesive, a diluent, a surfactant and a filler.
Preferably, the form of the pharmaceutical composition for treating lung cancer is not limited, and may be liquid, solid, gel, aerosol.
Preferably, the dosage form of the medicine is any clinically acceptable dosage form, and can be injection, powder, capsule and spray.
Preferably, the pharmaceutical composition for treating lung cancer is administered in a form without limitation, and may be administered intravenously, orally, intramuscularly, and subcutaneously.
The invention has the beneficial effects that:
the invention discovers that LINC01331 is highly expressed in lung cancer tissues for the first time, and proves that LINC01331 can be used as an action target for treating lung cancer. Meanwhile, the gene inhibitor of LINC01331 is used for preparing the pharmaceutical composition for treating the lung cancer, and the gene inhibitor of LINC01331 is proved to be capable of inhibiting the proliferation, invasion and migration of lung cancer cells, so that the gene inhibitor has important clinical value and application prospect.
Drawings
FIG. 1 differential expression of LINC01331 in paracarcinoma and lung carcinoma tissues.
FIG. 2 real-time fluorescent quantitative PCR detection of the knockdown efficiency of si-RNA to LINC 01331.
FIG. 3 Effect of transfection of si-LINC01331-3 on proliferation-associated proteins C-myc and Cyclin-D1.
FIG. 4 Effect of transfected si-LINC01331-3 on cell proliferation of A549 cells.
FIG. 5 Effect of transfected si-LINC01331-3 on cell migration and cell proliferation of A549 cells.
Detailed Description
Example 1
The present invention will now be further described with reference to the following examples and accompanying drawings, before further description of embodiments of the invention, it is to be understood that the scope of the invention is not limited to the specific embodiments described below; it is also to be understood that the terminology used in the examples is for the purpose of describing particular embodiments only, and is not intended to limit the scope of the present invention. Test methods in which specific conditions are not specified in the following examples are generally carried out under conventional conditions or under conditions recommended by the respective manufacturers. The reagents and drugs mentioned in the examples are all common commercial products unless otherwise specified.
Example 1
20 lung adenocarcinoma tissues and corresponding tissues beside the lung adenocarcinoma tissues are selected for experiments, the tissues are from Central hospitals in Qingdao City, all tissue specimens are examined and approved by ethical committees of hospitals, and patients from all tissue specimens sign informed consent. The lung adenocarcinoma tissue is verified by pathological detection (when the lung adenocarcinoma tissue is removed, the patient is not treated by chemotherapy, radiotherapy and the like).
The concrete samples are as follows:
sample numbering Tumor type Age diagnosis Sex M stages N stages
1 Adenocarcinoma of lung 67 For male M0 N0
2 Adenocarcinoma of lung 78 Woman M0 N1
3 Adenocarcinoma of lung 65 For male M0 N0
4 Adenocarcinoma of lung 70 For male M0 N2
5 Adenocarcinoma of lung 58 For male M0 N0
6 Adenocarcinoma of lung 75 Woman M0 N2
7 Adenocarcinoma of lung 66 For male M0 N1
8 Adenocarcinoma of lung 76 Woman M0 N0
9 Adenocarcinoma of lung 48 Woman M0 N3
10 Adenocarcinoma of lung 74 Woman M0 N0
11 Adenocarcinoma of lung 60 For male M0 N0
12 Adenocarcinoma of lung 51 Woman M0 N0
13 Adenocarcinoma of lung 57 For male M0 N2
14 Adenocarcinoma of lung 68 For male M0 N2
15 Adenocarcinoma of lung 40 For male M0 N0
16 Adenocarcinoma of lung 43 For male M0 N0
17 Adenocarcinoma of lung 72 For male M0 N1
18 Adenocarcinoma of lung 59 Woman M0 N0
19 Adenocarcinoma of lung 83 For male M0 N0
20 Adenocarcinoma of lung 50 For male M0 N2
2. Tissue RNA extraction
(1) Taking out lung adenocarcinoma tissue and tissue beside the lung adenocarcinoma tissue from a refrigerator at the temperature of-80 ℃, putting 50mg of the tissue into a mortar, adding liquid nitrogen, and grinding;
(2) adding 1ml Trizol, mixing well, transferring to a centrifuge tube, and standing at room temperature for 5 min;
(3) placing in a centrifuge, centrifuging at 12000rpm for 5min, removing precipitate, and keeping supernatant;
(4) adding 200 μ l chloroform, mixing, standing at room temperature for 15 min;
(5) placing in a centrifuge, and centrifuging at 12000rpm for 5 min;
(6) transferring the supernatant to a new centrifuge tube, adding equal volume of precooled isopropanol, mixing uniformly, and standing on ice for 10 min;
(7) placing in a centrifuge, centrifuging at 12000rpm for 10min, removing supernatant, and retaining precipitate;
(8) adding 1ml of 75% ethanol into the precipitate, mixing with an oscillator, placing in a centrifuge at 4 deg.C and 7500rpm for 5 min;
(9) Removing supernatant, standing for 10min, and drying RNA precipitate;
(10) the precipitate was dissolved in 50. mu.l of DEPC water and the total RNA purity and concentration were determined.
3. Reverse transcription to obtain cDNA
(1) Removal of genomic DNA
A10. mu.l reaction system was prepared: 5 XgDNA Eraser Buffer 2.0. mu.l, gDNA Eraser 1. mu.l, Total RNA 1. mu.g, RNase Free dH2O up to 10. mu.l.
Reaction conditions are as follows: 42 ℃ for 2 minutes, 4 ℃.
(2) Reverse transcription reaction
Prepare 20. mu.l reaction system: 10. mu.l of the reaction solution of step (1), 1.0. mu.l of PrimeScript RT Enzyme Mix I, 1.0. mu.l of RT Primer Mix, 24.0. mu.l of 5 XPimeScript Buffer, and 4.0. mu.l of RNase FreedH 2O 4.0.
Reaction conditions of the PCR apparatus: 15 minutes at 37 ℃, 5 seconds at 85 ℃ and 4 ℃.
4. Fluorescent PCR detection
The operation was carried out according to TAKARA fluorescent quantitative PCR kit
Reaction reagents, SYBR Green Premix Ex Taq (2X) 10. mu.l, primer 10.4. mu.l, primer 20.4. mu.l, cDNA template 2. mu.l, ddH2O 7.2.2. mu.l were prepared.
Reaction conditions are as follows: 10min at 95 ℃; 35 cycles of 95 ℃ for 15s and 59 ℃ for 60 s; 5min at 60 ℃.
By using 2-△△CtThe method processes real-time quantitative PCR data and calculates the expression change of LINC 01331.
Primer sequences
LINC01331 primer is
Forward primer 5'-AAGTGAAGGCAGCGCTCTAA-3' (SEQ ID NO. 2)
Reverse primer 5'-CCAGTCATGTGTGGGAAACTTG-3' (SEQ ID NO. 3)
GAPDH primer is
Forward primer 5'-AATGGGCAGCCGTTAGGAAA-3' (SEQ ID NO.4)
Reverse primer 5'-ATCTAGGAAAAGCATCACCCGG-3' (SEQ ID NO.5)
Results
The result of the fluorescence quantitative PCR is shown in FIG. 1, and it can be seen from FIG. 1 that the relative expression amount of LINC01331 in lung adenocarcinoma is 5.028 + -0.517, which is significantly higher than that of the tissue beside cancer, and the difference is statistically different (P < 0.05), compared with the tissue beside cancer, which indicates that LINC01331 can be used as a target for preparing a drug for treating lung adenocarcinoma.
Example 2
Verification of LINC01331 gene siRNA
siRNA sequence design
si- LINC01331-1
Sense strand AAUAAGGUGUUAAUUGGUCUC (SEQ ID NO. 6)
Antisense strand GACCAAUUAACACCUUAUUUU (SEQ ID NO. 7)
si- LINC01331-2
Sense strand UUAAAAGCGGUCUUUUGUGAG (SEQ ID NO. 8)
Antisense strand CACAAAAGACCGCUUUUAAAG (SEQ ID NO. 9)
si-LINC01331-3
Sense strand UCAAGUUUGGUUAAAGCUCCA (SEQ ID NO. 10)
Antisense strand GAGCUUUAACCAAACUUGAGU (SEQ ID NO. 11)
2. Cell culture
Human non-small cell lung cancer cell A549, cultured in high-glucose DMEM (DMEM) culture medium (10% fetal bovine serum), and cultured in a constant-temperature cell culture box at 37 ℃ and 5% CO 2.
Transfection with siRNA
(1) 2X 10 day before transfection 5The A549 cells of (1) were inoculated on a 6-well plate, cultured for 24 hours, and then transfected with the cells according to the Lipofectamine 2000 instructions;
(2) the experimental groups were divided into control group (idle), si-NC group, si-LINC 01331-1 group, si-LINC 01331-2 group, and si-LINC01331-3 group.
4. Fluorescent quantitative PCR detection of LINC01331 gene expression after interference
(1) Total RNA extraction from cells
Adding 500 ul Trizol into each hole of a 6-hole cell culture plate, standing at room temperature for 5 minutes, fully cracking, and transferring to a centrifuge tube;
the remaining steps were the same as the tissue RNA extraction step of example 1 (the respective amounts added were modified proportionally).
Results
As shown in FIG. 2, the mRNA expression level of LINC01331 in si-NC was not significantly changed from that in the control group, as shown in FIG. 2. And the mRNA expression level of LINC01331 of the si-LINC 01331-1 group, the si-LINC 01331-2 group and the si-LINC01331-3 group is remarkably reduced (P is less than 0.05), wherein the inhibition effect of the si-LINC01331-3 is the best (the inhibition rate is 71.7%), so that the si-LINC01331-3 is selected for subsequent experiments.
Example 3 Western blot to examine the Effect of si-LINC01331-3 on the expression of proliferation-related proteins
1. Protein extraction
(1) 2X 10 day before transfection 5The A549 cells of (a) were inoculated on a 6-well plate, and after 24 hours of culture, si-NC and si-LINC01331-3 were transfected into the cells with reference to Lipofectamine 2000 instructions;
(2) after transfection for 48h, the cells were washed with PBS, and 100 μ l of RIPA cell lysate was added to each well;
(3) after full cracking, transferring the cracking solution into a centrifuge tube, centrifuging at 10000g/min and 4 ℃ for 10 minutes, and transferring the supernatant into a new centrifuge tube;
(4) sucking 2 mul, determining the protein concentration according to a BCA specification, adding 5 Xloading buffer solution to adjust the protein concentration to be 2 mug/mul, and boiling for 5 minutes in boiling water to obtain a prepared protein sample;
western Blot detection of protein expression
(1) Assembling the electrophoresis tank, and preparing 5% of upper layer glue and 12% of lower layer glue;
(2) adding 20 microgram of protein sample and a protein Marker indicator into each hole;
(3) adding a newly configured electrophoresis buffer solution into the electrophoresis tank, carrying out electrophoresis under the conditions that the voltage of the upper layer gel is 80v and the voltage of the lower layer gel is 120v, and finishing the electrophoresis when the bromophenol blue indicator completely runs out of the gel;
(4) assembling a film transferring clamp according to a sandwich model, putting the film transferring clamp into an electric transferring groove, and adding 200mA for 1 h;
(5) taking out the PVDF membrane, transferring the PVDF membrane into 5% skimmed milk powder, sealing the PVDF membrane in a shaking table for 1h at room temperature;
(6) Washing the membrane for 3 times by TBST, incubating c-myc and cyclin-D1 primary anti-diluent for 5min each time, and incubating overnight in a shaking table at 4 ℃;
(7) washing the membrane for 3 times by TBST, incubating a secondary antibody for 5min each time, incubating at room temperature, and incubating for 1h by a shaking table;
(8) in a dark room, the luminescent solution is quickly dripped on the PVDF membrane for developing.
Results of the experiment
The experimental results are shown in FIG. 3, and it can be seen from FIG. 3 that the expression levels of cell proliferation-related proteins cyclin-D1 and C-myc are significantly reduced in the cells transfected with si-LINC01331-3 compared to the cells transfected with si-NC, indicating that interfering with si-LINC01331-3 can inhibit the proliferation of A549 cells.
Example 4
CCK-8 tests the Effect of si-LINC01331-3 on A549 cell proliferation
(1) Will be 5X 103Individually transfected si-NCAnd the A549 cells of si-LINC01331-3 are inoculated in a 96-well plate, each hole is 90 mu l, each group is provided with 3 multiple holes, and the cells are placed in an incubator for culture;
(2) detecting the cells at 0h, 24h, 48h, 72h and 96h respectively, adding 10 mul of CCK-8 detection solution into each hole during detection, and then putting the cells into an incubator for incubation for 4 hours;
(3) and (3) placing the cell culture plate in an enzyme labeling instrument, detecting a light absorption value at 450nm, and drawing a growth curve.
Results of the experiment
As shown in FIG. 4, it can be seen that the cell proliferation rate of the si-LINC01331-3 transfected cells was significantly inhibited compared to the si-NC transfected cells, indicating that the proliferation of the A549 cells can be inhibited by the si-LINC 01331-3.
Example 5 Effect of si-LINC01331-3 on cell migration of A549 cells
(1) The cell culture reagents and Transwell chamber were incubated at 37 ℃;
(2) digesting the A549 cells transfected with the si-NC and the si-LINC01331-3, washing the cells by PBS and serum-free medium, suspending the cells by the serum-free medium, and counting;
(3) 600. mu.L of medium containing 10% serum was added to the lower chamber and 100. mu.L of 2.5X 10 medium was added to the upper chamber4Continuously culturing the cell suspension in a cell culture box for 24 hours;
(4) carefully remove the chamber with forceps, blot the upper chamber liquid, then transfer the chamber to a culture plate with 800. mu.L methanol added, and fix for 30 minutes at room temperature;
(5) taking out the small chamber, sucking dry the fixing liquid in the upper chamber, transferring the fixing liquid into a hole in which 800 mu L of Giemsa dye liquor is added in advance, and dyeing for 20 minutes at room temperature;
(6) the chamber was removed, rinsed with clear water and soaked 3 times, the upper chamber liquid was aspirated, the cells on the membrane surface at the bottom of the upper chamber were carefully wiped off with a cotton swab, and the images were taken under a microscope.
Results of the experiment
The results of the experiment are shown in FIG. 5 for cell migration, and it can be seen that the number of cells passing through the Transwell chamber is significantly reduced after transfection of si-LINC01331-3, indicating that interference with LINC01331 using si-LINC01331-3 can inhibit migration of A549 cells.
Example 6 Effect of si-LINC01331-3 on cell invasion of A549 cells
(1) The BD Matrigel gel frozen at-80 ℃ is kept overnight at 4 ℃ and becomes liquid;
(2) adding 40 mul of Matrigel glue into 200 mul of serum-free culture medium, uniformly mixing on ice, respectively adding 100 mul of uniformly mixed Matrigel glue into the upper chamber, putting the mixture into an incubator, and incubating for 4 hours until the Matrigel glue becomes solid;
(3) digesting the A549 cells transfected with the si-NC and the si-LINC01331-3, washing the cells by PBS and serum-free medium, suspending the cells by the serum-free medium, and counting;
(4) 600. mu.L of medium containing 10% serum was added to the lower chamber and 100. mu.L of 2.5X 10 medium was added to the upper chamber4Continuously culturing the cell suspension in a cell culture box for 24 hours;
(5) carefully remove the chamber with forceps, blot the upper chamber liquid, then transfer the chamber to a culture plate with 800. mu.L methanol added, and fix for 30 minutes at room temperature;
(6) taking out the small chamber, sucking dry the fixing liquid in the upper chamber, transferring the fixing liquid into a hole in which 800 mu L of Giemsa dye liquor is added in advance, and dyeing for 20 minutes at room temperature;
(7) the chamber was rinsed with clear water 3 times, the upper chamber liquid was aspirated, the cells on the membrane surface of the bottom of the upper chamber were carefully wiped off with a cotton swab, and the image was taken under a microscope.
Results of the experiment
The results of the experiment are shown in FIG. 5 for cell invasion, and it can be seen that the number of passes through the Transwell chamber is significantly reduced in the si-LINC01331-3 group compared to the si-NC group, indicating that interference with LINC01331 using si-LINC01331-3 can inhibit the invasion of A549 cells.
In conclusion, the LINC01331 gene inhibitor si-LINC01331-3 can inhibit lung cancer by inhibiting the proliferation, migration and invasion of lung cancer cells A549, and therefore, can be used for preparing a medicine for treating lung cancer.
Sequence listing
<110> Qingdao city central hospital
Application of LINC01331 gene inhibitor in preparation of medicine for treating lung cancer
<160> 11
<170> SIPOSequenceListing 1.0
<210> 1
<211> 568
<212> DNA
<213> Human source (Human)
<400> 1
agtttattat gtttggggtt ggaatcacca agagaccaat taacacctta tttttaggat 60
tagccattct ggtatttgca gatagtttct taaacaggac tgtttggagt tcacactgta 120
ggagtaagtg aagtgttgat aaaagagatt ccagaacaaa taaagatttc tacagtaaaa 180
gctggggagg tgtgtagggc tccagtcttt gggttcacag cttggctcta cattcattgc 240
tggaggaatc caagcctcac aaaagaccgc ttttaaagaa aaactctatt tttcttagaa 300
gaactagaat atgtaacacc attgtgagaa ataaaacccc aaggtgaaca agattgaaag 360
tgaaggcagc gctctaagga ggaagccagc tggcttgaat ggtgatgtaa acagccttgg 420
agctttaacc aaacttgagt aagaactccc tgacttggaa acactcaagt ttcccacaca 480
tgactggatg gccctggcca cactgggaac ggaatggggg cctcccattg gaactcaggg 540
tggaggggga agctcgacca gctattgt 568
<210> 2
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
aagtgaaggc agcgctctaa 20
<210> 3
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
ccagtcatgt gtgggaaact tg 22
<210> 4
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 4
aatgggcagc cgttaggaaa 20
<210> 5
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 5
atctaggaaa agcatcaccc gg 22
<210> 6
<211> 21
<212> RNA
<213> Artificial Sequence (Artificial Sequence)
<400> 6
aauaaggugu uaauuggucu c 21
<210> 7
<211> 21
<212> RNA
<213> Artificial Sequence (Artificial Sequence)
<400> 7
gaccaauuaa caccuuauuu u 21
<210> 8
<211> 21
<212> RNA
<213> Artificial Sequence (Artificial Sequence)
<400> 8
uuaaaagcgg ucuuuuguga g 21
<210> 9
<211> 21
<212> RNA
<213> Artificial Sequence (Artificial Sequence)
<400> 9
cacaaaagac cgcuuuuaaa g 21
<210> 10
<211> 21
<212> RNA
<213> Artificial Sequence (Artificial Sequence)
<400> 10
ucaaguuugg uuaaagcucc a 21
<210> 11
<211> 21
<212> RNA
<213> Artificial Sequence (Artificial Sequence)
<400> 11
gagcuuuaac caaacuugag u 21

Claims (4)

  1. The application of the LINC01331 gene inhibitor in preparing a medicine for treating lung cancer is characterized in that the LINC01331 gene inhibitor has a sequence shown in SEQ ID NO. 1; the LINC01331 gene inhibitor is a molecule which is obtained by taking LINC01331 as an action target and has an inhibition effect on LINC 01331.
  2. 2. The use according to claim 1, wherein the LINC01331 gene inhibitor is a nucleic acid molecule.
  3. 3. The use according to claim 2, wherein the LINC01331 gene inhibitor is an siRNA.
  4. 4. The use according to claim 3, wherein the sense strand of the siRNA is represented by SEQ ID No.10 and the antisense strand of the siRNA is represented by SEQ ID No. 11.
CN202010174969.6A 2020-03-13 2020-03-13 Application of LINC01331 gene inhibitor in preparation of medicine for treating lung cancer Expired - Fee Related CN111254146B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202010174969.6A CN111254146B (en) 2020-03-13 2020-03-13 Application of LINC01331 gene inhibitor in preparation of medicine for treating lung cancer

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202010174969.6A CN111254146B (en) 2020-03-13 2020-03-13 Application of LINC01331 gene inhibitor in preparation of medicine for treating lung cancer

Publications (2)

Publication Number Publication Date
CN111254146A CN111254146A (en) 2020-06-09
CN111254146B true CN111254146B (en) 2021-10-26

Family

ID=70949827

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202010174969.6A Expired - Fee Related CN111254146B (en) 2020-03-13 2020-03-13 Application of LINC01331 gene inhibitor in preparation of medicine for treating lung cancer

Country Status (1)

Country Link
CN (1) CN111254146B (en)

Families Citing this family (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN111743912B (en) * 2020-07-14 2021-09-28 浙江生研生物科技有限公司 Gene inhibitor for promoting colon cancer cell apoptosis and inhibiting colon cancer cell migration
CN112301032B (en) * 2020-11-12 2021-06-15 济南生发堂生物科技股份有限公司 Gene inhibitor for inhibiting hair follicle stem cell aging
CN115025216B (en) * 2022-05-10 2023-08-11 浙江颐核医疗科技有限公司 Compositions and methods for cancer treatment

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN107190005B (en) * 2017-01-25 2018-05-04 河北医科大学第四医院（河北省肿瘤医院） Applications of the lncRNA as biomarker in adenocarcinoma of lung diagnosis and treatment

Also Published As

Publication number Publication date
CN111254146A (en) 2020-06-09

Similar Documents

Publication Publication Date Title
CN111254146B (en) Application of LINC01331 gene inhibitor in preparation of medicine for treating lung cancer
CN107805663B (en) Application of Lnc03729 gene as biomarker in lung adenocarcinoma pre-diagnosis reagent
CN111118013B (en) Leukemia biomarker LINC02033 and application thereof
WO2021022888A1 (en) Aso targeting long-chain non-coding rna ddx11-as1, kit and application in treatment of liver cancer
CN111893120B (en) Application of long-chain non-coding RNA LINC01141 in preparation of pharmaceutical composition for treating liver cancer
CN111235275B (en) Gene marker of lung cancer and application thereof
CN112795655B (en) Colorectal cancer diagnosis marker and diagnosis kit thereof
CN108034655B (en) Application of long non-coding RNA and composition thereof in diagnosis/treatment of colorectal cancer
CN111743912B (en) Gene inhibitor for promoting colon cancer cell apoptosis and inhibiting colon cancer cell migration
CN111420058B (en) Gene inhibitor for treating prostatic cancer
CN108721316B (en) Application of marker miR-652-5p in medicines and kits for metastasis, prognosis and treatment of esophageal squamous carcinoma
CN114522179B (en) Application of gene preparation in preparation of colorectal cancer cell proliferation and metastasis inhibitor
CN107625780B (en) Non-small cell lung cancer diagnosis marker microRNA-1253 and application thereof in medicine and diagnosis kit
CN111349706B (en) Application of gene inhibitor in preparation of medicine for treating liver cancer
CN112410429B (en) Application of FXYD3 as gastric cancer diagnosis marker and treatment target
CN110607368B (en) Application of miRNA3926-1 gene as pancreatic cancer diagnosis and curative effect marker
CN110577952B (en) Application of siRNA interfering long non-coding RNA in preparation of medicine for treating breast cancer
CN109402253B (en) Use of ALDH18A1 in the treatment and diagnosis of colorectal cancer
CN107881237B (en) Lung cancer diagnosis marker microRNA-4317 and application thereof in medicines and diagnosis kit
CN107937523B (en) Lung cancer diagnosis marker microRNA-3607-3p and application thereof in medicines and diagnosis kit
CN112301030B (en) Gene inhibitor for inhibiting Hippo signal pathway and gastric cancer
CN111118154B (en) Application of LINC01272 in preparation of tumor detection reagent and/or treatment drug
CN109554364B (en) TSNAX gene inhibitor and application thereof in tumors
CN114288315B (en) Pharmaceutical composition containing CCP110 inhibitor and application thereof
CN113604569B (en) Application of miR-6883-3p in preparation of anti-liver cancer or liver cancer prognosis evaluation product

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
CB03 Change of inventor or designer information

Inventor after: Huang Haisen

Inventor after: Zhang Jing

Inventor after: Liu Yumin

Inventor after: Liu Gaili

Inventor after: Liu Kahua

Inventor after: Yu Miaolin

Inventor before: Liu Yumin

Inventor before: Liu Gaili

Inventor before: Liu Kahua

Inventor before: Yu Miaolin

CB03 Change of inventor or designer information
TA01 Transfer of patent application right

Effective date of registration: 20210928

Address after: 644603 No. 1-1, floor 1, building 1, Kemao North Road, Baixi Town, Xuzhou District, Yibin City, Sichuan Province

Applicant after: Sichuan novoser Biotechnology Co.,Ltd.

Address before: 266042 No. 127, four Liu Nan Road, Shibei District, Qingdao, Shandong

Applicant before: QINGDAO CENTRAL Hospital

TA01 Transfer of patent application right
GR01 Patent grant
GR01 Patent grant
CF01 Termination of patent right due to non-payment of annual fee

Granted publication date: 20211026

CF01 Termination of patent right due to non-payment of annual fee