CN111848773B

CN111848773B - Molecular marker RANBP1 related to human colorectal cancer and application thereof

Info

Publication number: CN111848773B
Application number: CN202010939514.9A
Authority: CN
Inventors: 袁小琴; 左思雨; 郑旦旦; 沈铭
Original assignee: Nanjing Medical University
Current assignee: Nanjing Medical University
Priority date: 2020-09-09
Filing date: 2020-09-09
Publication date: 2021-04-02
Anticipated expiration: 2040-09-09
Also published as: CN111848773A

Abstract

The invention belongs to the technical field of tumor biological diagnosis, and particularly discloses a molecular marker RAN Binding Protein 1(RANBP1) related to human colorectal cancer and application thereof. The amino acid sequence of the molecular marker RANBP1 is shown in SEQ NO.1, and primers for amplifying the molecular marker RANBP1 are RANBP1-F and RANBP1-R (specific sequences are shown later). The research shows that the expression level of RANBP1 is increased to be used as a biomarker for diagnosing the occurrence and prognosis of colorectal cancer, and the antibody can be used for the application of a colorectal cancer diagnosis kit.

Description

Molecular marker RANBP1 related to human colorectal cancer and application thereof

Technical Field

The invention belongs to the technical field of tumor biological diagnosis, and relates to a molecular marker RANBP1 related to human colorectal cancer and application thereof.

Background

Colorectal cancer (CRC) is one of the most serious malignant tumors with high incidence and mortality worldwide. According to statistics, the death number of colorectal tumor patients accounts for more than 9 percent of the total death number caused by tumors in the whole world. In recent years, the incidence rate of colorectal cancer is gradually increased in China, and data statistics in 2015 show that the incidence rate of colorectal cancer in men is as high as 10.13 percent and is located in the fourth place of common malignant tumors, while the incidence rate of colorectal cancer in women is 9.25 percent after that of breast cancer and lung cancer. Meanwhile, the colorectal cancer has long latent period and no symptoms appear in the latent period, so that the early screening and diagnosis of the colorectal cancer have important significance and are important for treatment and survival of patients.

At present, CRC screening process mainly comprises Fecal Occult Blood Test (FOBT), Fecal Immunochemical Test (FIT), soft sigmoidoscope and other modes, and the methods are proved to be capable of effectively reducing colorectal cancer death rate. Although the detection is convenient and quick, has no harm to patients and has high patient compliance, the defects of poor positioning and poor specificity exist, so that the aim of developing a new molecular marker is to improve the early screening rate of colorectal cancer patients, and further improve the survival rate of colorectal cancer patients.

Disclosure of Invention

Aiming at the defects of the prior art, the invention provides a molecular marker RAN Binding Protein 1(RANBP1) related to human colorectal cancer and application thereof, and researches prove that the expression of the RANBP1 Protein in human colorectal cancer tissues is obviously higher than that of normal colorectal tissues and is related to poor prognosis. Specifically, the increased expression level of RANBP1 can be used as a biomarker for diagnosing the occurrence and prognosis of colorectal cancer, and the antibody thereof can be used for a colorectal cancer diagnosis kit.

A molecular marker RANBP1 related to human colorectal cancer, wherein the amino acid sequence of the molecular marker RANBP1 is shown as SEQ NO. 1.

SEQ NO.1：

MAAAKDTHEDHDTSTENTDESNHDPQFEPIVSLPEQEIKTLEEDEEELFKMRAKLFRFASENDLPEWKERGTGDVKLLKHKEKGAIRLLMRRDKTLKICANHYITPMMELKPNAGSDRAWVWNTHADFADECPKPELLAIRFLNAENAQKFKTKFEECRKEIEEREKKAGSGKNDHAEKVAEKLEALSVKEETKEDAEEKQ

A nucleic acid molecule, the nucleotide sequence (cDNA sequence) of the coding molecular marker RANBP1 is shown in SEQ NO. 2.

SEQ NO.2：

GCCGGCGCCAGACGCGGAGGGAAGGAGCTACGAGTAGCCGCCGAGAGGCCGCGGAGCCAGCGACGACCGACCCAGCCGAGCCGCCGCCGCCGCCGCGCCCCCATGGCGGCCGCCAAGGACACTCATGAGGACCATGATACTTCCACTGAGAATACAGACGAGTCCAACCATGACCCTCAGTTTGAGCCAATAGTTTCTCTTCCTGAGCAAGAAATTAAAACACTGGAAGAAGATGAAGAGGAACTTTTTAAAATGCGGGCAAAACTGTTCCGATTTGCCTCTGAGAACGATCTCCCAGAATGGAAGGAGCGAGGCACTGGTGACGTCAAGCTCCTGAAGCACAAGGAGAAAGGGGCCATCCGCCTCCTCATGCGGAGGGACAAGACCCTGAAGATCTGTGCCAACCACTACATCACGCCGATGATGGAGCTGAAGCCCAACGCAGGTAGCGACCGTGCCTGGGTCTGGAACACCCACGCTGACTTCGCCGACGAGTGCCCCAAGCCAGAGCTGCTGGCCATCCGCTTCCTGAATGCTGAGAATGCACAGAAATTCAAAACAAAGTTTGAAGAATGCAGGAAAGAGATCGAAGAGAGAGAAAAGAAAGCAGGATCAGGCAAAAATGATCATGCCGAAAAAGTGGCGGAAAAGCTAGAAGCTCTCTCGGTGAAGGAGGAGACCAAGGAGGATGCTGAGGAGAAGCAATAAATCGTCTTATTTTATTTTCTTTTCCTCTCTTTCCTTTCCTTTTTTTAAAAAATTTTACCCTGCCCCTCTTTTTCGGTTTGTTTTTATTCTTTCATTTTTACAAGGGACGTTATATAAAGAACTGAACTC

An amplification primer for detecting a molecular marker RANBP1 related to human colorectal cancer, wherein the primer for amplifying the marker RANBP1 of claim 1 is:

RANBP1-F：5’-GCCATCCGCTTCCTGAATG-3’

RANBP1-R:5’-TCTCTCTTCGATCTCTTTCCTGC-3’

the application of the molecular marker RANBP1 related to human colorectal cancer in preparing products related to colorectal cancer diagnosis, prognosis evaluation, or treatment and adjuvant therapy.

As an improvement, the related product is a detection reagent.

In the improvement, the detection reagent contains a molecular marker RANBP1 as described in claim 1.

In a modification, the detection reagent contains an antibody, the antibody specifically binds to the molecular marker RANBP1, and the detection method is an immunohistochemistry method.

In a further improvement, the antibody is a monoclonal antibody or a polyclonal antibody.

As a refinement, the assay actually comprises the amplification primers described above.

In a further improvement, the detection method used by the detection reagent is qRT-PCR method.

A detection kit comprises the detection reagent, and the detection reagent contains an antibody or an amplification primer.

Has the advantages that:

compared with the prior art, the invention discloses a molecular marker RANBP1 related to human colorectal cancer and a molecular marker RANBP1 related to human colorectal cancer

The application has the following advantages:

the expression of the molecular marker in colorectal cancer tumor tissues is obviously higher than that of corresponding normal tissues, the expression level of the molecular marker is positively correlated with the clinical stage of the tumor, and is negatively correlated with prognosis and survival rate, so that the molecular marker can be used as an early screening and prognosis evaluation index of colorectal cancer.

Drawings

FIG. 1 shows the expression of RANBP1 gene in TCGA database in 471 clinical colorectal cancer tissues and 41 normal colorectal tissues;

FIG. 2 shows the expression of RANBP1 in TCGA database 41 versus clinical colorectal cancer tissue and its corresponding normal tissue;

FIG. 3 is a graph of clinical patient survival curves for different amounts of RANBP1 expression in the TCGA database;

FIG. 4 shows the detection of RANBP1 expression in Tumor tissue (Tumor) and its corresponding normal tissue of clinical colorectal cancer patients by immunohistochemical assay;

FIG. 5 shows the immunohistochemical statistics of tumor samples RANBP1 of clinical colorectal cancer patients;

FIG. 6 shows the expression of RANBP1 in tumor tissues of colorectal cancer patients at different clinical stages;

FIG. 7 is a survival curve of colorectal cancer patients with different amounts of RANBP1 expression in clinical samples;

FIG. 8 shows the expression of RANBP1 in normal colorectal epithelial cells and colorectal tumor cells;

FIG. 9 shows the expression level of mRNA after specific knock-down of RANBP1 by siRNA in colorectal cancer cells, wherein (a) is the result of mRNA after RANBP1 knock-down of a colorectal cancer cell line HCT116, and (b) is the result of mRNA after RANBP1 knock-down of a colorectal cancer cell line RKO;

FIG. 10 shows the expression levels of protein after specific knockdown of RANBP1 by siRNA in colorectal cancer cells, wherein (a) shows the protein expression after knockdown of RANBP1 in a colorectal cancer cell line HCT116, and (b) shows the protein expression after knockdown of RANBP1 in a colorectal cancer cell line RKO;

FIG. 11 is a graph showing the proliferation potency of colorectal cancer cells after knockdown of RANBP1, wherein (a) is the proliferation potency of cells after knockdown of RANBP1 in a colorectal cancer cell line HCT116, and (b) is the proliferation potency of cells after knockdown of RANBP1 in a colorectal cancer cell line RKO;

FIG. 12 is the clonogenic capacity of HCT116 cells and RKO cells following knockdown of RANBP 1;

FIG. 13 shows cell clone number statistics, wherein (a) is the statistics of HCT116 cells and (b) is the statistics of RKO cells.

Detailed Description

Example 1 database analysis

Colorectal Cancer clinical sample expression profile data including transcriptome sequencing expression profiles of 471 colorectal tumor tissues and 41 adjacent normal tissues, and clinical follow-up data of 394 colorectal Cancer samples were downloaded from The Cancer Genome Atlas (TCGA) data website (https:// Cancer. Differences between groups were analyzed using the statistical two-tailed Student's t test. The analysis shows that the expression level of the RANBP1 gene in the colorectal tumor tissue is obviously higher than that of the normal colorectal tissue (p < 0.0001). TCGA clinical follow-up data shows that the total survival time of colon and rectum tumor patients with high expression of RANBP1 is significantly lower than that of low expression groups (Log-rank test) and has statistical significance.

Example 2 clinical sample analysis

The colorectal cancer clinical samples adopted by the invention are from the first subsidiary hospital of Nanjing medical university and the Drum building hospital of Nanjing City. The project solicited patient consent and approved by the research ethics committee of the university of medical, Nanjing.

(1) Source of tissue specimen

164 tissue samples of clinical colorectal cancer patients were collected at the first subsidiary hospital of Nanjing medical university and the Drum building hospital of Nanjing City (68 of them were from the first subsidiary hospital of Nanjing medical university and 96 were from the drum building hospital of Nanjing City).

The tissue samples are tumor tissue samples of CRC patients and normal mucosa tissues which are more than 5cm away from the tumor tissues respectively, the tissues are immediately put into liquid nitrogen for freezing after being separated in vitro in an operation, and then the tissues are transferred and stored in a refrigerator at the temperature of minus 80 ℃.

Information including patient name, sex, age, surgical record, pathological diagnosis result, enteroscopy result, etc. is collected.

(2)164 sample patient information is as follows

(3) Tissue section and immunohistochemistry

a) The tissue is fixed in 4% paraformaldehyde for 24 h;

b) and (3) dehydrating the fixed tissues after the fixed tissues are placed into an embedding frame for embedding: gradient alcohols (70%, 80%, 95%, 100% I and 100% II) each 45min, alcohol-xylene 30min, xylene 20min, xylene-paraffin 30min, low melting paraffin 45min, high melting paraffin 45 min;

c) the tissues were paraffin embedded, sectioned (5 μm thick) using a microtome, and the cut pieces were placed in an oven at 37 ℃ overnight.

d) Continuously placing the paraffin section in an oven at 55 ℃ for 30min, then sequentially carrying out xylene dewaxing, gradient alcohol hydration (for example, HE dyeing), and flushing for 3-5min with running water;

e) placing the slices in citrate buffer solution, performing antigen retrieval in boiling water bath for 10-15min, taking out, and naturally cooling;

f) the cooled slices were washed three times in PBS on a shaker for 5min each time;

g) dripping 3% hydrogen peroxide solution on sliced tissue, standing at 37 deg.C for 20min, washing with PBS for 5min three times;

h) dropwise adding the closed serum on the slices, and standing at 37 ℃ for 60 min;

i) lightly discarding serum, adding RANBP1 antibody (dilution ratio 1:150) diluted with 0.5% BSA-PBS dropwise onto the slices, and freezing at 4 deg.C overnight;

j) taking out the slices on the next day, standing at room temperature for 60min, washing with PBS for three times, 5min each time;

k) adding HRP-labeled rabbit anti-goat secondary antibody (dilution ratio 1:1000) diluted by 0.5% BSA-PBS dropwise onto the slices, incubating at 37 deg.C for 60min, washing with PBS for three times (5 min each time);

l) preparing a DAB developing solution, dropwise adding the DAB developing solution on the slices, reacting at room temperature, observing under a mirror, stopping the reaction in water according to the color development condition, recording the color development time, and flushing with running water for 3-5 min;

m) performing hematoxylin nucleus staining for 30-50s, flushing with running water for 3-5min, and observing nucleus staining conditions under a mirror;

n) neutralizing with 1% hydrochloric acid alcohol for 1-3s, and washing with running water for 5 min;

o) performing gradient alcohol dehydration: 70% alcohol, 80% alcohol, 90% alcohol, 100% alcohol I, 100% alcohol II each for 2min, and xylene I, xylene II each for 2 min;

p) sealing the neutral resin sheet, and airing in a fume hood; and photographed under a microscope.

(4) Statistics and analysis

The protein expression level of RANBP1 in clinical samples was quantitatively analyzed according to immunohistochemical scoring standard (H-Score). The calculation formula of H-Score is as follows: H-Score 0X% no staining + 1X% weak staining + 2X% moderate staining + 3X% strong staining.

Differences between groups were calculated using the statistical two-tailed Student's t test and survival curves were plotted using the Log-rank (Mantel-Cox) test.

(5) Results

The invention utilizes immunohistochemical technology to detect the expression level of RANBP1 in a pathological section of a clinical colorectal tumor tissue and a corresponding normal colorectal tissue, finds that the expression level of RANBP1 in the colorectal tumor tissue is obviously increased (the expression level of RANBP1 in the tumor tissue is 3.1 times of that of the corresponding normal tissue), the expression level of RAN BP1 is related to clinical stages, the expression level of RANBP1 in a later stage III/IV patient tumor tissue is higher than that of a stage I/II patient tumor sample, and at the same time, 164 pairs of clinical samples are divided into a high-expression RANBP1 group (n ═ 82) and a low-expression group (n ═ 82) according to an H-Score median, the clinical patients are subjected to RANBP survival analysis by follow-up information for three years, and the result shows that the expression level of BP1 in colorectal cancer tumors is related to Overall Survival (OS), the high-expression RANBP1 patients have prognosis, and the survival period is shorter than the low-expression group.

Example 3 expression level of RANBP1 in colorectal cancer cell lines

Detecting the protein expression quantity of colorectal cancer cell line (HCT116\ HT-29\ RKO \ SW480) and normal colon cell (FHC) RANBP 1. The method comprises the following steps:

(1) cell culture

HCT116\ RKO \ SW480\ FHC cells were cultured in RPMI (HYCLON) culture medium containing 10% fetal bovine serum (Gibico), 1% triple antibody (Gibico); HT-29 cells were cultured in DMEM (HYCLON) medium containing 10% fetal bovine serum (Gibico), 1% triple antibody (Gibico).

(2) Extraction of Total cellular protein

Adding 200 μ l RIPA containing 10% PI and 10% PMSF into adherent cells of a six-hole plate, shaking the culture plate slightly to make the cells fully contact with liquid, standing on ice for 5min, blowing the cells to separate the walls, transferring the cells into an EP tube, centrifuging after violent shaking at 4 ℃, 12000rpm for 30 min; sucking the supernatant into a new EP tube, and temporarily storing the supernatant on ice;

protein concentration was determined using ddH as described in Byunnan BCA protein concentration assay kit₂O the sample proteins were diluted to 300. mu.g/80. mu.l, 20. mu.l of 5 loading buffer was added, the metal bath was 100 ℃ for 5 min. Cooling at room temperature;

(3)Western Blot

a) preparing 10% separating glue and concentrated glue

b) Preparing SDS-PAGE glue, firstly pouring the prepared separation glue into a glass plate to prevent bubbles from being generated until the distance between the separation glue and the glass plate is 1.5cm, and slowly adding ddH₂O pressing the glue to isolate air, standing for about 30min until the glue surface and the water phase have a clear interface, namely separating glue solidification, pouring out the upper layer liquid, preparing upper layer concentrated glue, adding a glass plate, immediately inserting a comb, and standing for solidification;

c) installing a gel plate in an electrophoresis tank, pouring 1 × electrophoresis liquid into the inner tank and the outer tank, after sample application by a sample loading gun, starting electrophoresis at constant voltage of 85V until marker separation, and adjusting the voltage to 110V until electrophoresis is finished;

d) after the electrophoresis was completed, the gel was taken out and placed in ddH₂In O, putting the PVDF membrane in methanol for activation for 20s, and transferring into a pre-cooled membrane transferring liquid; placing sponge and filter paper in the film-rotating splintPlacing gel and a PVDF film in the current direction (from black to red), wherein the gel is arranged on one side of a black plate A, discharging bubbles between each layer by light pressure, closing a clamping plate, placing the clamping plate into a film rotating groove, the gel surface (black side) faces to the negative electrode of the film rotating groove, the PVDF film faces to the positive electrode, pouring a precooled film rotating liquid, placing an ice box, placing the film rotating groove into a refrigerator with the temperature of 4 ℃, keeping the film rotating at low temperature, and rotating the film at constant current for 90min at 0.3A;

e) after the film transfer is finished, taking out the PVDF film, ddH₂And O, cleaning twice, putting ponceau for dyeing, observing whether a protein band exists or not, and judging whether the membrane is successfully transferred or not. Cleaning ponceau, sealing with 5% milk-PBST, and standing at room temperature for 1 hr;

f) putting the blocked membrane into an antibody incubation box, adding RANBP1 primary antibody diluted by 5% BSA/TBST according to the proportion of 1:10000, and standing overnight at 4 ℃;

g) on the next day, washing the membrane with TBST, washing 3 times with a shaker for 5min, and washing with TBS for 5 min; adding a secondary antibody diluted by 1:10000, and incubating for 1h at room temperature;

h) washing the membrane with TBST for three times, 5min each time, and washing with TBS for 5 min;

i) preparing ECL developing solution, placing the film and a chemiluminescence imaging system for exposure imaging, and taking a picture and archiving;

(4) results

WB experimental results show that the expression level of RANBP1 in colorectal cancer cells (HCT116\ HT-29\ RKO \ SW480) is obviously higher than that of normal colorectal cell FHC.

Example 4 Effect of RANBP1 on the proliferation and clonogenic Capacity of colorectal cancer cells

Knockdown of RANBP1 with small interfering RNA (siRNA) in colorectal cancer cell lines HCT116 and RKO, detection of knockdown efficiency, was performed as follows:

(1) specific knockdown of RANBP1

The design of small interfering RNA (siRNA) by RiboBio (Ribo) of Guangzhou was entrusted.

The sequence is as follows:

seed 1x10 in six-well plate⁵After each cell was attached, each well was transfected with 5. mu.l of transfection reagent Lipofectamine 2000(Invitrogen) plus 100pmol siRNA as a transfection complex, and 48H after the cells were harvested, RNA was extracted.

(2) Total RNA extraction from cells

Extracting total RNA of cells by a Trizol method. Collect about 1x10⁶For each cell, 500. mu.l Trizol was added. Adding 200ul chloroform, shaking vigorously to mix the upper and lower phases, standing at room temperature for 5min, centrifuging at 12000Xg, and centrifuging at 15min and 4 deg.C. Carefully sucking 160ul of the upper aqueous phase into a new RNase free EP tube, adding equal volume of isopropanol (160ul), reversing and mixing evenly, standing at room temperature for 10min, then centrifuging at 12000Xg and 15min at 4 ℃, and finally, centrifuging to obtain white RNA precipitate in the tube. Discard the supernatant, wash the pellet once with pre-cooled 75% ethanol (DEPC water dilution), 7000xg, 5min, 4 ℃ centrifugation. Abandoning the supernatant, and standing at room temperature for airing (10-15 min) to ensure that the alcohol is completely volatilized. Then 15. mu.l of DEPC water was added to dissolve it, and the concentration was measured for use.

(3) Reverse conversion of RNA to cDNA

Reverse transcription of RNA was performed using a reverse transcription kit (degenomic DNA) of Nanjing Novozam (vazyme) according to the kit instructions, and the reverse transcription system was as follows:

mixing the above mixture, reacting at 42 deg.C for 2min with PCR instrument, and continuing the second step of reversion:

after mixing, reverse transcription PCR was performed under the following conditions:

50℃,15min；85℃,5s

the obtained cDNA product can be used for Real-time PCR

(4)Real-time PCR

The cDNA of the previous step was used as a template for Real-time PCR using SYBR Green Mix from Novomedium according to the kit instructions. 10 μ l system:

after the mixture is mixed evenly, Real-time PCR is carried out, and the reaction conditions are as follows:

95 ℃ for 5 min; 95 ℃ for 10s to 60 ℃ for 30 s; 40 cycles

The primer sequences are as follows:

(5) as a result:

the expression of RANBP1 in colorectal cancer cells can be effectively knocked down by using the small interfering RNA.

Example 5 cell proliferation (CCK8) and colony formation

We performed cell proliferation and clonogenic experiments on colorectal tumor cells HCT116 and RKO cells knocked down in RANBP1 as follows:

(1) CCK8 experiment

Respectively inoculating the cells transfected with si-NC and si-RANBP1 into a 96-well plate according to the number of 3000 cells per well, and putting the plate into a cell culture box for more than 8 hours until the cells adhere to the wall;

adding CCK8 reagent according to the concentration of 10%, and continuing culturing for 2 hours;

detecting the absorbance at 450nm by using a microplate reader to obtain the length of the growth of 0h, and performing the same operation every 24 hours till 96 hours;

the fold increase indicates the cell proliferation capacity by comparison with the absorbance at 0 h.

(2) Clone formation experiments

Digesting the cells transfected with si-NC and si-RANBP 148 h, inoculating the cells into a six-hole plate in a number of 500cells/well, shaking the culture plate lightly to uniformly spread the cells, and putting the cells into an incubator for culture;

every 3 days, the complete medium was replaced with a new one until colony formation was visible by eye on day 13;

discarding the culture medium, washing twice with PBS, adding 1ml paraformaldehyde, standing and fixing for 15 min;

adsorbing paraformaldehyde, adding ddH₂Washing for 3 times (each time for 2 min);

adding 1ml of 1-crystal violet reagent, standing in dark, dyeing for 15min, and adding ddH₂And washing for multiple times until the redundant crystal violet is washed, airing, photographing by a camera, and counting the number of clones.

(3) Results

After the knockdown of RAMBP1, the proliferation capacity of colorectal tumor cells is reduced, and the clonogenic capacity is reduced, thereby proving that RANBP1 is related to the proliferation and clonogenic capacity of colorectal cancer cells.

Combining the results of TCGA data analysis and clinical sample analysis, it was found that expression of RANBP1 was higher in colorectal cancer tissues than in corresponding normal colorectal tissues, and that it was highly expressed in colorectal tumor cell lines. The expression of the RANBP1 of the colorectal cancer cells is knocked down, so that the proliferation of the colorectal cancer cells can be slowed down, and the clonogenic capacity of the colorectal cancer cells is reduced. It is proved that RANBP1 can be used as a molecular marker of colorectal cancer and applied to the preparation of a diagnostic kit of tumors.

The above description is only a preferred embodiment of the present invention, and the scope of the present invention is not limited thereto, and any simple modifications or equivalent substitutions of the technical solutions that can be obviously obtained by those skilled in the art within the technical scope of the present invention are within the scope of the present invention.

Sequence listing

<110> Nanjing university of medical science

<120> molecular marker RANBP1 related to human colorectal cancer and application thereof

<160> 9

<170> SIPOSequenceListing 1.0

<210> 1

<211> 201

<212> PRT

<213> polypeptide (polypeptide)

<400> 1

Met Ala Ala Ala Lys Asp Thr His Glu Asp His Asp Thr Ser Thr Glu

1 5 10 15

Asn Thr Asp Glu Ser Asn His Asp Pro Gln Phe Glu Pro Ile Val Ser

20 25 30

Leu Pro Glu Gln Glu Ile Lys Thr Leu Glu Glu Asp Glu Glu Glu Leu

35 40 45

Phe Lys Met Arg Ala Lys Leu Phe Arg Phe Ala Ser Glu Asn Asp Leu

50 55 60

Pro Glu Trp Lys Glu Arg Gly Thr Gly Asp Val Lys Leu Leu Lys His

65 70 75 80

Lys Glu Lys Gly Ala Ile Arg Leu Leu Met Arg Arg Asp Lys Thr Leu

85 90 95

Lys Ile Cys Ala Asn His Tyr Ile Thr Pro Met Met Glu Leu Lys Pro

100 105 110

Asn Ala Gly Ser Asp Arg Ala Trp Val Trp Asn Thr His Ala Asp Phe

115 120 125

Ala Asp Glu Cys Pro Lys Pro Glu Leu Leu Ala Ile Arg Phe Leu Asn

130 135 140

Ala Glu Asn Ala Gln Lys Phe Lys Thr Lys Phe Glu Glu Cys Arg Lys

145 150 155 160

Glu Ile Glu Glu Arg Glu Lys Lys Ala Gly Ser Gly Lys Asn Asp His

165 170 175

Ala Glu Lys Val Ala Glu Lys Leu Glu Ala Leu Ser Val Lys Glu Glu

180 185 190

Thr Lys Glu Asp Ala Glu Glu Lys Gln

195 200

<210> 2

<211> 837

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

gccggcgcca gacgcggagg gaaggagcta cgagtagccg ccgagaggcc gcggagccag 60

cgacgaccga cccagccgag ccgccgccgc cgccgcgccc ccatggcggc cgccaaggac 120

actcatgagg accatgatac ttccactgag aatacagacg agtccaacca tgaccctcag 180

tttgagccaa tagtttctct tcctgagcaa gaaattaaaa cactggaaga agatgaagag 240

gaacttttta aaatgcgggc aaaactgttc cgatttgcct ctgagaacga tctcccagaa 300

tggaaggagc gaggcactgg tgacgtcaag ctcctgaagc acaaggagaa aggggccatc 360

cgcctcctca tgcggaggga caagaccctg aagatctgtg ccaaccacta catcacgccg 420

atgatggagc tgaagcccaa cgcaggtagc gaccgtgcct gggtctggaa cacccacgct 480

gacttcgccg acgagtgccc caagccagag ctgctggcca tccgcttcct gaatgctgag 540

aatgcacaga aattcaaaac aaagtttgaa gaatgcagga aagagatcga agagagagaa 600

aagaaagcag gatcaggcaa aaatgatcat gccgaaaaag tggcggaaaa gctagaagct 660

ctctcggtga aggaggagac caaggaggat gctgaggaga agcaataaat cgtcttattt 720

tattttcttt tcctctcttt cctttccttt ttttaaaaaa ttttaccctg cccctctttt 780

tcggtttgtt tttattcttt catttttaca agggacgtta tataaagaac tgaactc 837

<210> 3

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

gccatccgct tcctgaatg 19

<210> 4

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

tctctcttcg atctctttcc tgc 23

<210> 5

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

gcaggaaaga gatcgaaga 19

<210> 6

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

gggcaaaact gttccgatt 19

<210> 7

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

acgtcaagct cctgaagca 19

<210> 8

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

tcatgaagtg tgacgtggac at 22

<210> 9

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

ctcaggagga gcaatgatct tg 22

Claims

1. The application of a molecular marker RANBP1 related to human colorectal cancer in preparing related products for colorectal cancer diagnosis or prognosis evaluation is characterized in that the amino acid sequence of the molecular marker RANBP1 is shown as SEQ NO. 1.

2. The use of claim 1, wherein the related product is a detection reagent.

3. The use according to claim 2, wherein the detection reagent comprises the molecular marker RANBP1 according to claim 1.

4. The use according to claim 2, wherein the detection reagent comprises an antibody that specifically binds to the molecular marker RANBP1 and the detection method is immunohistochemistry.

5. The use of claim 4, wherein the antibody is a monoclonal or polyclonal antibody.

6. The use of claim 5, wherein the detection reagent comprises primers for the amplification marker RANBP1, RANBP 1-F: 5'-GCCATCCGCTTCCTGAATG-3', RANBP1-R: 5'-TCTCTCTTCGATCTCTTTCCTGC-3', and the detection method used by the detection reagent is qRT-PCR method.