CN114231623B - Application of Palmdelphin in preparation of human colorectal cancer detection and treatment products - Google Patents

Abstract

The invention discloses application of a marker molecule Palmdelphin (PALMD) related to human colorectal cancer stem cells (colorectal cancer stem cells, CRC-CSCs) in colorectal cancer detection and treatment products. PALMD, a novel marker for human CRC-CSCs, is hardly expressed in cryptake intestinal epithelial non-stem cells, is low-expressed in cryptake intestinal epithelial stem cells of normal intestinal tracts, exhibits remarkably high expression when the cryptake intestinal epithelial stem cells are mutated and cancerated, and has a protein expression level remarkably associated with disease progression, patient survival and progression-free survival of first-line chemotherapy drugs, and a gene expression level remarkably increased (low differentiation, high malignancy) in pathological tissue typing as mucous colon adenocarcinoma. By researching the biological function of the PALMD in colorectal cancer, the invention takes the PALMD as a brand new molecular marker for early diagnosis of colon cancer and evaluation of curative effect of chemotherapeutics, and can also be used as a new target point for development of anti-intestinal cancer stem cell medicines.

Description

Application of Palmdelphin in preparation of human colorectal cancer detection and treatment products

Technical Field

The invention belongs to the technical field of biological diagnosis and treatment of tumors, and relates to a novel tumor stem cell marker for colorectal cancer diagnosis, curative effect evaluation and treatment targets.

Background

Colorectal cancer (colorectal cancer, CRC) mortality is the second worldwide and its incidence is the second in china. The research shows that the high mortality rate of CRC is closely related to the late diagnosis (more than 50% of diagnosis is middle and late, and the surgical indication is missed) and the chemotherapy drug resistance. Studies have shown that tumor stem cells (CSCs) are the root cause of tumorigenesis and development and drug resistance. Under physiological conditions, intestinal epithelial stem cells are distributed on the base of an upper Pi Yin nest and have the function of rebuilding intestinal epithelium after rapid differentiation, and if the intestinal stem cells are mutated, such as APC mutation or beta-catenin nuclear translocation, the intestinal cancer stem cells (colorectal cancer stem cells, CRC-CSCs) are obtained in the process, CRC-CSC gene expression is different from that of the intestinal stem cells, and genes with obvious expression difference can be used as CRC-CSCs marker molecules. The stem cells of the intestinal cancer after mutation are continuously accumulated and differentiated into cancerous intestinal epithelial cells, tumors are generated after the stem cells are accumulated to a certain extent, the process is that crypt foci are evolved into adenoma and finally adenocarcinomas are generated, the evolution process leads to long latent period of colorectal cancer and no symptoms usually appear in the latent period, so that screening diagnosis is carried out by taking the CRC-CSCs of the cells of the origin of the intestinal cancer as a subject compared with the existing terminal mode examination such as fecal occult blood test, fecal immunochemistry test, soft sigmoidoscope and the like, the colorectal cancer can be found earlier, and the stem cells of the intestinal cancer are vital to the treatment and survival of patients. The colorectal cancer chemoradiotherapy drugs commonly used at present aim at rapidly dividing intestinal cancer epithelial cells, including radiation, taxane, platinum therapy and DNA damaging agents, however, CRC-CSCs are different from differentiated epithelial cells, can be in or recover to a static state when being attacked by drugs, and can prevent the attack of CRC-CSCs from causing chemotherapy resistance, so that the treatment effect is greatly reduced, and therefore, the combination of CRC-CSCs can better and more accurately predict the chemotherapy curative effect, but related applications are not seen at present.

Although a plurality of molecular markers such as LGR5, DCLK1, ALDH, CD44 and CXCR4 are reported, because most of the molecular markers are common to intestinal stem cells and CRC-CSCs, the molecular markers lack of specificity or are difficult to apply with low expression level, and therefore, the molecular markers are necessary to better characterize, identify and screen CRC-CSCs and apply the CRC-CSCs to early clinical diagnosis, prognosis evaluation and targeted drug development, so that the search for CRC-CSCs molecular markers with higher specificity and expression level is necessary.

PALMD is the major cytoplasmic subtype of the Paralemmin family, a lipid raft-associated protein involved in plasma membrane dynamics and cell shape control. Current studies have found that PALMD is a susceptibility gene for calcified aortic stenosis and can act as a target for serine 46 mutation and P53 phosphorylation to regulate apoptosis in response to DNA damage. Furthermore, PALMD promotes myoblast differentiation and muscle regeneration, which is critical for skeletal muscle development and regeneration to form multinucleated contractile muscle fibers. At present, no report is yet made on the function, clinical significance and regulation mechanism of PALMD in CRC-CSCs. The invention discovers that the PALMD is low in the crypt intestinal epithelial stem cells of the normal intestinal tract in the early stage, the crypt intestinal epithelial stem cells show remarkable high expression after mutation and canceration, the protein expression level is remarkably related to disease progress, patient survival time and non-progress survival time of first-line chemotherapy, and the gene expression level is remarkably increased (low differentiation and high malignancy degree) in pathological tissue parting as mucous colon adenocarcinoma.

Based on the early-stage research, the invention considers that the PALMD can be used as a novel molecular marker of CRC-CSCs and is used for early diagnosis of colorectal cancer, chemotherapy curative effect evaluation, prognosis judgment and targeted drug development.

Disclosure of Invention

Aiming at the condition that the existing clinical colorectal cancer lacks an effective CRC-CSCs diagnostic marker, the invention provides a molecular marker-PALMD which can be used for identifying colorectal cancer CRC-CSCs, and the purposes of early diagnosis, prognosis evaluation and targeted drug development of colorectal cancer are achieved by detecting the expression level of the PALMD gene or protein.

In order to achieve the above purpose, the invention adopts the following technical means:

according to the invention, samples meeting the conditions are screened through bioinformatics and statistical analysis is carried out on the sequencing results of clinical colorectal cancer RNA-seq from a TCGA database, the fact that the gene expression of the PALMD in more areas of intestinal stem cells in the clinical colorectal cancer samples is obviously higher than that in areas with lower stem cells and mainly exists in the hidden-base intestinal epithelial stem cell parts, the PALMD protein expression of the hidden-base areas of the colorectal cancer samples is obviously higher than that of normal tissues, the tumor specific survival time of patients with high PALMD expression is obviously lower than that of the groups with low PALMD expression, and the disease progression free survival time is also lower than that of the groups with low PALMD expression is found, namely the PALMD can be used as the early diagnosis basis of colorectal cancer and can judge prognosis.

The invention screens colorectal cancer patients receiving first-line chemotherapy from a TCGA COADREAD database and statistically analyzes the expression characteristics of the PALMD, and the result shows that the survival rate of the PALMD in a disease-free way and the survival rate of the PALMD in a tumor-specific way are obviously lower than those of the PALMD in a low-expression way, namely, the expression level of the PALMD can predict the curative effect of the colorectal cancer patients receiving first-line chemotherapy.

Further, according to the invention, the TCGA database is used for screening out the cases meeting the conditions, and the mRNA expression levels of various molecules are analyzed, so that compared with the non-mucous colon cancer, the result shows that the expression levels of the PALMD mRNA are remarkably increased in pathological tissue typing of mucous colon adenocarcinoma (mucous colon adenocarcinoma is characterized by low differentiation and high malignancy), namely, the expression of the PALMD mRNA can be used as the diagnosis basis of colorectal cancer typing.

The invention detects 40 pairs of protein expression levels of PALMD in clinically paired colorectal cancer and paracancerous tissues through an immunohistochemical method, verifies the results of database screening statistical analysis, and discovers that the expression content of PALMD in the cancerous tissues is obviously increased in paired colorectal cancer samples and is mainly positioned at intestinal epithelial crypt positions where intestinal cancer stem cells are positioned.

According to the invention, three colorectal cancer cell lines are used for verifying the prediction of high expression of the PALMD in colorectal cancer, and the intervention is carried out by giving the PALMD (traditional Chinese medicine monomer with anti-intestinal cancer effect), and anti-tumor drug screening is carried out by taking the PALMD as a target point, so that the result shows that the PALMD can be used as the target point of anti-intestinal cancer stem cell drug screening by obviously reducing the PALMD protein expression and reducing the cloning capacity of tumor stem cells.

Therefore, on the basis of the research, the invention provides the application of the PALMD as a novel molecular marker in preparing a kit for early diagnosis of colorectal cancer, prediction of curative effect of chemotherapeutics, and pathological tissue typing and development of targeted drugs.

Wherein, preferably, the reagent for detection from RNA level comprises a primer required for the PALMD qRT-PCR detection, the primer consists of an upstream primer and a downstream primer, and in one specific embodiment of the invention, the nucleotide sequence of the upstream primer is shown as the text, and the nucleotide sequence of the downstream primer is shown as the text.

Of course, all primers designed based on the human PALMD gene sequence should be within the scope of the present invention.

Wherein, preferably, the reagent for detecting from the protein level comprises a monoclonal or polyclonal antibody against PALMD.

Aiming at the condition that the PALMD has expression difference in clinical colorectal cancer patients and has correlation with bad prognosis, the invention uses the PALMD related sequence and protein antibody to analyze the expression condition of the PALMD in colorectal cancer tissues through the detection of mRNA and protein expression level, thereby carrying out early diagnosis of colorectal cancer, the prediction of curative effect of chemotherapeutics, the prognosis evaluation of patients and the development of related targeted drugs, and having important significance for the clinical diagnosis and treatment of colorectal cancer.

Description of the drawings:

FIG. 1 Palmdelphin (Palmd) is a completely novel human intestinal tumor stem cell marker

A: the expression of the PALMD is obviously increased along with the enhancement of the detection signal of the intestinal stem cells, which indicates that the PALMD is mainly expressed in the intestinal stem cells but not other cells

B: the pathological results in the human proteome graph database show that the expression level of the PALMD in stem cells in human small intestine crypt basal cells is lower, the expression level of the PALMD in colon tumor crypt epithelial stem cells is obviously increased, which proves that the PALMD is mainly expressed in intestinal cancer stem cells but not intestinal stem cells

FIG. 2 PALMD predicts tumor-specific survival in colorectal patients, and screening a sample of eligible colorectal patients in the TCGA database, statistics show that tumor-specific survival in patients with high expression of PALMD is significantly reduced (including total number of samples: 354, p <0.0001 x)

FIG. 3 PALMD predicts disease progression-free survival in colorectal patients, and screening a sample of eligible colorectal patients in the TCGA database, statistics show that disease progression-free survival in tumors is significantly reduced in patients with high expression of PALMD (taken in total number of samples: 376, p <0.0001

FIG. 4 shows that the expression of PALMD can evaluate the efficacy of first-line chemotherapeutics, and that patients with colorectal cancer with high expression of PALMD have significantly lower survival rate without disease progression after receiving first-line chemotherapy than patients with low expression of PALMD, indicating that PALMD can predict the efficacy of first-line chemotherapeutics (including total number of samples: 84, p=0.01:)

FIG. 5 PALMD can evaluate the pathological typing of colon cancer, and the expression of PALMD mRNA in mucous colon adenocarcinoma is significantly up-regulated (p < 0.007) compared with that of non-mucous colon adenocarcinoma, which shows that the mucous colon adenocarcinoma has low differentiation and high malignancy degree, and the PALMD can be used as the evaluation basis of colorectal cancer typing

FIG. 6 shows that the expression level of PALMD in cancer tissue is higher than that in other tissue, and the expression site is mainly in the hidden pit of the epithelium of intestinal cancer stem cell (inclusion example number: 40)

In the following, the expression level of the PALMD in the human colorectal cancer cell strain is inhibited, so that the capacity of forming balls of CRC-CSC is reduced, the PALMD in three colorectal cancer cells HCT116, DLD1 and SW480 are all expressed in high, and after different doses of the PALMD protein (5 mu M and 10 mu M) are administered for stem prognosis, the expression of the PALMD protein is reduced in a dose-dependent manner, and the capacity of forming balls of CRC-CSCs 3D is also obviously reduced, namely, the proliferation capacity of colorectal cancer stem cells is reduced after the PALMD is inhibited by medicaments, so that the PALMD can be used as a screening target of anti-intestinal cancer stem cell medicaments.

Example 1 database analysis

Colorectal cancer clinical sample expression profile data meeting inclusion criteria were downloaded from the cancer genome map (The Cancer Genome Atlas, TCGA) data website (https:// cancer nonome. Nih. Gov), and included 370 colorectal cancer patients and 84 colorectal cancer patients receiving first-line chemotherapy were classified into PALMD high-expression and low-expression groups. Analysis of the group differences using the statistical two-tailed Student's t assay found that PALMD gene expression increased with increased colorectal cancer stem cell signaling (fig. 1), and that patients with high PALMD expression had tumor-specific survival and disease progression-free survival (fig. 2, fig. 3), and that survival was lower after first-line chemotherapy than that of the PALMD low-expression group (fig. 4). Example 3 RT-qPCR detects expression of PALMD in tissues.

Example 2 clinical sample analysis

The colorectal cancer clinical samples adopted by the invention are all from 40 cases of paraffin samples obtained by the medical department of Beijing Korea hospital, wherein the cancer paracentesis tissue of colorectal cancer tumor patients is used as 40 cases of negative control samples. Paraffin tissue sections, the front portion exposed to air, were discarded, the section thickness was around 10 μm, each 4 rolls of paraffin were placed into a 1.5mL centrifuge tube, each sample was 6 tubes and labeled. If RNA extraction is not performed for a short period of time, RNA later reagent may be added and the sample kept at 4℃for a short period of time.

PALMD mRNA expression analysis of clinical samples

1.1 Reverse transcription

After tissue disruption, 200. Mu.L of chloroform was added to the mixture after 500. Mu.L of Trizol was added, and the mixture was vigorously shaken to mix the upper and lower phases thoroughly, and after standing at room temperature for 5 minutes, the mixture was centrifuged at 12000 x g,15min 4 ℃. 160. Mu.L of the upper aqueous phase was carefully aspirated into a fresh RNase free EP tube, an equal volume of isopropanol (160. Mu.L) was added, the mixture was inverted and mixed well, and after 10 min at room temperature, centrifugation was performed at 12000 x g,15min 4 ℃and after centrifugation white RNA precipitation was seen in the tube. The supernatant was discarded, and the pellet was washed once with pre-chilled 75% ethanol (DEPC water dilution), centrifuged at 7000 Xg, 5min at 4 ℃. Discarding the supernatant, standing at room temperature, and air drying (10-15 min) to volatilize the alcohol completely. Then adding 15 mu L of DEPC water for dissolution, and measuring the concentration for later use;

adjusting the total RNA amount of each group of samples according to the measured concentration, and adopting a Transcriptor First StandcDNA System Kit reverse transcription kit to carry out reverse transcription to synthesize a cDNA first strand according to the method provided by the specification;

a) cDNA reaction system

RNA reverse transcription was performed using a reverse transcription kit according to the kit instructions, the reverse transcription system being as follows:

total RNA (50 ng-5. Mu.g) X. Mu.L (x.ltoreq.8) random primer (N9) (0.1. Mu.g/. Mu.L) 1. Mu.L 2X TS Reaction Mix 10. Mu.L RT/RI Enzyme Mix 1. Mu.L RNase-free water 8-X. Mu.L;

b) Lightly mixing, putting the mixed system into a PCR instrument, and carrying out PCR reaction on the PCR instrument by the amplification reaction, wherein the reaction parameters are as follows: 25 ℃ for 10 min;42 ℃ for 15 min; (80 ℃ C. For 2min; 4 ℃ C. For 15 min). Times.2 cycles;

c) The obtained cDNA solution of the RNA reversion product is preserved for a short period of time at the temperature of minus 20 ℃;

1.2 Real-time PCR

real-time PCR was performed using the cDNA of the previous step as a template, and the PCR was performed using SYBRGreen Mix according to the kit instructions. 20. Mu L system:

in a 0.2 mL PCR tube, 1. Mu.L of Reverse Transcription (RT) product was added in sequence, each gene forward primer and reverse primer was 0.5. Mu.L each, 10. Mu.L of PCR reaction mix was made up to 20. Mu.L with ddH 2O water. Mixing, immediately placing in a PCR instrument for reaction according to the following procedures, and storing the sample at-20 ℃ for later use after the reaction is finished;

after the above mixture was mixed, real-time PCR was performed under the following reaction conditions:

95 ℃ for 5min; 95 ℃,10 s-60 ℃ and 30 s;40 cycles

The primer sequences were as follows:

TTCCCCGTCTGACTGTCCTT (upstream)

CCCTCAAGGCCTTTTTCTTCAAA (downstream)

1.3 Results

PALMD mRNA was significantly upregulated in mucinous colon adenocarcinoma as compared to non-mucinous colon adenocarcinoma (fig. 5).

Palmd protein expression analysis of clinical samples

2.1 Tissue section and immunohistochemistry

a) Tissue was fixed at 4% paraformaldehyde 24 h;

b) The fixed tissue is put into an embedding frame for embedding and then dehydrated: gradient alcohol (70%, 80%, 95%, 100% I and 100% II) for 45min each, alcohol-xylene for 30min, xylene for 20min, xylene-paraffin for 30min, low melting paraffin for 45min, and high melting paraffin for 45min;

c) Paraffin embedding the tissue, slicing the tissue by using a slicer (5 μm thick), and placing the sliced tissue slices in a 37 ℃ oven overnight;

d) Continuously placing paraffin sections in a 55 ℃ oven for 30min, then sequentially dewaxing by xylene, hydrating by gradient alcohol (time like HE dyeing), and flushing for 3-5min by running water;

e) Placing the slices in citrate buffer solution, performing antigen retrieval in boiling water bath for 10-15min, taking out, and naturally cooling;

f) Placing the cooled slice in PBS and washing on a shaker for three times, each time for 5min;

g) Dropping 3% hydrogen peroxide solution onto sliced tissue, standing at 37deg.C for 20min, and washing with PBS for three times, each time for 5min;

h) Dripping the closed serum onto the slice, and standing at 37deg.C for 60min;

i) Serum was gently removed, and PALMD antibody diluted in 0.5% bsa-PBS (dilution ratio 1:150) was added dropwise to the sections, overnight in a refrigerator at 4 ℃;

j) Taking the slices in the next day, standing at room temperature for 60min, and performing PBS (phosphate buffered saline) film washing for three times, wherein each time is 5min;

k) HRP-labeled rabbit anti-goat secondary antibody (dilution ratio 1:1000) diluted with 0.5% bsa-PBS was added dropwise to the sections, incubated at 37 ℃ for 60min, and washed three times with PBS for 5min each;

preparing DAB developer, dripping the DAB developer on a slice, reacting at room temperature, observing under a mirror, stopping the reaction in water according to the color development condition, recording the color development time, and flushing for 3-5min by running water;

m) hematoxylin is used for dying the nuclear for 30-50s, washing is carried out for 3-5min in running water, and nuclear dying conditions are observed under a lens;

n) neutralizing with 1% hydrochloric acid alcohol for 1-3s, and washing with running water for 5min;

o) gradient alcohol dehydration: 70% alcohol, 80% alcohol, 90% alcohol, 100% alcohol I, 100% alcohol II for 2min each, xylene I, xylene II for 2min each;

p) sealing the neutral resin, and airing in a fume hood; and photographed under a positive microscope.

2.2 Statistics and analysis

Clinical samples were quantitatively analyzed for RANBP1 protein expression level according to the immunohistochemical scoring criteria (H-Score). The H-Score formula is: h-score=0×% no staining+1×% weak staining+2×% moderate staining+3×% strong staining, the differences between groups were calculated using the statistical two-tailed Student's t test.

2.3. Results

The invention detects 40 the expression level of PALMD in clinical colorectal tumor tissues and pathological sections of tissues beside cancers by utilizing an immunohistochemical technology, and discovers that the expression content of the PALMD in the colorectal tumor tissues is obviously increased, and the expression part is mainly positioned at the hidden pit part of the epithelium of the basal intestine where the stem cells of the intestinal cancer are positioned (figure 6).

EXAMPLE 3 target of Palmd in colorectal cancer cell lines as an anti-tumor Stem cell drug

The amount of PALMD protein expression in colorectal cancer cell lines (HCT 116, DLD1, SW 480) following the stem prognosis was examined. The method comprises the following steps:

1. cell culture and emodin intervention

(HCT 116, DLD1, SW480 cells are cultivated in RPMI culture solution containing 10% of fetal bovine serum and 1% of triple antibody, total protein is extracted after 5 mu M and 10 mu M emodin intervene on intestinal cancer cells for 48 hours, DMSO intervene is used as a control, and meanwhile, 500 plates are counted for stem prognosis cells, and clone balls are counted after 7d of balling experiment cultivation and photographed;

2. total cell protein extraction

Adding 200 mu L of RIPA containing 10% PI and 10% PMSF into six-hole plate adherent cells, allowing the cells to fully contact with liquid by shaking a culture plate, standing on ice for 5min, blowing the cells to leave the wall, transferring the cells into an EP tube, and centrifuging after intense shaking at 4 ℃ at 12000rpm for 30min; sucking the supernatant into a new EP pipe, and temporarily storing on ice;

the protein concentration was determined according to the Biyundian BCA protein concentration assay kit, and the sample protein was diluted to 300. Mu.g/80. Mu.L with ddH 2O, and 20. Mu.L of 5-x loading buffer was added to the solution at 100℃for 5min in a metal bath. Cooling at room temperature;

3．Western Blot

a) Preparing 10% separating gel and concentrating gel

b) Preparing SDS-PAGE gel, firstly pouring the prepared separating gel into a glass plate, preventing and treating bubbles, standing for 30min until a gel surface and a water phase have obvious interfaces at a position which is 1.5cm away from the upper edge of the glass plate, pouring out upper liquid, preparing upper concentrated gel, adding the glass plate, immediately inserting a comb, and standing for solidification;

c) Mounting the gel plate in an electrophoresis tank, pouring electrophoresis liquid into the inner and outer tanks, loading a sample by a sample loading gun, starting electrophoresis at a constant voltage of 85V until the markers are separated, and adjusting the voltage to 110V until the electrophoresis is completed;

d) After electrophoresis is completed, taking out gel, putting the PVDF film into methanol to activate for 20s, and transferring the PVDF film into precooled film transferring liquid; putting sponge and filter paper in a film transfer clamp plate, putting gel and PVDF film according to the current direction (from black to red), discharging bubbles between each layer by light pressure, closing the clamp plate, putting the clamp plate into a film transfer groove, putting the gel surface towards the negative electrode of the film transfer groove, putting the PVDF film towards the positive electrode, pouring precooling film transfer liquid, putting an ice box, putting the film transfer groove into a refrigerator at 4 ℃, keeping low temperature film transfer, and transferring the film for 90min at constant current of 0.3A;

e) After the film transfer is finished, taking out the PVDF film, cleaning twice, putting ponceau for dyeing, observing whether protein strips exist, and judging whether film transfer is successful;

f) Placing the sealed membrane into an antibody incubation box, adding PALMD primary antibody diluted according to 1:10000, and standing at 4 ℃ overnight;

g) The next day, the membrane is washed with TBST, the membrane is washed on a shaking table for 3 times, each time for 5 minutes, and the TBS is washed once for 5 minutes; adding the secondary antibody diluted by 1:1000, and incubating for 1h at room temperature;

h) TBST washes the membrane three times, each time for 5min, TBS washes once for 5min;

i) Preparing ECL developing solution, placing the film, performing exposure imaging with a chemiluminescent imaging system, photographing and archiving;

4. results

The WB experimental results show that the expression level of the PALMD in the human colorectal cancer cells (HCT 116, DLD1 and SW 480) is remarkably inhibited by emodin in a dose-dependent manner, and meanwhile, the balling capacity of the intestinal cancer stem cells is remarkably reduced, so that the PALMD can be used as a screening target point of anti-intestinal cancer stem cell medicines (figure 7).

While the invention has been described in detail in the foregoing general description and with reference to specific embodiments thereof, it will be apparent to one skilled in the art that modifications and improvements can be made thereto. Accordingly, such modifications or improvements may be made without departing from the spirit of the invention and are intended to be within the scope of the invention as claimed.

Claims (2)

1. Use of Palmdelphin for in vitro detection of emodin's ability to interfere with the pelleting of colorectal cancer stem cells, wherein Palmdelphin low expression corresponds to a reduced pelleting ability of colorectal cancer stem cells.
2. 2. The use of claim 1, wherein the detection is with a primer pair that specifically amplifies the human Palmdelphin gene, wherein the forward primer is TTCCCCGTCTGACTGTCCTT and the reverse primer is CCCTCAAGGCCTTTTTCTTCAAA; or the detection reagent contains monoclonal or polyclonal antibodies specifically binding to Palmdelphin, and the detection method is an immunohistochemical method or ELISA.