CN116042819A

CN116042819A - Application of hsa_circ_0002490 in preparation of liver cancer detection or efficacy evaluation products

Info

Publication number: CN116042819A
Application number: CN202211067244.2A
Authority: CN
Inventors: 缪辉来; 梁浩凡; 叶志荣; 程海兵; 杨子毅
Original assignee: Second Affiliated Hospital Of Guangdong Medical University; LIAOBU HOSPITAL OF DONGGUAN
Current assignee: Second Affiliated Hospital Of Guangdong Medical University; LIAOBU HOSPITAL OF DONGGUAN
Priority date: 2021-06-28
Filing date: 2021-06-28
Publication date: 2023-05-02
Also published as: CN115851931A; CN115261480A; CN113337607B; CN113337607A

Abstract

The invention discloses an application of hsa_circ_0002490 in preparing liver cancer detection or curative effect evaluation products, wherein the nucleic acid sequence of hsa_circ_0002490 is shown as SEQ ID NO. 1. The hsa_circ_0002490 has a correlation with the liver cancer, can quickly, simply and accurately realize auxiliary diagnosis of the liver cancer, and provides a basis for diagnosis of the liver cancer and selection of curative effect evaluation indexes.

Description

Application of hsa_circ_0002490 in preparation of liver cancer detection or efficacy evaluation products

Technical Field

The invention relates to the technical field of biology, in particular to an application of hsa_circ_0002490 in preparing liver cancer detection or curative effect evaluation products.

Background

Primary Liver Cancer (PLC) is listed as the seventh most common cancer in the world, with hepatocellular carcinoma (HCC) caused by malignant transformation of hepatocytes accounting for about 75% of Primary Liver Cancer (PLC). Intrahepatic cholangiocarcinoma is another major PLC, originating from cholangiocytes, accounting for 12-15% of hepatic malignancies. Due to the aggressiveness of these hepatic malignancies, primary liver cancer has become the fourth most common cause of cancer death. It is counted that more than 90% of HCC cases occur in the context of chronic liver disease, and cirrhosis of the liver by any cause is a high risk factor for HCC, including chronic alcohol consumption, diabetes or obesity-related non-alcoholic steatohepatitis (NASH) and HBV or HCV infection. HCC is the leading cause of death in patients with cirrhosis, with a yearly HCC incidence of 1-6%. Due to improvements in public health measures, the risk factors for liver cancer are currently changing, the prevalence of chronic HBV and HCV infection is decreasing in many areas, and diseases related to obesity, diabetes, metabolic syndrome and the like have become major factors leading to an increase in liver cancer incidence in many low risk countries. Some socioeconomic characteristics are associated with liver cancer, with aging being a strong risk factor, and reports indicate that the highest relevant population is one over 70 years of age. In addition, liver cancer has a strong male advantage (a ratio of 2-3:1), which may be related to the accumulation of risk factors and sex hormone differences in men. Despite advances in diagnosis, surgical techniques and liver transplantation, long-term survival of liver cancer patients has been poor to date. The relevant data show that prognosis of liver cancer is closely related to disease progression stage: very early (bazerana stage 0, BCLC 0) and early (BCLC a) liver cancer patients after receiving active surgical treatment, 5 years survival rates are close to 90% and 50% -70%, respectively; however, the five-year survival rate of patients with middle and advanced liver cancer is only 14%. Therefore, effective early diagnosis and early treatment measures of liver cancer are one of key factors for improving prognosis of liver cancer patients.

Although the early diagnosis and early treatment of liver cancer are necessary, in clinic, the early diagnosis still faces a plurality of difficulties which are difficult to surmount. First, early liver cancer lacks specific symptoms, resulting in low admission rate to early liver cancer patients. About 2/3 of liver cancer patients are diagnosed for the first time, namely liver cancer in the progressive stage, and the opportunity of surgical treatment is lost; secondly, the existing screening means for liver cancer have defects in clinic. The diagnostic efficiency of liver ultrasound is affected by factors such as tumor size, subjective judgment of operators, review frequency and instrument accuracy, so that less than half of early liver cancer patients can be found in ultrasound examination. Alpha Fetoprotein (AFP) is a liver cancer marker widely applied in clinic, but the detection rate of early liver cancer is only 66%. Although most HCC has characteristic features in imaging, about 10% of tumors (up to 30% of tumors with diameters up to 1-2 cm) have atypical manifestations, lacking the imaging features of HCC. In addition, the prognosis after radical resection of liver cancer remains unsatisfactory due to the high incidence of postoperative recurrence. The identification of early diagnostic and prognostic biomarkers for metastatic liver cancer is therefore critical to overcome these persistent challenges to human health.

Disclosure of Invention

The invention aims to provide an application of hsa_circ_0002490 in preparing liver cancer detection or curative effect evaluation products, wherein the hsa_circ_0002490 can be used as a molecular marker of liver cancer, and can quickly, simply and accurately realize auxiliary diagnosis of liver cancer.

In order to achieve the above object of the present invention, the following technical solutions are specifically adopted:

the first aspect of the invention provides a molecular marker for detecting or evaluating curative effect of liver cancer, which is characterized by comprising at least one of hsa_circ_0002490, hsa_circ_0005197 and hsa_circ_0101802, wherein the nucleic acid sequence of hsa_circ_0002490 is shown as SEQ ID NO. 1; the nucleic acid sequence of hsa_circ_0005197 is shown in SEQ ID NO. 2; the nucleic acid sequence of hsa_circ_0101802 is shown in SEQ ID NO. 3.

The second aspect of the invention provides an application of the molecular marker in preparing liver cancer detection or curative effect evaluation products.

Preferably, the product includes, but is not limited to, a kit.

The third aspect of the present invention provides a product for liver cancer detection or efficacy evaluation, characterized in that the product comprises an amplification primer for amplifying cDNA complementary to a molecular marker;

the molecular marker comprises at least one of hsa_circ_0002490, hsa_circ_0005197 and hsa_circ_0101802, and the nucleic acid sequence of hsa_circ_0002490 is shown as SEQ ID NO. 1; the nucleic acid sequence of hsa_circ_0005197 is shown in SEQ ID NO. 2; the nucleic acid sequence of hsa_circ_0101802 is shown in SEQ ID NO. 3.

Preferably, the product further comprises RNA extraction reagents.

Preferably, the upstream amplification primer and the downstream amplification primer corresponding to hsa_circ_0002490 are respectively shown in SEQ ID NO. 4 and SEQ ID NO. 5;

the upstream amplification primer and the downstream amplification primer corresponding to hsa_circ_0005197 are respectively shown in SEQ ID NO. 6 and SEQ ID NO. 7;

the upstream amplification primer and the downstream amplification primer corresponding to hsa_circ_0101802 are respectively shown as SEQ ID NO. 8 and SEQ ID NO. 9.

The fourth aspect of the invention also provides an application of hsa_circ_0005197 and/or hsa_circ_0101802 SiRNA in preparing medicaments for treating liver cancer.

Preferably, the SiRNA sequence of hsa_circ_0101802 is as follows:

the sense strand sequence is shown as SEQ ID NO. 10, and the antisense strand sequence is shown as SEQ ID NO. 11; or, the sense strand sequence is shown as SEQ ID NO. 12, and the antisense strand sequence is shown as SEQ ID NO. 13.

In a fifth aspect, the invention provides a medicament for treating liver cancer, the medicament comprising hsa_circ_0005197 and/or hsa_circ_0101802 SiRNA.

Preferably, the SiRNA sequence of hsa_circ_0101802 is as follows:

Compared with the prior art, the invention has the beneficial effects that at least:

the molecular marker has a correlation with the liver cancer, can quickly, simply and accurately realize auxiliary diagnosis of the liver cancer, and provides a basis for diagnosis of the liver cancer and selection of curative effect evaluation indexes; in addition, the molecular marker can also be used as a therapeutic target of liver cancer drugs.

The amplification primer adopted by the invention has excellent specificity, can stably amplify the molecular marker, and improves the detection accuracy of the molecular marker.

Drawings

In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the embodiments or the prior art will be briefly described below. Like elements or portions are generally identified by like reference numerals throughout the several figures. In the drawings, elements or portions thereof are not necessarily drawn to scale.

FIG. 1 is a bar graph showing the expression level of circPNN in liver cancer cells in example 1 of the present invention;

FIG. 2 is a bar graph showing the expression level of circPTPN12 in liver cancer cells in example 1 of the present invention;

FIG. 3 is a bar graph showing the expression level of circFCHO2 in hepatoma cells in example 1 of the present invention;

FIG. 4 shows the results of fluorescence microscopy after expression of the silenced CircPNN in example 2 of the present invention;

FIG. 5 is a bar graph showing PCR detection of the expression level of CircPNN after silencing CircPNN expression in example 2 of the present invention;

FIG. 6 is a bar graph showing the ability of cells to proliferate after silencing of CircPNN expression in example 2 of the present invention;

FIG. 7 shows the results of an apoptosis flow assay of SK-HEP-1 cells after silencing of CircPNN expression in example 2 of the present invention;

FIG. 8 is a bar graph of SK-HEP-1 apoptosis rate after silencing of CircPNN expression in example 2 of the present invention;

FIG. 9 shows the result of Western Blot detection of Caspase-3 protein development in example 2 of the present invention;

FIG. 10 is a bar graph of the Western Blot detection of Caspase-3 protein expression levels in example 2 of the present invention.

Detailed Description

Embodiments of the technical scheme of the present invention will be described in detail below with reference to the embodiments. The following examples are only for more clearly illustrating the technical aspects of the present invention, and thus are merely examples, and are not intended to limit the scope of the present invention.

It is noted that unless otherwise indicated, technical or scientific terms used herein should be given the ordinary meaning as understood by one of ordinary skill in the art to which this invention pertains.

At present, the diagnosis efficiency of liver ultrasound is affected by factors such as tumor size, subjective judgment of operators, review frequency, instrument precision and the like, so that less than half of early liver cancer patients can be found in ultrasound examination. Alpha Fetoprotein (AFP) is a liver cancer marker widely applied in clinic, but the detection rate of early liver cancer is only 66%. Although most HCC has characteristic features in imaging, about 10% of tumors (up to 30% of tumors with diameters up to 1-2 cm) have atypical manifestations, lacking the imaging features of HCC. In addition, the prognosis after radical resection of liver cancer remains unsatisfactory due to the high incidence of postoperative recurrence. The identification of early diagnostic and prognostic biomarkers for metastatic liver cancer is therefore critical to overcome these persistent challenges to human health.

In view of the above, the embodiment of the invention provides a molecular marker for detecting or evaluating liver cancer, which is characterized in that the molecular marker comprises at least one of hsa_circ_0002490, hsa_circ_0005197 and hsa_circ_0101802,

the nucleic acid sequence of hsa_circ_0002490 is shown in SEQ ID NO. 1, and specifically comprises the following steps:

GUGUGUCACGGGGUCCCAGCCCUGUCAGCCUUGGAAAUCAGGAUACCUUACCUGUGGCAGUUGCCCUUACAGAAUCUGUUAAUGCCUACUUUAAAGGAGCAGAUCCCACCAAGUGUAUUGUGAAGAUCACUGGUGAUAUGACAAUGUCAUUUCCAAGUGGAAUUAUUAAAGUCUUCACCAGCAAUCCAACUCCAGCUGUGUUGUGCUUCAGGGUGAAAAAUAUCAGCAGACUAGAGCAGAUUCUUCCAAAUGCACAGCUUGUGUUCAG；

the nucleic acid sequence of hsa_circ_0005197 is shown in SEQ ID NO. 2, specifically:

UUGAUCACAGCCGAGUUAAAUUGACAUUAAAGACUCCUUCACAAGAUUCAGACUAUAUCAAUGCAAAUUUUAUAAAGGGCGUCUAUGGGCCAAAAGCAUAUGUAGCAACUCAAGGACCUUUAGCAAAUACAGUAAUAGAUUUUUGGAGGAUGAUAUGGGAGUAUAAUGUUGUGAUCAUUGUAAUGGCCUGCCGAGAAUUUGAGAUGGGAAGGAAAAAAUGUGAGCGCUAUUGGCCUUUGUAUGGAGAAGACCCCAUAACGUUUGCACCAUUUAAAAUUUCUUGUGAGGAUGAACAAGCAAGAACAGACUACUUCAUCAGGACACUCUUACUUGAAUUUCAAAAU；

the nucleic acid sequence of hsa_circ_0101802 is shown in SEQ ID NO. 3, specifically:

CAAAAGCGGCGCCAGGAAAUUGAACAAAAACUUGAAGUUCAGGCAGAAGAAGAGAGAAAGCAGGUUGAAAAUGAAAGGAGAGAACUGUUUGAAGAGAGGCGUGCUAAACAGACAGAACUGCGGCUUUUGGAACAGAAAGUUGAGCUUGCGCAGCUGCAAGAAGAAUGGAAUGAACAUAAUGCCAAAAUAAUUAAAUAUAUAAGAACUAAGACAAAGCCCCAUUUGUUUUAUAUUCCUGGAAGAAUGUGUCCAGCUACCCAAAAACUAAUAGAAGAGUCACAGAGAAAAAUGAACG。

the molecular marker has a correlation with liver cancer, wherein hsa_circ_0005197 and hsa_circ_0101802 are positively correlated with the liver cancer, and hsa_circ_0002490 is negatively correlated with the liver cancer; the molecular marker can quickly, simply and accurately realize auxiliary diagnosis of liver cancer, and provides a basis for diagnosis of liver cancer and selection of curative effect evaluation indexes; in addition, the molecular marker can also be used as a therapeutic target of liver cancer drugs.

The invention also provides an application of the molecular marker in preparing liver cancer detection or curative effect evaluation products.

Further, such products include, but are not limited to, kits.

Yet another embodiment of the present invention provides a product for liver cancer detection or efficacy evaluation, the product comprising an amplification primer for amplifying a cDNA complementary to a molecular marker;

the molecular marker comprises at least one of hsa_circ_0002490, hsa_circ_0005197 and hsa_circ_0101802, wherein the nucleic acid sequence of hsa_circ_0002490 is shown as SEQ ID NO. 1.

Further, the product also includes an RNA extraction reagent.

Further, the upstream amplification primer corresponding to hsa_circ_0002490 is shown as SEQ ID NO. 4, specifically CTGTGTTGTGCTTCAGGGTG; the downstream amplification primer is shown as SEQ ID NO. 5, specifically TGACACACCTGAACACAAGC;

the upstream amplification primer corresponding to hsa_circ_0005197 is shown as SEQ ID NO. 6, specifically CAAAATTTGATCACAGCCGAGT; the downstream amplification primer is shown as SEQ ID NO. 7, specifically GCCCATAGACGCCCTTTATAA;

the upstream amplification primer corresponding to hsa_circ_0101802 is shown as SEQ ID NO. 8, specifically AGAATGTGTCCAGCTACCCA; the downstream amplification primer is shown as SEQ ID NO. 9, specifically CAAAAGCCGCAGTTCTGTCT.

The amplification primer provided by the invention has excellent specificity, and can stably amplify the molecular marker, so that the detection accuracy of the molecular marker is effectively improved.

The embodiment of the invention also provides an application of hsa_circ_0005197 and/or hsa_circ_0101802 SiRNA in preparing medicaments for treating liver cancer.

Further, the SiRNA sequence of hsa_circ_0101802 is as follows:

the sense strand sequence is shown as SEQ ID NO. 10, specifically GAGAAAAAUGAACGCAAAA (TT), and the antisense strand sequence is shown as SEQ ID NO. 11, specifically UUUUGCGUUCAUUUUUCUC (TT); or, the sense strand sequence is shown as SEQ ID NO. 12, specifically AAUGAACGCAAAAGCGGCG (TT), and the antisense strand sequence is shown as SEQ ID NO. 13, specifically CGCCGCUUUUGCGUUCAUU (TT).

The SiRNA can inhibit the expression level of hsa_circ_0101802 in cells, further inhibit proliferation of liver cancer cells, and achieve the aim of treating liver cancer.

The embodiment of the invention also provides a medicine for treating liver cancer, which comprises hsa_circle_ 0005197 and/or SiRNA of hsa_circle_ 0101802.

Further, the SiRNA sequence of hsa_circ_0101802 is as follows:

The technical scheme of the invention is further described in detail through specific examples.

Example 1

In this example, expression of circPNN (hsa_circ_ 0101802), circFCHO2 (hsa_circ_ 0002490), and circPTPN12 (hsa_circ_ 0005197) in human liver cancer cell lines and human normal liver cell lines:

human normal hepatocyte line HL-7702 cells were cultured with RPMI-1640 medium+10% FBS Fetal Bovine Serum (FBS); whereas Huh-7 used DMEM medium+10% FBS; SK-HEP-1 was used as a special culture medium purchased from the national academy of sciences typical culture preservation Commission cell Bank (Shanghai). The cells are all cultivated in a cell incubator with the temperature of 37 ℃ and the saturated humidity of CO2 of 5 percent, and the cells grow in an adherence way.

(1) Cell resuscitation

The cells are rapidly thawed by shaking back and forth in a water bath kettle at 37 ℃ from a liquid nitrogen tank or an ultralow temperature refrigerator at-80 ℃. The cell suspension of the frozen tube is transferred into a 15ml centrifuge tube by a 1ml pipette in an ultra clean bench, blown and mixed evenly, and centrifuged at 1000rpm for 5min. The supernatant was discarded in an ultra clean bench, and 1ml of culture medium was added to resuspend the cells and blow-mix. The cell suspension was transferred to a flask, and 5ml of culture medium was added thereto, and the cells were uniformly distributed at the bottom of the flask by gentle shaking. The cell state was observed under an inverted microscope. The cell information, date and incubator information are marked, and the cells are placed in a carbon dioxide incubator for incubation.

(2) Cell exchange liquid

Observing the growth state of the cells under the mirror, and changing the cell culture medium once for 1-3 days as required. In the ultra clean bench, cells were washed 2-3 times with 1ml of the culture medium in a pipette cell flask, with 1 XPBS buffer, and then 5ml of new 10% FBS-containing cell culture medium was added.

(3) Cell passage

And observing the cells under a lens, and subculturing when 80% -90% of the cells are reached. In an ultra clean bench, old medium was aspirated with a 1ml pipette, followed by washing the cells 2-3 times with 1 XPBS, and then 1.5ml of 0.25% trypsin solution was added. The flask was placed down and gently shaken left and right to allow pancreatin to fully contact the cells and placed in a carbon dioxide incubator for digestion for 3 minutes. After the cells are completely digested into spheres and changed from adherent to floating, 2.0ml of culture solution is added to terminate the digestion. Centrifuging at 1000rpm for 5min at low speed, centrifuging at room temperature, discarding supernatant, adding 1ml of complete culture medium, blowing, resuspending cells, inoculating into new culture flask at ratio of 1:3, supplementing culture solution to 5ml, and culturing in cell incubator.

(4) Cell cryopreservation

Early procedures such as cell passaging. And (3) mixing FBS and DMSO according to a volume ratio of 4:1 to prepare the cell frozen stock solution. The digested cells were placed in a 10ml centrifuge tube and centrifuged at 1000rpm for 5min. After centrifugation, adding cell cryopreservation liquid, re-suspending, blowing, uniformly mixing and transferring to a cell sterile cryopreservation tube, wherein each tube is 1.6ml, sealing the tube orifice, and marking clearly the cell type and the cryopreservation date. The freezing tube is frozen according to the gradient cooling of 4 ℃ for 30min, 20 ℃ for 30min, 80 ℃ and ultra-low temperature refrigerator for 24 hours, and finally the frozen tube is placed into liquid nitrogen for long-term freezing.

(5) Cellular RNA extraction

After the medium was aspirated, the mixture was rinsed 1 time with PBS, 500. Mu.l of Trizol was added and allowed to stand at room temperature for 5 minutes, and after transferring Trizol to a new 1.5ml EP tube, 100. Mu.l of chloroform was added and thoroughly mixed to a chylomorph state and allowed to stand for 10 minutes. Centrifuging at 12000g for 15min at 4 ℃ to obtain an upper clear liquid, and putting the upper clear liquid into a new 1.5ml centrifuge tube; adding isopropanol precooled at-20deg.C and equal volume to the supernatant, mixing, standing at room temperature for 20min (or overnight at-80deg.C), centrifuging at 4deg.C 12000g for 10 min, and discarding supernatant; mu.l of pre-chilled 75% ethanol was added, after mixing well, the supernatant was discarded after centrifugation at 8500g for 5 minutes at 4℃and dried at room temperature for 5 to 10 minutes, and after complete evaporation of the alcohol 10. Mu.l RNase-, DNase-free Water was added to measure RNA concentration and purity.

(6) Reverse transcription reaction

Based on the RNA concentration measurements, total RNA was diluted to 500 ng/. Mu.l with enzyme-free water and reverse transcription reaction solutions were prepared on ice throughout the course of the procedure according to TAKARA RR037A reverse transcription kit instructions (Table 1). Immediately after preparation, the solution was put into a PCR apparatus for reverse transcription under conditions of 37℃for 15min and 85℃for 5s. The total cDNA measured concentration is obtained at the end of the reaction, and can be stored in a refrigerator at-80 ℃ or immediately subjected to real-time fluorescence quantitative PCR.

TABLE 1 preparation of reverse transcription reaction solution

(7) Real-time fluorescent quantitative PCR

The whole procedure was carried out on ice in the absence of light, and according to the instructions of TAKARA RR820A kit, a real-time fluorescent quantitative PCR (qRT-PCR) reaction solution was prepared according to Table 2, which was diluted appropriately according to the cDNA concentration, and the reaction system was 20. Mu.l per well, at least 3 multiplex wells.

TABLE 2 preparation of qRT-PCR reaction solution

The conditions of the amplification reaction are: a melting curve was obtained by fluorescence melting at 95℃for 30s (pre-denaturation) → (95℃for 5s,60℃for 30 s). Times.40 cycles). At the end of each cycle in Stage 2, the instrument automatically collects and analyzes the fluorescence intensity of each sample.

(8) Real-time fluorescent PCR data processing

After the reaction, the information such as the dissolution profile, dissolution temperature, etc. of the target gene is checked. The Ct value of the sample is extracted, and relative quantitative analysis of the differential expression level of the gene is carried out by using a log 2-delta Ct (delta Ct=Ct target gene-Ct reference gene, delta Ct=delta Ct liver cell-delta Ct normal human liver cell) method, and meanwhile U6 is set as the reference gene. Data analysis using GraphPad Premier 9 software, statistical analysis used a one-factor variance test.

(9) Results

The results of expression of circPNN (hsa_circ_ 0101802), circFCHO2 (hsa_circ_ 0002490), and circPTPN12 (hsa_circ_ 0005197) in the human liver cancer cell line and the human normal liver cell line are shown in tables 3 to 5; the expression histogram is shown in figures 1-3;

table 3 expression of circPNN in hepatoma cells (X soil SD, n=3)

VS HL-7702，*P<0.05，**P<0.01；

Table 4 expression of circptpn12 in hepatoma cells (X soil SD, n=3)

VS HL-7702，***P<0.001

TABLE 5 expression of circFCHO2 in hepatoma cells (Xsoil SD, n=3)

VS HL-7702，*P<0.05,**P<0.01

As can be seen from tables 3 to 5 and fig. 1 to 3:

compared with the human normal liver cell line HL7702 (FC value is 1.000+/-0.045), the circFCH02 shows low expression in liver cancer cells (FC values are 0.785+/-0.039, 0.036+/-0.004 and p <0.05 respectively); the circPNN shows high expression in a liver cancer cell line (FC values are respectively HL-7702 0.950+/-0.010, huh-7.206+/-0.118, SK-HEP-1.822+/-0.288 and p < 0.05); the circPTPN12 is also up-regulated in liver cancer cells (FC values are HL-7702:1.100+ -0.027, huh-7:1288.420+ -13.664, SK-HEP-1:1321.599+ -15.921, p <0.05 respectively); therefore, the molecular marker has a correlation with liver cancer, and can be used as a marker for liver cancer examination and curative effect evaluation.

Example 2

The present example is to silence the effect of circPNN (hsa_circ_ 0101802) in liver cancer cells SK-HEP-1 on the cell biology behavior:

(1) Experimental grouping

(1) siRNA-1 group: the circPNN-siRNA-1 (SEQ ID NO:10 and SEQ ID NO: 11)/lentiviral complex was added at the time of transfection. (2) siRNA-2 group: the circPNN-siRNA-2 (SEQ ID NO:12 and SEQ ID NO: 13)/lentiviral complex was added at the time of transfection. (3) Blank control group: liver cancer cells without any intervention.

(2) Cell transfection

Taking SK-HEP-1 liver cancer cells with good growth state and logarithmic phase, subjecting to trypsin digestion, centrifuging, re-suspending with culture solution, counting, and adjusting cell concentration to 1.0X10 ⁵ The density of each ml was inoculated into 6-well plates and placed in CO ₂ Culturing in incubator until cell density reaches 70% -80%; old medium was aspirated and cells were rinsed 2 times with PBS. The 25 Xviral infection solution was diluted to 1X using complete medium and 500. Mu.l of diluted 1 Xviral infection solution was added to each well. According to the instructions, transfection was performed with MOI=30 and 15. Mu.l of the circPNN-siRNA-virus complex at a concentration of 1X 108TU/ml was added per well. The culture plate is gently shaken, fully and uniformly mixed and placed in an incubator to be incubated for 8 hours, then fresh culture solution is replaced, and the culture is continued for 24 hours until the next experiment is needed.

(3) Detection of transfection efficiency

After 24h transfection, the transfection efficiency is observed under a fluorescence microscope, the observation result is shown in fig. 4, then total RNA of the cells is extracted, reverse transcription is carried out on the extracted total RNA, and the expression level of the circPNN is detected by qRT-PCR.

As can be seen from FIG. 4, the green fluorescent cells were seen under a fluorescent microscope after successful transfection of SiRNA-1 and SiRNA-2 groups.

The results of the expression level detection of the circPNN are shown in Table 6, and the histogram is shown in FIG. 5;

TABLE 6 PCR detection of the variation in the expression level of CircPNN after silencing

n＝3)

VS Control group，*P<0.05，**P<0.01

As can be seen from table 6 and fig. 5:

after SiRNA-1 and SiRNA-2 were transfected into human hepatoma cell SK-HEP-1, the PCR results suggested that the SK-HEP-1 intracellular Control group 1.005 soil 0.386; the relative expression level of SiRNA-1 group 0.366 soil 0.041 and Control group is reduced (P < 0.01); siRNA-2 group 0.449 soil 0.023, relative expression level decreased with Control group (P < 0.01), relative expression level increased with SiRNA-1 group (P > 0.05).

(4) CCK8 detection of cell proliferation after transfection

Taking SK-HEP-1 cells after transfection, digesting with pancreatin, centrifuging, and preparing into concentration of 2.0X10 ⁴ Cell suspension per ml. The 96-well plates were added 100 μl of cell suspension per well in experimental groups, 3 replicates per group. To prevent the evaporation of the cell culture medium from interfering with the experimental results, PBS was added to the surrounding blank wells. The 96-well plate was placed in a cell incubator, cultured for 24 hours, and then removed, and 10. Mu.l of CCK8 reagent was added to each well. The 96-well plate was returned to the cell incubator and the absorbance of each well was measured on a microplate reader after 2 hours. Cell proliferation rate= (experimental group OD value/control group OD value);

the results are shown in Table 7, and the bar graph is shown in FIG. 6;

TABLE 7 cell proliferation potency Change after CircPNN silencing

n＝3)/>

VS Control group，*P<0.05，**P<0.01；VS SiRNA-1 group， ^# P<0.05， ^## P<0.01

As can be seen from table 7 and fig. 6:

control group 102.280 soil 5.399; siRNA-1 group 49.259 soil 2.272, decreased cell proliferation rate compared to Control group (P < 0.01); the cell proliferation rate was decreased (P < 0.01) in the SiRNA-2 group 82.628 soil 4.013 compared to the Control group, and increased (P < 0.01) compared to the SiRNA-1 group.

(5) Flow cytometry to detect apoptosis

Taking siRNA transfected SK-HEP-1 cells of blank control group and experimental group, preparing single cell suspension, and adjusting cell density to 2×10 ⁵ Inoculating the cells/ml to a 6-well plate, culturing for 48 hours by using serum-free DMEM culture solution, digesting the cells by using trypsin, stopping digestion by using a complete culture medium, collecting cell digestion solution, centrifuging, collecting by centrifuging, suspending the cell suspension by using PBS after supernatant is discarded, centrifuging the supernatant, adding 100 mu l of 1×loading buffer solution to lightly suspend the cells, and transferring the cells to a flow tube; adding 5 mu.l annexin V and 5 mu.l 7-AAD, gently mixing, incubating at room temperature in the absence of light for 15min (on ice), adding 400 mu.l of 1×loading buffer solution, and detecting and analyzing by using a flow cytometer; and (3) result judgment: the lower left quadrant Q3 shows living cells, the upper left quadrant Q1 is necrotic cells, the upper right quadrant Q2 is late apoptotic cells, and the lower right quadrant Q4 is early apoptotic cells. Total apoptosis rate = (q2+q4)%.

The results of the flow-through analysis of SK-HEP-1 apoptosis after expression of the silenced CircPNN are shown in FIG. 7; the apoptosis rate of SK-HEP-1 cells after the expression of the silencing CircPNN is shown in Table 8, and a bar graph is shown in FIG. 8;

TABLE 8 apoptosis Rate of SK-HEP-1 cells after CircPNN expression silencing

n＝3)

As can be seen from table 8 and fig. 7 to 8, the Control group 4.800 is 0.608; siRNA-1 group 27.133 soil 0.751, increased apoptosis rate compared to Control group (P < 0.01); siRNA-2 group 16.633 showed an increase in apoptosis rate (P < 0.01) compared to Control group and a decrease in apoptosis rate (P < 0.01) compared to SiRNA-1 group 0.404.

(6) Western blot detection of intracellular protein expression

Preparation of protein samples and determination of the content

(1) Cells with good growth state were collected, cultured and passaged as described above, inoculated into 6-well cell culture plates, and observed to have good growth state and confluence of about 80%, rinsed twice with pre-chilled PBS, collected by conventional digestion, and transferred into 3 1.5ml EP tubes in groups. (2) Mu.l of the complex cell lysate (25 Xproteinase inhibitor 12. Mu.l+100 XPMSF 3. Mu.l+10 Xphosphatase inhibitor 30. Mu.l+RIPA make-up volume to 300. Mu.l) was added to each EP tube and lysed by shaking on ice for 30min. (3) The EP tube was transferred to a high-speed refrigerated centrifuge for centrifugation at 12000rpm at 4℃for 20min, the supernatant from the EP tube was aspirated, and the pellet was discarded to obtain total cellular protein.

Preparation of SDS-PAGE gels

According to the molecular weight of the protein required by the experiment, separating gel and concentrated gel with proper concentrations are prepared according to the description of the kit, and when the gel is prepared, the phenomenon of gel leakage is noted, and bubbles are avoided between the separating gel and the concentrated gel.

Loading sample

The electrophoresis device is placed in an electrophoresis tank, electrophoresis liquid is added to exceed the plane of the gel, a comb is pulled out, protein samples with the same mass are respectively added into each hole according to the sequence according to the measured protein concentration, the sample loading amount is generally 25 mu l, the sample is added to the bottom of each hole during sample loading, bubbles are avoided, overflow proteins are prevented from influencing experimental results in the electrophoresis liquid, and a pre-dyed protein molecular marker with the proper model is added into two holes at the outermost side according to the molecular weight of target proteins.

Electrophoresis

The constant pressure method is adopted: setting 80V for 30min during electrophoresis of the concentrated gel; 120V was set when separating the gel and electrophoresis stopped when bromophenol blue reached the bottom of the gel.

Transfer film

Selecting PVDF film with proper pore size, shearing the film with proper size according to the width of the gel with the molecular weight of the protein, marking, and soaking in methanol; taking out the separated protein gel plate from the electrophoresis tank, separating target protein from the internal reference according to the molecular weight mark of the pre-dyed protein, placing the target protein and the internal reference on the membrane transfer plate, and covering the membrane transfer plate with a corresponding PVDF membrane, wherein the PVDF membrane is completely covered on the surface of the separation gel, and bubbles are avoided in the covering process. The film is put into a film transfer groove according to the principle of red to red and black to black, and the placement direction of the film transfer plate is noted. Constant voltage transfer was used, 120V voltage transfer was performed for 90min. The transfer tank was placed in ice water and kept at a constant low temperature.

Closure

Placing a PVDF membrane in TBST, washing for 5min, blocking with 5% BSA solution, placing the PVDF membrane in blocking solution, and blocking for 1h at room temperature on a shaking table;

anti-incubation

Taking out the PVDF film from the sealing liquid, putting the PVDF film into TBST, washing for 5min X3 times, putting the PVDF film into diluted primary antibody solution after washing, and shaking the PVDF film overnight at 4 ℃;

second antibody incubation

Placing PVDF membrane and diluted primary antibody solution on a shaking table, re-heating for 1h at room temperature, taking out PVDF membrane from primary antibody dilution, placing in TBST, shaking table for 5min x4 times at room temperature, selecting horseradish peroxidase-labeled goat anti-rabbit or goat anti-mouse secondary antibody, adding into TBS containing 5% according to a certain proportion, shaking uniformly, placing PVDF membrane into secondary antibody dilution, placing on shaking table at room temperature, and incubating for 1h

Development process

After the secondary antibody is incubated, placing the strip in TBST for washing 5minx3 times, preparing ECL developing solution from luminescent solution and stabilizing solution according to the proportion of 1:1, and placing the film in Tanon5200 for developing, photographing and preserving; the photographing result is shown in fig. 9;

the expression level of Caspase-3 protein detected by Western Blot is shown in Table 9, and a bar graph is shown in FIG. 10;

TABLE 9 Western Blot detection of Caspase-3 protein expression level

n＝3)/>

As can be seen from table 9 and fig. 9 to 10:

control group 0.553 soil 0.067; siRNA-1 group 1.237 soil 0.110, increased expression level of C3 protein compared to Control group (P < 0.01); siRNA-2 group 0.957 soil 1.102 showed higher expression level of C3 protein than Control group (P < 0.01) and lower expression level of C3 protein than SiRNA-1 group (P < 0.05).

Statistical analysis

All data were obtained as a result of 3 independent experiments, and statistical analysis was performed using SPSS 25.0 software. Normal distribution metrology data results are expressed as mean ± standard error (x±sd), the comparison of differences between groups is by single factor analysis of variance, and P <0.05 is considered statistically significant.

In conclusion, the molecular marker has a correlation with liver cancer, can quickly, simply and accurately realize auxiliary diagnosis of the liver cancer, and provides a basis for diagnosis of the liver cancer and selection of curative effect evaluation indexes; in addition, the molecular marker can also be used as a therapeutic target of liver cancer drugs.

Finally, it should be noted that: the above embodiments are only for illustrating the technical solution of the present invention, and not for limiting the same; although the invention has been described in detail with reference to the foregoing embodiments, it will be understood by those of ordinary skill in the art that: the technical scheme described in the foregoing embodiments can be modified or some or all of the technical features thereof can be replaced by equivalents; such modifications and substitutions do not depart from the spirit of the invention, and are intended to be included within the scope of the appended claims and description.

Claims

The application of hsa_circ_0002490 in preparing a liver cancer detection or curative effect evaluation product, wherein the nucleic acid sequence of hsa_circ_0002490 is shown as SEQ ID NO. 1.
2. The use of claim 1, wherein the product comprises, but is not limited to, a kit.