CN111235271A

CN111235271A - Application of accurate treatment based on guidance of hepatocellular carcinoma and application of accurate treatment based on guidance of hepatocellular carcinoma in kit

Info

Publication number: CN111235271A
Application number: CN201911271908.5A
Authority: CN
Inventors: 杨扬; 覃伟; 刘炜; 王励
Original assignee: Third Affiliated Hospital Sun Yat Sen University
Current assignee: Third Affiliated Hospital Sun Yat Sen University
Priority date: 2019-12-12
Filing date: 2019-12-12
Publication date: 2020-06-05

Abstract

The invention discloses an application of the method based on guidance of accurate treatment of hepatocellular carcinoma, namely the application of detection of miR-375 expression level in plasma exosomes of hepatocellular carcinoma patients in guidance of accurate target treatment of hepatocellular carcinoma, and the combined application of the miR-375 expression level in the plasma exosomes and the expression level of alpha fetoprotein α -fetoprotein (AFP) expression level in plasma.

Description

Application of accurate treatment based on guidance of hepatocellular carcinoma and application of accurate treatment based on guidance of hepatocellular carcinoma in kit

Technical Field

The invention relates to the technical field of biological medicines, in particular to an application of accurate targeted therapy based on guidance of hepatocellular carcinoma and a kit.

Background

Hepatocellular carcinoma (HCC) is one of the most common malignancies in our country or even worldwide. In recent years, with the progress of surgical techniques and the application of high-new life science and technology, a comprehensive treatment method mainly based on 'surgical treatment' is widely adopted clinically, so that the overall treatment effect of liver cancer is improved to a certain extent. However, the recurrence and metastasis rate after liver cancer operation is still high, and the 5-year survival rate after liver cancer operation is only 30-50%, which hinders further improvement of the curative effect of liver cancer treatment.

With the continuous progress of medical technology, the medical mode gradually changes to an accurate medical mode which attaches importance to individual signs, and the new concept and mode of accurate medical treatment may bring new hope to the treatment of HCC patients. Accurate medicine is based on gene sequencing technology, proteomics detection technology and bioinformatics, and carries out analysis, identification, verification and application of biomarkers, so that pathogenesis and treatment targets of diseases are accurately found, HCC patients are layered, and finally, specific patients are individually and accurately treated. The biomarkers of tissue biopsy play an important role in guiding the targeted therapy and immunotherapy of precise medicine. In recent years, the tumor liquid biopsy has rapid development, and has the advantages of rapidness, convenience, small damage, continuous and repeated sampling, convenience for dynamic monitoring and the like. Clinically, it is used by physicians to monitor the response of tumors to treatment and predict tumor recurrence. In the long term, fluid biopsies can also help physicians to arrive at the earliest diagnosis when the patient is asymptomatic. Currently, the biomarkers mainly used for detecting tumor sources in liquid biopsy include Circulating Tumor Cells (CTCs), circulating tumor deoxyribonucleic acid (ctDNA), and exosomes (exosomes).

Exosomes are vesicles with a diameter of about 30-100nm coated with a double-layer lipid membrane, which are formed into multivesicular bodies (MVBs) through a series of complex mechanisms after the cell membrane is invaginated, and then the MVBs are fused with the cell membrane and released to the outside of the cell. The exosome contains proteins such as cytokines and growth factors similar to the cells from which the exosome is derived, and bioactive substances such as lipid, coding or non-coding ribonucleic acid (RNA) and the like, can be transported to another cell along with blood, directly activate the cell through ligand-receptor interaction, mediate the transport of membrane receptors and shuttle of the bioactive substances among different cell types, and participate in the fine cellIntercellular substance exchange and information exchange^[1]. A large number of studies indicate that exosomes play an important role in tumorigenesis and organ-prone metastasis. Today, collecting and analyzing exosomes released by tumors has become an important development direction for liquid biopsy. Relevant research shows that micro RNA (miRNA) -21(miR-21) in serum exosome can better distinguish esophageal squamous cell carcinoma from benign disease^[2](ii) a Similarly, miR-21 in serum exosome of hepatocellular carcinoma patient is obviously higher than that of chronic hepatitis B patient and normal population^[3]. Since exosomes are widely present in many body fluids, some researchers have tested relevant markers in other body fluid-derived exosomes. In 2014, Dijkstra S and other research results suggest that prostate specific antigen and prostate tumor gene 3 are also detected in urine-derived exosomes of prostate cancer patients^[4]. In 2016, Machida T et al found that miRNA-1246(miR-1246) and miR-4644(miR-4644) in salivary exosomes have good diagnostic efficacy in pancreatic bile duct tumors, and the area under the curve can reach 0.833^[5]。

For example, in serum exosomes of tumor patients with lung metastasis, integrin β 4(integrin β 4, ITG β 4) is expressed at a significantly higher level than in serum exosomes of tumor patients without tumor metastasis or liver metastasis, and in serum exosomes of tumor patients with liver metastasis, integrin α 5((integrin α 5, ITG α 5) is expressed at a significantly higher level than in serum exosomes of tumor patients without tumor metastasis or lung metastasis, which suggests that integrin in exosomes can be used as an indicator for determining whether tumor has metastasis tendency or not^[6]. In addition, other researches show that the content of MIF (migration inhibition factor) in the serum exosome of the stage I pancreatic ductal adenocarcinoma patient with liver metastasis is obviously higher than that of the tumor non-progressing patient and normal population^[7]. In addition, researches show that miR-21 in serum exosomes is closely related to esophageal cancer recurrence and distant metastasis^[8]. Based on the research results, miRNA in the serum exosomes can be reasonably used as a marker for judging whether the tumor has distant metastasis. However, the problem of the source of miRNA in serum exosomes remains to be further investigated. A recent study has shown that^[9]The level of programmed death ligand 1 (PD-L1) in plasma exosomes reflects the level of activation of T cells by immune checkpoint inhibitors in vivo. Dynamic monitoring of changes in the levels of PD-L1 in plasma exosomes in vivo is effective in monitoring the therapeutic efficacy of anti-PD-1. This will help to achieve accurate medical and individualized treatment of the tumor.

The research shows that miR-375 is a cancer-suppressing miRNA, is widely present in tumor tissues such as head and neck tumors, liver cancers, esophageal cancers, breast cancers and the like and is in a low expression state, and the miR-375 is involved in the proliferation, metastasis, apoptosis and cell cycle regulation of the tumor cells.

Disclosure of Invention

The invention aims to provide an application of the kit in accurate treatment based on guidance of hepatocellular carcinoma and a kit, which are convenient and efficient and can better guide accurate targeted treatment of hepatocellular carcinoma.

The invention is realized by the following technical scheme:

based on the application of guiding accurate targeted therapy of hepatocellular carcinoma, the method is characterized by detecting the expression level of miR-375in plasma exosomes of a hepatocellular carcinoma patient and guiding the accurate targeted therapy of the hepatocellular carcinoma.

Detecting the expression level of the alpha-fetoprotein α -fetoprotein AFP in the plasma, and combining the expression level of miR-375in plasma exosomes with the expression level of the alpha-fetoprotein α -fetoprotein AFP in the plasma.

A kit for diagnosing hepatocellular carcinoma is characterized in that the kit is used for detecting the expression level of miR-375in plasma exosomes.

The plasma exosomes miR-375 are biomarkers for predicting therapeutic effect of ranvatinib.

The kit is also used for detecting the expression level of the alpha-fetoprotein α -fetoprotein AFP in the plasma, and the expression level of miR-375in the plasma exosome and the expression level of the alpha-fetoprotein α -fetoprotein AFP in the plasma are jointly applied to design the kit.

The reagent components of the kit for hepatocellular carcinoma diagnosis comprise: the reagent is used for extracting total RNA of plasma exosomes and specifically detecting the expression level of miR-375in the plasma exosomes.

Further, the kit comprises a reagent for extracting plasma exosomes of normal people, chronic hepatitis B patients and hepatocellular carcinoma patients, a reagent for synthesizing a cDNA first strand of miRNA reverse transcription, a reagent for miRNA fluorescent quantitative PCR detection, upper and lower primers of human hsa-miR-375, and reagents for diluting plasma and primers.

The reagent for extracting the Plasma exosomes of the normal population, the chronic hepatitis B patient and the hepatocellular carcinoma patient comprises Buffer XBP, Buffer XWP, QIAzol, miRNeasy Serum/Plasma Spike-In Control working solution, chloroform, absolute ethyl alcohol, RWT Buffer solution and RPE Buffer solution.

The reagent for cDNA first strand synthesis of miRNA reverse transcription comprises 2 x miRNA RT Reaction Buffer, miRNA RT Enzyme Mix and RNase-Free ddH₂O。

The reagent for miRNA fluorescent quantitative PCR detection comprises 2 x miRcute Plus miRNA PreMix (SYBR)&ROX) and RNase-Free ddH₂O; the reagent for diluting plasma and primer comprises PBS and RNase-freeddH₂O。

Expression level of miR-375in the plasma exosomes: the cutoff value calculated by the Johnson index method for plasma exosome miR-375 of hepatocellular carcinoma patients is 11.06.

The invention has the advantages that:

the application is further used for the design of a kit, and the expression level of miR-375in plasma exosomes of a hepatocellular carcinoma patient can be detected by the kit, so that the best benefitting population can be screened, and the accurate targeted therapy of the hepatocellular carcinoma can be guided. Because miR-375in plasma exosomes of hepatocellular carcinoma patients is mainly from cancer-associated fibroblast (CAFs) derived exosomes, the CAFs can further enhance and maintain the activation state of the CAFs by secreting the exosomes miR-375in vivo; in addition, the molecular targeting drug ranvatinib (lenvatinib) suitable for first-line unresectable hepatocellular carcinoma patients has the effect of promoting CAFs (circulating endothelial cells) derived exosomes miR-375 (miR-375)⁺Exosomes) are released.

Drawings

FIG. 1 is a schematic diagram (one) of the expression level of plasma exosome miR-375in hepatocellular carcinoma patients in the training group and the diagnostic efficacy thereof.

FIG. 2 is a schematic diagram showing the expression level of plasma exosome miR-375in a verification group of hepatocellular carcinoma patients and the diagnostic efficacy thereof (II).

FIG. 3 is a schematic representation of the selectivity of miR-375in plasma exosomes of hepatocellular carcinoma patients.

FIG. 4 is a schematic representation of miR-375 expression levels in plasma exosomes, cancerous tissues and paracancerous liver tissues of a typical hepatocellular carcinoma patient.

FIG. 5CAFs by releasing miR-375⁺Schematic representation of exosomes enhancing self-activation state.

FIG. 6 Lunvatinib promoted CAFs-derived miR-375⁺Schematic representation of the release of exosomes and enhancing the activation state of CAFs.

FIG. 7 schematic representation of the delivery of miR-375 from CAFs-derived exosomes into Human Umbilical Vein Endothelial Cells (HUVECs).

FIG. 8 shows that Ras p21 protein activator 1(Ras p21 protein activator 1, RASA1) is a schematic representation of the direct target gene of miR-375.

Fig. 9 is a schematic diagram of miR-375 promoting tumor angiogenesis through targeted modulation of expression of RASA 1.

FIG. 10 is a schematic diagram of miR-375 activating Ras/extracellular regulated protein kinases (Erk) signaling pathways in HUVECs.

Detailed Description

The present invention is not to be considered as limited to the particular embodiments shown. Those skilled in the art, having the benefit of this disclosure, may effect numerous modifications thereto without departing from the scope of the invention in its aspects. The present invention will be described in detail below with reference to the embodiments with reference to the attached drawings.

The invention relates to an application of the method in guiding accurate targeted therapy of hepatocellular carcinoma, in particular to an application of detecting the expression level of miR-375in plasma exosomes of a hepatocellular carcinoma patient in guiding accurate targeted therapy of hepatocellular carcinoma.

The kit is used for detecting the expression level of miR-375in the plasma exosome, and the expression level of miR-375in the plasma exosome is applied to guiding accurate targeted therapy of hepatocellular carcinoma. Plasma exosomes miR-375 are also used as a biomarker for predicting the efficacy of treatment with ranvatinib.

The kit is also used for detecting the expression level of the alpha-fetoprotein α -fetoprotein AFP in the plasma, namely the expression level of miR-375in plasma exosomes and the expression level of the alpha-fetoprotein α -fetoprotein AFP in the plasma, and is used for designing the kit.

The reagent components of the kit for diagnosing hepatocellular carcinoma comprise:

a reagent for extracting plasma exosomes of normal people, chronic hepatitis B patients and hepatocellular carcinoma patients; a reagent for first strand cDNA synthesis for reverse transcription of miRNA; a reagent for fluorescent quantitative PCR detection of miRNA; upper and lower primers of human hsa-miR-375; and reagents for diluting plasma and primers. Wherein the extract is used for extracting normal population, chronic hepatitis B patient and hepatocellular carcinomaReagents for patient Plasma exosomes include Buffer XBP, Buffer XWP, QIAzol, miRNeasy Serum/Plasma Spike-In Control working solution, chloroform, absolute ethanol, RWT Buffer, and RPE Buffer. The reagent for cDNA first strand synthesis of miRNA reverse transcription comprises 2 x miRNA RT Reaction Buffer, miRNA RT Enzyme Mix and RNase-Free ddH₂And O. The reagent for miRNA fluorescent quantitative PCR detection comprises 2 x miRcute Plus mirnaprep mix (SYBR)&ROX) and RNase-Free ddH₂O; the reagent for diluting plasma and primer comprises PBS and RNase-Free ddH₂O。

In the expression level of miR-375in plasma exosomes: the cutoff value calculated by the Johnson index method for plasma exosome miR-375 of hepatocellular carcinoma patients is 11.06.

The invention adopts a Real-time RCR method to detect the expression level of miR-375in plasma exosomes of normal persons, chronic liver disease patients and hepatocellular carcinoma patients. The result indicates that the expression level of plasma exosome miR-375 of the hepatocellular carcinoma patient is obviously higher than that of normal people and chronic liver disease patients. Meanwhile, the invention analyzes the correlation between the plasma exosome miR-375 and clinical pathological characteristics. The results show that the up-regulation of miR-375 expression level in plasma exosomes is closely related to microvascular invasion, Barcelona Clinical Liver Cancer (BCLC) staging and postoperative early relapse. In addition, the expression level of plasma exosome miR-375 can be used for predicting the clinical prognosis of hepatocellular carcinoma patients.

In order to investigate whether the plasma exosome miR-375 has clinical transformation value, the diagnosis efficiency of the plasma exosome miR-375in hepatocellular carcinoma is evaluated firstly, a training group and a verification group are established, an enzyme linked immunosorbent assay (ELISA) method is adopted to detect the expression level of alpha-fetoprotein (α -fetoprotein, AFP) in plasma, then a receiver operating characteristic curve (ROC) is drawn according to the expression levels of the plasma exosome miR-375 and the AFP, the result of the training group indicates that the diagnosis efficiency of the plasma exosome is slightly higher than that of the AFP when the plasma exosome is singly diagnosed, the area under the curve (area under curve, AUC) of the plasma exosome reaches 0.867 when the AFP is diagnosed in combination, the sensitivity is 74.0%, and the specificity is 88.9%, the result indicates that the plasma exosome miR-375 also has better diagnosis efficiency on hepatocellular carcinoma patients is further verified in the verification group.

Then, the invention adopts a Real-time RCR method to detect the expression conditions of miR-375in cancer tissues of a hepatocellular carcinoma patient and corresponding paracancer tissues. The results show that the expression level of miR-375in cancer tissues is obviously lower than that of paracancer tissues. The results indicate that the miR-375in the plasma exosomes of the hepatocellular carcinoma patients has a specific sorting process, so that the low expression of the miR-375in liver cancer tissues and the high expression of the miR-375in the plasma exosomes are caused. The expression level of miR-375in cells (liver cancer cells, CAFs and vascular endothelial cells) forming the primary focus of the liver cancer and source exosomes thereof is detected by adopting a Real-time PCR method. The results suggest that miR-375in exosomes is mainly derived from CAFs.

The invention further discusses the release of miR-375 by CAFs⁺The relationship between exosomes and their own activation states. The results show that CAFs can release miR-375⁺Exosomes enhance their activation state.

The Ranvatinib has the effect of up-regulating the expression level of the miR-375 of the CAFs-derived exosome. Results suggest that the Lunvatinib can promote CAFs to release miR-375⁺Exosomes, and enhances its own activation state.

Finally, the invention also provides that miR-375in the CAFs-derived exosome can promote the generation of tumor vessels by remodeling the endothelial cell skeleton and enhancing the proliferation and migration capabilities of endothelial cells. The results probably suggest that the plasma exosome miR-375 is expected to be a marker for screening the optimal beneficial population of the ranvatinib and a potential action target of combined treatment.

In the present invention, figure 1 expression levels of plasma exosomes miR-375in a training set of hepatocellular carcinoma patients and their diagnostic potency; a, a schematic diagram of clinical plasma sample exosome extraction. After total RNA of the plasma exosomes is extracted, the expression level of miR-375in the plasma exosomes is detected by adopting a Real-timePCR method. B-C: in the training group, the expression level of miR-375 (P <0.05) in plasma exosomes of 7 normal populations, 20 patients with chronic hepatitis B or hepatitis B cirrhosis and 106 patients with hepatocellular carcinoma was detected by using a Real-time PCR method. D (upper panel) sensitivity, specificity and area under the curve (AUC) for independent and combined diagnosis of hepatocellular carcinoma by plasma exosomes miR-375 and AFP in the training set. (lower panel) in the training set, plasma exosomes miR-375, AFP, independently and in combination, diagnose the receiver operating characteristic curve (ROC curve) for hepatocellular carcinoma. The greater the AUC in the graph, the higher the diagnostic value. (E) (upper panel) positive expression rates of plasma exosomes miR-375 and AFP in hepatocellular carcinoma patients in the training set. (lower panel) positive expression rate of plasma exosome miR-375in training groups in AFP-positive and AFP-negative hepatocellular carcinoma patients, respectively.

FIG. 2 expression levels of plasma exosome miR-375in validation groups of hepatocellular carcinoma patients and their diagnostic efficacy; A-B: in the validation group, the expression level of miR-375in plasma exosomes of 9 normal populations, 12 chronic hepatitis B or hepatitis B cirrhosis patients and 34 hepatocellular carcinoma patients (P <0.05 and P <0.01) was detected by using the Real-time PCR method. C: in the validation group, plasma exosomes miR-375, AFP independently and jointly diagnose sensitivity, specificity and area under the curve (AUC) of hepatocellular carcinoma. (lower panel) in the validation group, plasma exosomes miR-375, AFP, were independently and jointly diagnostic of the receiver operating characteristic curve (ROC curve) for hepatocellular carcinoma. The greater the AUC in the graph, the higher the diagnostic value. D (left panel) positive expression rates of plasma exosomes miR-375 and AFP in hepatocellular carcinoma patients in the validation group. (right panel) positive expression rate of plasma exosome miR-375in the validation group in AFP-positive and AFP-negative hepatocellular carcinoma patients, respectively. And E, detecting the expression level of miR-375in plasma exosomes of 16 BCLC0& A stages and 18 BCLC B/C stages of hepatocellular carcinoma patients in the verification group by using a Real-time PCR method, and comparing the expression levels (P is less than 0.05). Further defining the relationship between postoperative recurrence of hepatocellular carcinoma patients and miR-375 expression levels in preoperative plasma exosomes (. about.P < 0.05).

FIG. 3miR-375 is selectively sequestered into plasma exosomes from hepatocellular carcinoma patients; a: the Real-time PCR method detects the expression level of miR-375in liver cancer and adjacent non-tumor liver tissue specimens of 76 HCC patients respectively. B: the Real-time PCR method detects the expression level of miR-375in plasma samples of 76 HCC patients. C: the expression level of the miR-375 of the exosome in the plasma sample of the HCC patient is detected by a Real-time PCR method, and the correlation between the expression level of the miR-375 and the expression level of the miR-375in the liver cancer tissue sample is determined (P is less than 0.05). Respectively detecting the expression levels of miR-375in normal liver cells (L02), liver cancer cell lines (Huh7, HepG2 and MHCC97-L), CAFs, PAFs, human liver shape cells (LX2), HUVECs mother cells and source exosomes thereof by a Real-time PCR method. Respectively detecting the expression levels of miR-375in normal liver cells (L02), liver cancer cell lines (Huh7, HepG2 and MHCC97-L), CAFs, PAFs, human liver-shaped cells (LX2) and HUVECs-derived exosomes and a conditioned medium by a Real-time PCR method. F, after 20 μ M GW4869 treatment of liver cancer cell lines (Huh7, HepG2 and MHCC97-L) and CAFs for 48 hours, the expression level of miR-375in the above cells and exosomes was measured by Real-time PCR method (P <0.05, P < 0.001).

FIG. 4 expression levels of miR-375in plasma exosomes, cancer tissues and paracancerous liver tissues of a typical hepatocellular carcinoma patient. A: patients were 1,79 years old, 4.0cm in size, position VI, Edmondson-Steiner grade II;

patient

2,28 years old, 4.9cm in size, position V/VIII, Edmondson-Steiner grade II;

patient

3,73 years old, 14.0cm in size, right liver position, Edmondson-Steiner grade III; b: expression levels of miR-375 and AFP in plasma exosomes of three typical hepatocellular carcinoma patients. C: expression levels of miR-375in cancer tissue and paracancerous liver tissue (P < 0.001) in three typical hepatocellular carcinoma patients. D: the relationship between cancer tissue and miR-375 expression levels in plasma exosomes in the same hepatocellular carcinoma patients (. P <0.05,. P <0.01,. P < 0.001). HCC hepatocellular carcinoma; ANLT, paracancerous liver tissue.

FIG. 5CAFs by releasing miR-375⁺After 20 mu M GW4869 is used for inhibiting secretion of CAFs exosomes, Real-time PCR and Western blot detection show that the expression level of mRNA and protein of a CAFs activation marker α -SMA is remarkably reduced (P)<0.01,***P<0.001); and C, Western blot detection shows that the activity of the CAFs can be further enhanced after the CAFs are externally thrown to miR-375in the form of exosomes.

FIG. 6 Lunvatinib promoted CAFs-derived miR-375⁺Exosome release and enhancement of CAFsActivating, A, carrying out Western blot detection on the expression conditions of α -SMA and Rab27a in the CAFs after the CAFs are treated by different concentrations of Farnetinib for 72 hours, B, treating the CAFs by 5.0 mu M Farnetinib and collecting cell supernatant, and detecting the expression level (P) of exosome miR-375in the supernatant by a Real-time PCR method<0.05)。

FIG. 7 shows that miR-375 is transferred into HUVECs by CAFs-derived exosomes, A is that after 100 mu g of CAFs-derived exosomes and HUVECs are incubated for 24 hours, miR-375 labeled by Cy3 can enter HUVECs, B is that after 10 mu M RNA polymerase-II inhibitor (5, 6-dichoro-1- β -D-ribofuranoside, DRB) is added, the miR-375 expression level in HUVECs treated by CAFs-derived exosomes has no obvious change.

FIG. 8Ras p21 protein activator 1(Ras p21 protein activator 1, RASA1) is the direct target gene of miR-375; a (a) potential binding sites of miR-375 and RASA1-3 'UTR region, including RASA1 wild type and mutant 3' UTR binding site region. (b) The dual-luciferase reporter gene experiment shows that the fluorescence signal intensity of HEK293T over-expressing miR-375in a wild-type group in the RASA 1-3' UTR region is reduced, but the completely opposite result is shown in an anti-miR-375 group. It was suggested that miR-375 inhibited the expression of RASA1 by direct binding to the 3' UTR region of RASA1 (. P <0.05,. P < 0.01). B: (a) real-time PCR detected changes in RASA1 mRNA levels in HUVECs overexpressing miR-375 (. about.. P < 0.01). (b) Western blot was used to detect changes in the level of RASA1 protein in HUVECs overexpressing miR-375. C: (a) after co-culturing 100. mu.g of CAFs-derived exosomes with HUVECs, Real-time PCR detected changes in the level of RASA1 mRNA in HUVECs (. about.P < 0.01). (b) After 100 mu g of CAFs-derived exosome is co-cultured with HUVECs, Western blot is used for detecting the change condition of the RASA1 protein level in the HUVECs.

Fig. 9miR-375 promotes tumor angiogenesis by targeted modulation of expression of RASA 1; a: small interfering RNA (siRNA) plasmids of RASA1 are constructed and transfected into HUVECs cells, and the transfection efficiency is verified by Real-time PCR and Western blot methods. CCK-8(B), angiogenesis experiment (C), Transwell invasion experiment (D), scratch healing experiment (E) and TUNEL experiment (F) are used for detecting the influence of RASA1 on the angiogenesis and migration capability, proliferation and apoptosis of HUVECs. G-K: CCK-8(G), angiogenesis experiment (H), Transwell invasion experiment (I), scratch healing experiment (J) and TUNEL experiment (K) suggest that RASA1 can block the effect of miR-375 on angiogenesis, migration ability, proliferation and apoptosis of HUVECs (P < 0.01).

FIG. 10miR-375 activates the Ras/Erk signaling pathway in HUVECs; a: and detecting the expression condition of Ras/Erk signal channel related protein in HUVECs by using Western blot. B: mode diagram: CAFs release miR-375⁺Exosomes act on vascular endothelial cells, thereby promoting tumor angiogenesis and malignant progression of hepatocellular carcinoma.

The invention is completed based on the following experimental method; the samples and experimental procedures employed in the present invention are described below, and the following biological means or reagents, which are not provided in detail, are all achieved using techniques conventional in the art:

1. plasma specimens in the examples of the present invention were obtained from the third hospital affiliated with the university of Zhongshan and the Huashan hospital affiliated with the university of Fudan, respectively. Among them, the plasma-tissue matched clinical specimens were from hepatocellular carcinoma patients who were surgically excised between 2016 month 1 to 2018 month 9 and pathologically confirmed at the third hospital affiliated to Zhongshan university. After isolating 76 specimens of fresh hepatocellular carcinoma tissue (with care to avoid necrotic tissue) and corresponding Adjacent Nonneoplastic Liver Tissue (ANLTs) outside 1cm beside the carcinoma, a portion of the specimens was immediately stored in liquid nitrogen and then transferred to a-80 ℃ deep hypothermia refrigerator for storage. The other part was fixed in 10% formalin, paraffin-embedded, sectioned, and subjected to hematoxylin-eosin (HE) or immunohistochemical staining. All cases received no treatment including hepatic artery chemoembolization prior to surgery.

2. Normal hepatocytes (L02) and liver cancer cell lines (HepG2 and Huh7) were preserved by the liver disease laboratory of the third Hospital affiliated to Zhongshan university. Hepatoma cell lines (MHCC97-L, MHCC97-H and HCCLM3) were purchased from the liver cancer institute of the university of Zedan. All cell cultures were performed in a high-sugar DMEM (Dulbecco's modified Eagle's medium) containing 10% Fetal Bovine Serum (FBS) (GIBCO, USA) and maintained at a constant temperature of 37 ℃ and 5% CO (GiBCO, USA), unless otherwise specified₂Culturing in a cell culture box. All operations were performed in a clean bench. Then, the cells are frozen, recovered and subcultured.

3. The separation and culture method of CAFs in the embodiment of the invention is completed by the following steps that under the aseptic condition, 3-5g of fresh hepatocellular carcinoma tissue specimen cut by operation is preserved in Phosphate Buffered Saline (PBS) containing double antibody, marked and temporarily preserved in an ice box. Hepatocellular carcinoma tissue specimens were taken from the cancerous limbal region and tissue spared for hemorrhagic necrosis. And (3) washing the sample for several times by using PBS containing double antibodies, removing adipose tissues and blood on the sample as much as possible, and shearing non-liver cancer tissues adjacent to the sample and obvious vascular structures. Cutting the trimmed specimen into about 1mm³The tissue fragments are washed with PBS for 2 times (to remove calcium ions and magnesium ions in the tissue and the inhibition effect of blood on trypsin and Ethylene Diamine Tetraacetic Acid (EDTA)). The minced tissue pieces were put into 8-10ml of high-glucose DMEM (containing 5mg/ml collagenase type IV, 10% FBS) culture medium and the tissue was digested for 6 hours at 37 ℃ on a shaker. When the tissue mass appeared flocculent after shaking, it indicated complete digestion. Gently blow the digestive juice until the loose tissue mass dissipates. Washing with PBS solution for 2 times, resuspending with 10% FBS-containing high-sugar DMEM culture solution, filtering with 200 mesh filter screen, and adjusting cell density of the filtered cell suspension to 1.0 × 10⁶Perml, inoculated at 25cm²Placing in a culture flask at 37 deg.C and 5% CO₂Culturing in a cell culture box. And (5) transferring the cells into a culture bottle for 48 hours, then carrying out the cell liquid change for the 1 st time, and observing the cell adherence and growth conditions. Thereafter, the medium was changed 1 time every 2-3 days with high-glucose DMEM medium containing 10% FBS until the cells were completely fused.

4. Plasma specimens in the examples of the present invention were obtained from 140 hepatocellular carcinoma patients (confirmed by a combination of AFP, imaging, histopathology, and the like), 32 chronic hepatitis b patients, and 16 healthy blood donors, which were approved and approved by ethical committees of the third hospital affiliated to zhongshan university and the huashan hospital affiliated to the university of compound denier, and which were signed up for approval.

5. The extraction of the total RNA of the plasma exosome is completed according to the following steps: collecting plasma 200 μ l, diluting with PBS (total volume at least 1ml), and addingFiltration was performed with a 0.8 μm filter (Millipore, USA). The filtrate was collected and an equal amount of XBP buffer (QIAGEN, USA) was added and vortexed gently 5 times rapidly to mix well. The mixture was transferred to an exoEasy spin column (QIAGEN, USA) and centrifuged at 500g for 1 min. After discarding the centrifugate, 3.5ml XWP buffer (QIAGEN, USA) was added to the column and centrifuged at 5000g for 5 min. The column was placed in a fresh collection tube, and 700. mu.l of QIAzol (QIAGEN, USA) was added to the column, followed by centrifugation at 5000g for 5 min. The centrifugate was collected and transferred to 2ml centrifuge tubes without ribonuclease (RNase). The centrifugate was gently vortexed at room temperature (15-25 deg.C) for 5 min. 3.5. mu.l of mirneasysSerum/Plasma Spike-In Control working solution (1.0X 10)⁶Perml) (QIAGEN, USA) to the centrifugate, adding 90 μ l chloroform, shaking vigorously for 15sec, and incubating at room temperature (15-25 deg.C) for 2-3 min. Centrifuging at 12000g at 4 deg.C for 15min, sucking the upper water phase liquid, adding 2 times volume of anhydrous ethanol, and gently mixing up and down for several times. The mixture was then applied to an RNeasy MinElute spin column (QIAGEN, USA) and centrifuged at 8000g for 15sec at room temperature. To an RNeasy MinElute spin column, 700. mu.l of RWT buffer was added, and centrifuged at 8000g at room temperature for 15 sec. After discarding the centrifugate, 500. mu.l of RPE buffer was added, centrifuged at 8000g at room temperature for 15sec, and repeated once. The RNeasy MinElute spin column was placed in another 2ml centrifuge tube without RNase and centrifuged at full speed for 5min to remove the liquid. Finally, 14. mu.l of RNase-free water was added to the center of the RNeasy MinElute spin column and left for 1min, centrifuged at full speed for 1min and the RNA solution was collected.

RNA quantification and quality detection: mu.l of RNA sample was dropped on an ultramicro nucleic acid analyzer to determine OD value and concentration. The purity of the RNA sample is considered to be acceptable if the ratio of OD260/OD280 is between 1.8 and 2.1.

7. Reverse Transcription (RT) A20. mu.l Reverse Transcription reaction system (TIANGEN, China) was set up using the first strand synthesis kit for mirnacDNA from TIANGEN. Firstly, adding the following components into a microcentrifuge tube without RNase: total RNA, 8.0. mu.l; 2 x miRNA RT Reaction Buffer,10.0 μ l; miRNA RT Enztme Mix,2.0 μ l. The mixture was subjected to RT reaction on a PCR instrument (Applied Biosystems, USA) under the following conditions: 60min at 42 ℃ and 3min at 95 ℃. The cDNA product obtained after reverse transcription was stored at-20 ℃.

8. Fluorescent Real-time quantitative Real-time PCR reaction: hsa-miR-375 and U6 small nuclear RNA (snRNA) primers in fluorescent Real-time quantitative Real-time PCR were synthesized by Shanghai Jie Li Biotechnology Limited. The primers were designed as follows: the sequence of the upstream primer of hsa-miR-375 is as follows: 1 (5'-AGCCGTTTGTTCGTTCGGCT-3'), and the sequence of the downstream primer of hsa-miR-375 is as follows: 2 (5'-GTGCAGGGTCCGAGGT-3') SEQ ID NO; the upstream primer sequence of the U6snRNA primer is as follows: 3 (5'-CTCGCTTCGGCAGCACA-3'), and the downstream primer sequence of the U6snRNA primer is as follows: SEQ ID NO 4 (5'-AACGCTTCACGAATTTGCGT-3'). The primer nematode cel-miR-39 was purchased from QIAGEN. The primers are added with RNase-free water to prepare a stock solution with the concentration of 10 mu M for later use. According to the instruction of a TIANGEN company miRcute enhanced miRNA fluorescent quantitative detection kit (SYSB Green), a 20-mu-l reaction system is established: forward primer (10. mu.M), 0.4. mu.l; downstream primer (10. mu.M), 0.4. mu.l; cDNA template, 2. mu.l; 2 × miRcute Plus mirnaprep mix (SYBR)&ROX),10 μ l; RNase-free water, 7.2. mu.l. All the steps are carried out on ice. The Real-time PCR reaction process was carried out in a Light Cycler480(Roche, USA). The reaction conditions were set as follows: 15min at 95 ℃ for 1 cycle; 94 ℃ 20sec,63 ℃ 30sec,72 ℃ 34sec, 5 cycles; 94 ℃ 20sec,60 ℃ 34sec,40 cycles; and quantitative and melting curve analysis was performed. The Real-time PCR reaction was run and the analysis results were counted. Calculating the cycle threshold (Ct) values of hsa-miR-375 and U6snRNA or cel _ miR-39 respectively, taking the expression quantity of U6snRNA or cel _ miR-39 as an internal reference, and expressing the relative expression level of hsa-miR-375 as 2^-△CtWherein the relative expression level of miR-375in plasma exosomes- △ Ct ═ Ct_{(hsa-miR-375)}-Ct_{(cel_miR-39)}Relative expression level of miR-375in tissue or cell- △ Ct ═ Ct_{(hsa-miR-375)}-Ct_{(U6 snRNA)}。

9. Extraction of tissue and cellular proteins: taking 500 mu g of fresh tissue specimen, shearing into pieces by an ophthalmic scissors, putting into a precooled mortar (sterilized at high temperature of 180 ℃), pouring liquid nitrogen, grinding and crushing the tissue, and transferring the crushed tissue into a 1.5ml centrifuge tube; PBS was washed several times and minced with tissue scissors. Placing the tissue into a homogenizer, adding 1.5ml of radioimmunoprecipitation assay (RIPA) [ phosphatase inhibitor such as Phenylmethylsulfonylfluoride (PMSF) ], and grinding the tissue on ice to form a homogenate; extraction of relevant cell proteins: the culture medium in the cell culture flask was discarded, the cells were rinsed twice with ice-cold PBS, the PBS in the flask was aspirated off, and 0.5ml of 0.5MEDTA (GIBCO, USA) was added to promote cell shedding. Then scraping the cells by using a cell curette, transferring the cells and EDTA into a 1.5ml centrifuge tube, centrifuging for 3-5min at the normal temperature by 800g, and removing the supernatant; 1.0ml of RIPA lysate (Beyotime, China) (containing PMSF phosphatase inhibitor) was added. After vortex oscillation, cracking on ice for 30min (vortex oscillation is carried out once every 4-5 min), centrifuging at 4 deg.C for 15min at 12,000g, precipitating impurities such as uncleaved organelles at the bottom, collecting supernatant (avoiding lipid layer), collecting the supernatant as total tissue protein, packaging, and storing at-80 deg.C.

10. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and western immunoblotting: and (4) placing the glass plate into a glue making frame after aligning. According to the molecular weight of the target protein, preparing separation gel with different concentrations, pouring the gel on a plate, and adding 95% ethanol to the gel until the upper edge of the glass plate is pressed after the gel surface rises to the edge of the green band. Standing at room temperature for 30min, pouring off 95% ethanol after the separation gel is solidified, and drying with filter paper. Preparing 15% concentrated glue, filling with the concentrated glue, inserting a comb into the concentrated glue, and standing at room temperature for 30 min. After the concentrated gel is solidified, the glass plate with the gel is placed into an electrophoresis tank and clamped tightly. Pouring the 1 Xelectrophoresis solution into an electrophoresis tank (the electrophoresis solution should not cover the upper edge of the small glass plate), and then slightly and horizontally pulling out the comb; a certain amount of total protein sample is added into 5 xSDS sample buffer to make its final concentration 1 x, and heated at 100 deg.C for 10min to fully denature protein. And adding the protein sample into the hole, and adding 3-5 mul of protein Marker as a Marker according to actual needs. During electrophoresis, a constant current of 70mA × 10min was used to compress each well sample into a straight line, and then a constant voltage of 150V was used until bromophenol blue ran to the edge of the lower edge green line. During film transfer, a sponge pad, filter paper, gel, a polyvinylidene fluoride (PVDF) film with the thickness of 0.45 mu m, the filter paper and the sponge pad are sequentially placed in the direction from a negative electrode to a positive electrode, a1 multiplied film transfer liquid is poured into a tray, then a clamp is placed into the film transfer liquid, the clamp is opened, the sponge pad is firstly placed on a black surface, the filter paper and separation glue are sequentially placed on the sponge pad, then the PVDF film (the upper right corner of the film is pre-cut to serve as a mark, and the PVDF film is soaked in methanol for 5min) is laid on the separation glue (the bubbles contained in the PVDF film are removed), the filter paper and the sponge pad are sequentially laid on the PVDF film, and the clamp is closed to form a sandwich structure. The clips are placed into a film transferring groove (black frame to black frame, white frame to red frame), 1 x film transferring liquid is poured until the film transferring clips are immersed, ice blocks are placed around the electrophoresis groove, the pressure is constant at 100V, and the film transferring time is 90 min. After membrane washing, the PVDF membrane was placed in a blocking solution containing 5% skimmed milk powder and incubated for 1h at room temperature in a slow shaker. The membrane was cut according to the molecular weight of the protein, and the cut PVDF membrane was placed in the diluted primary antibody solution and incubated overnight in a shaker at 4 ℃. The membrane was washed 5min × 3 times. The PVDF membrane is put into a secondary antibody of the corresponding species, and incubated for 1h at room temperature in a slow shaker. The membrane was washed 5min × 3 times. Absorbing water with filter paper, soaking in the luminescent solution for 1min, and exposing in an automatic exposure machine.

11. Treatment of CAFs with lunvatinib: CAFs were first plated on 24-well plates, and when they grew to 80-90%, Ranatinib (Selleck, USA) was added to 10% FBS-containing DMEM medium to give final concentrations of 0.5. mu.M, 2.5. mu.M, 5.0. mu.M and 7.5. mu.M, respectively, while a control group was set up, and total cell protein was extracted after 48h of culture.

12. Inhibitor of miR-375 transfection (inhibitor): one day before transfection, CAFs cells were seeded in culture plates and 500. mu.l of antibiotic-free DMEM medium was added to each well to enable the cell density at transfection to reach 50%. Mu.l of liposome Lipofectamine2000 per well was diluted with 50. mu.l of Opti-MEM I Reduced Serum Medium, gently mixed and incubated at room temperature for 5 min. Mu.g of miR-375inhibitor was aspirated, diluted with 50. mu.l of Opti-MEM I Reduced SerumMedium, and gently mixed well. After incubation for 5min, the diluted Lipofectamine2000 is lightly mixed with the diluted miR-375inhibitor, and the mixture is kept stand for 20min at room temperature to form a miR-375 inhibitor-transfection reagent mixture. The miR-375 inhibitor-transfection reagent mixture was added to DMEM medium and the well plate was gently shaken to mix well. The culture is carried out in a cell culture box, and after 6 hours, the culture solution can be replaced by DMEM culture solution containing 10% FBS to continue the culture.

13. Extracting cell-derived exosomes: the research adopts a hunger method to extract cell-derived exosomes and is completed according to the following steps: selecting cells with good state after passage to 3-5 generations, and waiting for the cells to be at 75cm²When the growth area in the culture flask can cover 80% -90% of the bottom area of the flask, removing high-sugar DMEM culture solution originally containing 10% FBS, rinsing with PBS for 2-3 times, adding high-sugar DMEM culture solution [ primary cancer and cancer-collateral fibroblasts containing 0.2% FBS (exosome has been removed) ]]12-15ml, and collecting cell culture solution after 72 hours. The collected cell culture fluid was centrifuged through a series of centrifuges to remove cells and debris, and the centrifugation was performed sequentially at 4 ℃: 300g × 10min → 2000g × 20min → 10,000g × 30 min. The supernatant collected after centrifugation was filtered through a 0.22 μm filter, and the filtrate was transferred to a 100kDa MWCO Amicon 50ml ultrafiltration centrifuge tube (Millpore, USA), centrifuged at 4 ℃ for 1500 g.times.15 min, and the concentrate was collected. Mixing the concentrated solution with ExoQuick-TC (SBI, USA) at a ratio of 5:1, standing overnight (at least 12h) at 4 deg.C, centrifuging at 4 deg.C for 1500g × 30min the next day, discarding supernatant, and collecting white precipitate, i.e. exosome. The suspension was centrifuged again at 4 ℃ for 1500 g.times.5 min, the residual liquid carefully aspirated, and the exosome pellet was never suspended. The exosomes were resuspended in the appropriate amount of PBS (PH 7.4) (GIBCO, USA) and stored at-80 ℃ for use.

14. Statistical analysis method: statistical analysis was performed using IBM SPSS Statistics Version 20.0 and GraphPad Prism Version 6.0 statistical software. The measurement data is expressed by mean plus or minus standard deviation, and a paired sample or an independent sample is adopted for t test; subject working characteristic curves are plotted to calculate the area under the curves and to evaluate diagnostic efficacy. All tests were two-sided, with P <0.05 considered statistically significant.

With the above experimental method, specifically, the present invention obtains the following results:

1. the plasma exosome miR-375 is remarkably and highly expressed in hepatocellular carcinoma patients

Firstly, 106 hepatocellular carcinoma cases and 20 chronic hepatitis B cases in a training group are detected by adopting Real-time PCRThe expression conditions of miR-375in plasma exosomes of patients and 7 normal people take the expression quantity of nematode cel-miR-39 as an internal reference, and 2 cases of the normal people adopt^-△CtThe method calculates the relative expression level of miR-375in plasma exosomes. At the same time, a sample of a healthy person is selected as a control, and 2 is adopted^-△△CtThe method calculates the expression level of miR-375 of plasma exosomes of hepatocellular carcinoma and chronic liver disease patients relative to healthy people. The result indicates that the expression level of miR-375in the plasma exosome of the hepatocellular carcinoma patient is obviously higher than that of normal people and chronic liver disease patients (P)<0.05) as shown in fig. 1A-C.

The invention further analyzes the correlation between the expression level of the plasma exosome miR-375 and the clinical pathological characteristics of the liver cancer. The study shows that the high expression of miR-375in plasma exosomes of hepatocellular carcinoma patients is closely related to microvascular invasion and BCLC staging, but has no obvious correlation with liver cirrhosis, tumor size, tumor nodule number, envelope or pseudoenvelope and Edmendson-Steiner grading (Table 1).

In addition, the invention adopts Real-time PCR to detect the expression conditions of miR-375in plasma exosomes of 34 hepatocellular carcinoma cases, 12 chronic hepatitis B patients and 9 normal population cases in a verification group. The results also suggest that the expression level of miR-375in plasma exosomes of hepatocellular carcinoma patients is obviously higher than that of normal people and chronic liver disease patients (P <0.05), as shown in FIG. 2A. Further analysis shows that the high expression of plasma exosome miR-375 of hepatocellular carcinoma patients is closely related to BCLC staging and postoperative early relapse, as shown in FIGS. 2E-F.

TABLE 1106 relationship between expression level of plasma exosome miR-375 and clinical pathological features of hepatocellular carcinoma patients

2. Plasma exosome miR-375 helps to improve the capacity of clinically diagnosing hepatocellular carcinoma

In the training group, researchers plotted ROC curves of plasma exosome miR-375 alone, AFP alone and combination diagnosis of primary hepatocellular carcinoma according to miR-375(exo-miR-375) expression levels in 106 hepatocellular carcinoma patients, 20 chronic liver diseases and 7 normal human plasma exosomes, as shown in fig. 2C, and calculated areas under the curves, AUC (exo-miR-375) ═ 0.694, AUC (AFP) ═ 0.852 and AUC (combination) ═ 0.867, and it can be seen that the diagnosis efficiency of plasma exosomes was slightly inferior to that of AFP when diagnosed alone; when the AFP is combined with diagnosis, the area under the curve (AUC) reaches 0.867.

In addition, the invention calculates the cutoff value (cutoff value) by a Jodon index method, determines the cutoff value to be 11.06 (relative to healthy people, and divides hepatocellular carcinoma patients into miR-375 positive expression groups and miR-375 negative expression groups by taking the value as a boundary, also determines the cutoff value to be 20.0ng/ml according to the normal value range of clinical AFP, and divides the hepatocellular carcinoma patients into AFP positive expression groups and AFP negative expression groups by taking the value as a boundary, respectively calculates the plasma exosome miR-375 and AFP expression conditions in the hepatocellular carcinoma groups and chronic hepatitis B liver disease patients/healthy people groups, and then evaluates the efficiency of diagnosing the hepatocellular carcinoma, as shown in a figure 1D. the result shows that the diagnosis sensitivity of the plasma exosome miR-375 is slightly inferior to that of the AFP, on the basis, the plasma exosome miR-375 and AFP are jointly diagnosed, and the result shows that the sensitivity is greatly improved by parallel diagnosis, according to the invention, when the AFP diagnoses that a hepatocellular carcinoma patient is negative, the probability that the plasma exosome miR-375 is positive to the diagnosis is 55.2%, which shows that the plasma exosome miR-375 can remarkably improve the detection rate of the AFP negative hepatocellular carcinoma, as shown in figure 1E. The above results were also confirmed in the validation group, as shown in FIGS. 2A-D.

MiR-375 was selectively isolated into plasma exosomes of hepatocellular carcinoma patients

Then, the invention adopts a Real-time RCR method to detect the expression conditions of miR-375in cancer tissues of 76 cases of hepatocellular carcinoma patients and matched tissues beside the hepatocellular carcinoma. The results suggest that the expression level of miR-375in cancer tissues is significantly lower than that in paracancer tissues, as shown in FIG. 3A. According to the expression level of miR-375in cancer tissues, dividing hepatocellular carcinoma patients into a miR-375 high expression group and a miR-375 low expression group by taking the average expression value as a boundary. And (3) the expression level of miR-375 matched with the plasma exosome group of the hepatocellular carcinoma patient is combined. The result shows that hepatocellular carcinoma patients with high miR-375 expression in cancer tissues often show low plasma exosome miR-375 expression, as shown in figure 3B. By detecting the expression level of miR-375in main cells (liver cancer cells, CAFs and vascular endothelial cells) forming the primary tumor foci and exosomes derived from the cells, the result indicates that miR-375in exosomes tends to be derived from CAFs, and the mother cells pass through miR-375 by external throwing in the form of exosomes, so that the low expression of miR-375 per se is caused, as shown in FIG. 3C-D.

Finally, the invention adopts a Real-time RCR method to detect the expression levels of miR-375in three typical plasma exosomes, liver cancer tissues and ANLTs of hepatocellular carcinoma patients, aiming at further defining the diagnostic efficacy and confirming that miR-375 is specifically classified into the plasma exosomes, as shown in figures 4A-D.

CAFs by release of miR-375⁺Exosomes enhance their activation state

Subsequently, the present inventors further investigated the phenotype of CAFs after exosome release. The results suggest that the sphingomyelinase inhibitor GW4869(20 μ M) can significantly reduce the activation state of CAFs after inhibiting the release of CAFs-derived exosomes, as shown in FIGS. 5A-B. The miR-375inhibitor is specifically transfected into the CAFs, so that the activation state of the CAFs can be obviously enhanced, as shown in FIG. 5C. The results probably suggest that CAFs can release miR-375⁺The form of exosomes enhances their activation state.

5. Lunvatinib promoted CAFs-derived miR-375⁺Exosome release

Lovatinib, a newly approved multi-target kinase inhibitor for first-line treatment of advanced hepatocellular carcinoma by the Food and Drug Administration (FDA) and CFDA (China Food and Drug Administration, CFDA), inhibits vascular endothelial growth factor receptor 2(vascular endothelial

growth factor receptor

1,2,3, VEGFR-1,2,3), fibroblast

growth factor receptor

1,2,3,4(fibroblast

growth factor receptor

1,2,3,4, FGFR-1,2,3,4), platelet-derived growth factor receptor (PDGFR), RET and KIT. Researches show that gemcitabine can promote the up-regulation of miR-146a, snail expression level in CAF-derived exosome in pancreatic ductal adenocarcinoma^[10]. Based on the situation, the invention further discusses the CAFs-derived miR-375 by the Lovatinib⁺ExosomesResults show that the expression levels of Rab27a, sphingosine kinase 1(sphingosine kinase 1, sphk1) and α -SMA in CAFs can be obviously up-regulated, and a certain concentration-effect relationship is presented, as shown in FIG. 6A, more interestingly, after the CAFs are treated by the Rantinib, the miR-375 expression level in the exosomes from which the Rantinib is derived is obviously increased, as shown in FIG. 6B, results indicate that the Rantinib can promote miR-375 expression level⁺The release of exosomes enhances the activation state of CAFs. The plasma exosome miR-375 can be used as a marker for screening the population with the optimal benefit of the ranvatinib and a potential action target of combined treatment.

CAFs-derived exosome miR-375 has effect of promoting tumor angiogenesis

In order to clarify the effect of miR-375in CAFs-derived exosomes on tumor angiogenesis. The invention observes that CAFs-derived exosomes can transfer Cy 3-labeled miR-375 to HUVECs, so that the expression level of miR-375in the HUVECs is up-regulated, as shown in figure 7.

The invention further comprehensively analyzes the possible potential target point of miR-375 direct action by adopting bioinformatics software TargetScan and MiRanda, and the result shows that RASA1 can be used as a target gene of miR-375 to play a role. In order to confirm that RASA1 is a direct downstream target gene of miR-375, the invention constructs a dual-luciferase reporter gene system comprising a Wild type (Wild type, WT) and a Mutant type (Mutant, Mut)3 'UTR binding site region of RASA1 aiming at potential binding sites of miR-375 and RASA 1-3' UTR (untransfatedregion), and constructs corresponding luciferase reporter gene plasmids respectively. The results suggest that miR-375 inhibits expression of RASA1 by direct binding to the 3' UTR region of RASA1, as shown in fig. 8A. To verify whether miR-375 can inhibit expression of RASA1 at the protein level, we further verified changes in the protein level of RASA1 by western blot. Western blot results show that the protein expression level of RASA1 is obviously reduced in HUVECs which are over-expressed with miR-375 and co-cultured with CAFs-derived exosomes, as shown in FIGS. 8B-C.

As previous studies have demonstrated that RASA1 is a direct target gene for miR-375, for further R studyWhether ASA1 plays a key role in the process of regulating tumor angiogenesis by miR-375 and an action mechanism thereof. We constructed siRNA plasmid of RASA1 and transfected it into HUVECs as in fig. 9A. Meanwhile, we also constructed an overexpression lentivirus containing the full-length sequence of RASA1 and transfected the overexpression lentivirus into HUVECs (HUVECs) over-expressing miR-375^miR-375) In (1), HUVEC stably expressing RASA1 is established^miR-375. Next, we used angiogenesis, Transwell invasion, scratch healing, Cell counting kit-8(CCK-8) and terminal deoxynucleotidyl transferase mediated dUTP nick end labeling assay (TdT) -mediated dUTP nick end labeling, TUNEL) to detect angiogenesis, migration, and proliferation, apoptosis of HUVECs, respectively. Angiogenesis experiments confirmed that HUVEC^miR-375The angiogenesis ability of the siRNA plasmid was compared with that of HUVECs (HUVEC) transfected with siRNA plasmid^{RASA1 siRNA}) Similar to, and all compare with control group (transfection blank plasmid) HUVEC^vectorA significant enhancement, as in figure 9C, H. The HUVEC is proved by Transwell invasion and scratch healing experiments^miR-375Migration ability of (2) with HUVEC^{RASA1 siRNA}The cells are similar and are compared with the HUVEC of the control group^vectorThe enhancement was evident as in FIG. 9D-E, I-J. CCK-8 experiment proves that HUVEC^miR-375Proliferation of (2) with HUVEC^{RASA1 siRNA}Similar to and compared with HUVEC of a control group^vectorThe significant enhancement is shown in figure 9B, G. TUNEL experiments confirmed that HUVEC^miR-375The level of apoptosis is related to HUVEC^{RASA1 siRNA}The cells are similar and are compared with the HUVEC of the control group^vectorAnd significantly decreased, as in figure 9F, K. While HUVEC overexpressing RASA1^miR-375(HUVEC^{miR-375+RASA1}) The angiogenesis, migration ability, proliferation and apoptosis of the cells are recovered to HUVEC^vectorThe level of (c). The experimental result shows that miR-375 has a biological function of promoting tumor angiogenesis similar to RASA1 siRNA, and a anaplerosis experiment further proves that miR-375 plays a role in promoting HUVECs angiogenesis by targeted regulation of expression of RASA 1.

Subsequently, the invention further defines the action mechanism of miR-375in the process of regulating and controlling tumor angiogenesis, and by combining the existing results and the reports of related documents, the invention detects Ras/Erk signal pathway related protein in HUVEC. Results indicate that miR-375 can promote tumor angiogenesis by activating Ras/Erk signaling pathway in HUVEC, as shown in FIG. 10.

In a word, the CAFs-derived exosome miR-375 can activate a Ras/Erk signal channel in endothelial cells through targeted regulation and control of the expression of RASA1, so that the endothelial cytoskeleton is remodeled, the proliferation and migration capacity of the endothelial cells are enhanced, and the generation of tumor vessels is promoted. To some extent, miR-375in plasma exosomes may partially impair the therapeutic effect of ranvatinib. Thus, plasma exosome miR-375 is perhaps expected to be a biomarker effective for predicting therapeutic efficacy of ranvatinib.

The kit package in the present invention comprises: buffer XBP, Buffer XWP, QIAzol, miRNeasy Serum/Plasma Spike-In Control working solution, chloroform, absolute ethanol, RWT Buffer and RPE Buffer. And Real-time PCR primers for specifically detecting the expression level of miR-375in the plasma exosomes.

In the primer, the hsa-miR-375 primer sequence:

SEQ ID NO:1 AGCCGTTTGTTCGTTCGGCT

SEQ ID NO:2 GTGCAGGGTCCGAGGT

u6snRNA primer sequence:

SEQ ID NO:3 CTCGCTTCGGCAGCACA

SEQ ID NO:4 AACGCTTCACGAATTTGCGT

wherein the primer sequences of the human hsa-miR-375 are SEQ ID NO 1 and SEQ ID NO 2; the U6snRNA primer sequences are SEQ ID NO 3 and SEQ ID NO 4. The reagent for detecting the expression level of miR-375in the plasma exosome comprises: miRNA reverse transcription and fluorescence quantitative PCR detection reagent. Therefore, the plasma exosome miR-375 provided by the invention is used as a molecular marker in hepatocellular carcinoma diagnosis. By applying the technical scheme of the invention, the expression level of miR-375in the plasma exosome of the hepatocellular carcinoma patient is obviously higher than that of the normal population and the liver cirrhosis patient, and the diagnosis efficiency is better; hepatocellular carcinoma patients with high expression of plasma exosome miR-375 are closely related to microvascular invasion and poor clinical stages. The expression condition of miR-375in plasma exosomes of hepatocellular carcinoma patients can be detected by applying the kit, so that hepatocellular carcinoma can be effectively diagnosed. The plasma exosome miR-375 is used as a liquid biopsy marker for guiding accurate targeted therapy of hepatocellular carcinoma.

The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention, and various modifications and changes may be made by those skilled in the art. Any modification, equivalent replacement, or improvement made within the spirit and principle of the present invention should be included in the protection scope of the present invention.

Reference to the literature

1.Colombo M,Raposo G,Thery C.Biogenesis,secretion,and intercellularinteractions of exosomes and other extracellular vesicles.Annu Rev Cell DevBiol,2014,30:255-289.

2.Tanaka Y,Kamohara H,Kinoshita K,et al.Clinical impact of serumexosomal microRNA-21 as a clinical biomarker in human esophageal squamouscell carcinoma.Cancer,2013,119:1159–1167.

3.Wang H,Hou L,Li A,et al.Expression of serum exosomal microRNA-21 inhuman hepatocellular carcinoma.Biomed Res Int.2014,2014:864-894.

4.Sun J,Aswath K,Schroeder SG,et al.MicroRNA expression profiles ofbovine milk exosomes in response to Staphylococcus aureus infection.BMCGenom.2015,16:806.

5.Machida T,Tomofuji T,Maruyama T,et al.miR1246 and miR4644 insalivary exosome as potential biomarkers for pancreatobiliary tractcancer.Oncol Rep.2016,36:2375–2381.

6.Hoshino A,Costa-Silva B,Shen TL,et al.Tumour exosome integrinsdetermine organotropic metastasis.Nature,2015,527:329-335.

7.Costa-Silva B,Aiello NM,Ocean AJ,et al.Pancreatic cancer exosomesinitiate pre-metastatic niche formation in the liver.Nat Cell Biol,2015,17:816-826.

8.Liao J,Liu R,Shi YJ,et al.Exosome-shuttling microRNA-21promotescell migration and invasion-targeting PDCD4 in esophageal cancer.Int J Oncol,2016,48:2567–2579.

9.Chen G,Huang AC,Zhang W,et al.Exosomal PD-L1 contributes toimmunosuppression and is associated with anti-PD-1 response.Nature,2018,560:382-386.

10.Richards KE,Zeleniak AE,Fishel ML,et al.Cancer-associatedfibroblast exosomes regulate survival and proliferation of pancreatic cancercells.Oncogene,2017,36:1770-1778.

Claims

1. The application of the miR-375 expression level in plasma exosomes of a hepatocellular carcinoma patient in guiding accurate targeted therapy of hepatocellular carcinoma is characterized by comprising the application of detecting the miR-375 expression level in plasma exosomes of the hepatocellular carcinoma patient in guiding accurate targeted therapy of hepatocellular carcinoma.

2. The use of claim 1 for the guidance of accurate treatment of hepatocellular carcinoma wherein the expression level of alpha-fetoprotein α -fetoprotein, AFP, in plasma is measured and the expression level of miR-375in plasma exosomes is used in combination with the expression level of alpha-fetoprotein α -fetoprotein, AFP, in plasma.

3. A kit for diagnosing hepatocellular carcinoma is characterized in that the kit is used for detecting the expression level of miR-375in plasma exosomes.

4. The kit for hepatocellular carcinoma diagnosis according to claim 3, characterized in that said plasma exosomes miR-375 is used as a biomarker for predicting the effect of the treatment with Ranvatinib.

5. The kit for hepatocellular carcinoma diagnosis as claimed in claim 3, wherein said kit is further used for detecting the expression level of alpha-fetoprotein α -fetoprotein AFP in plasma, and the expression level of miR-375in said plasma exosome is used in combination with the expression level of alpha-fetoprotein α -fetoprotein AFP in plasma for the design of kit.

6. The kit for hepatocellular carcinoma diagnosis according to claim 3,4 or 5, wherein the reagent components of the kit for hepatocellular carcinoma diagnosis comprise:

a reagent for extracting plasma exosomes of normal people, chronic hepatitis B patients and hepatocellular carcinoma patients,

a reagent for first strand cDNA synthesis of miRNA reverse transcription,

a reagent for miRNA fluorescent quantitative PCR detection,

upper and lower primers of human hsa-miR-375,

and reagents for diluting plasma and primers.

7. The kit for hepatocellular carcinoma diagnosis In accordance with claim 6, wherein the reagents for extracting Plasma exosomes of normal human, chronic hepatitis B patient and hepatocellular carcinoma patient include Buffer XBP, Buffer XWP, QIAzol, miRNeasy Serum/Plasma Spike-In Control working solution, chloroform, absolute ethanol, RWT Buffer and RPE Buffer.

8. The kit for hepatocellular carcinoma diagnosis as claimed in claim 6, wherein the reagent for cDNA first strand synthesis for miRNA reverse transcription comprises 2 x miRNA RT Reaction Buffer, miRNA RT Enzyme Mix and RNase-Free ddH₂O。

9. The kit for hepatocellular carcinoma diagnosis as claimed in claim 6, wherein the reagent for miRNA fluorescent quantitative PCR detection comprises 2 x mix Plus miRNA Premix (SYBR)&ROX) and RNase-Free ddH₂O; the reagent for diluting plasma and primer comprises PBS and RNase-Free ddH₂O。

10. The kit for hepatocellular carcinoma diagnosis according to claim 3, characterized in that the expression level of miR-375in said plasma exosomes: the cutoff value calculated by the Johnson index method for plasma exosome miR-375 of hepatocellular carcinoma patients is 11.06.