CN113337519B

CN113337519B - Application of different copies of BrMYC2/3/4 gene in plant growth

Info

Publication number: CN113337519B
Application number: CN202110616932.9A
Authority: CN
Inventors: 臧运祥; 滕芝妍
Original assignee: Zhejiang A&F University ZAFU
Current assignee: Zhejiang A&F University ZAFU
Priority date: 2021-06-03
Filing date: 2021-06-03
Publication date: 2022-04-05
Anticipated expiration: 2041-06-03
Also published as: CN114480424B; CN114517201A; CN114480425A; CN114480425B; CN114410655B; CN113337519A; CN114517200A; CN114410656A; CN114517200B; CN114410655A; CN114438098B; CN114517201B; CN114480423A; CN114438098A; CN114480424A; CN114480423B; CN114410654B; CN114410654A; CN114410656B

Abstract

The invention discloses application of different copies of a BrMYC2/3/4 gene in plant growth, wherein the BrMYC2 and BrMYC4-1 are applied to promoting plants to bloom in advance, increasing the yield of plant seeds and improving the resistance to fungal pathogens; application of BrMYC3-1 in promoting plant to bloom in advance and improving resistance to fungal pathogens; application of BrMYC3-2 in promoting plant to delay flowering, increasing plant seed yield, and improving resistance to fungal pathogens; use of BrMYC4-2 for delaying flowering in a plant and increasing resistance to a fungal pathogen. The invention provides a new gene resource for the improvement and breeding of the Chinese cabbage, thereby promoting the breeding process of the Chinese cabbage.

Description

Application of different copies of BrMYC2/3/4 gene in plant growth

Technical Field

The invention relates to the technical field of plant genetic engineering, in particular to application of different copies of a BrMYC2/3/4 gene in plant growth.

Background

Leaf vegetables of Brassica (Brassica) of Brassica of Brassicaceae (Brassica rapa ssp.) also called as 'head-forming Chinese cabbage' and 'yellow bud vegetable', originally produced in North China, have a long cultivation history, are widely cultivated in various places at present, and are the leaf vegetables with the largest cultivation area of Brassica of Brassica. The Chinese cabbage is not only various in variety, but also has the characteristics of low temperature resistance, crisp and tender mouthfeel and the like, and also contains rich mineral substances, carotenoid and glucosinolate. Cabbage contains rich glucosinolates, and the special flavor of cabbage, and the disease and pest resistance, cancer prevention, cancer resistance and oxidation resistance of important secondary metabolites, namely glucosinolates and hydrolysates thereof, attract the attention of researchers in various subjects such as botany, medicine, biology, food and the like.

MYC2/3/4 transcription factor as an important member in bHLH IIIe family plays an important role in jasmonic acid-mediated biological metabolism regulation and control activity, and the study on the function of MYC2/3/4 transcription factor mainly comprises model plant Arabidopsis. Although Chinese cabbage and Arabidopsis have a common ancestor, due to the complexity of the heterotrimeric genome, the application of the defense function of glucosinolate in Chinese cabbage is influenced to a certain extent, and it is necessary to understand the functional differentiation of BrMYC2/3/4 in plant growth and development and indole glucosinolate metabolism.

Disclosure of Invention

The invention aims to provide application of different copies of a BrMYC2/3/4 gene in plant growth so as to overcome the defects of the prior art.

The invention adopts the following technical scheme:

application of different copies of the BrMYC2/3/4 gene in plant growth: application of BrMYC2 and BrMYC4-1 in promoting plants to bloom in advance, increasing plant seed yield and improving resistance to fungal pathogens; application of BrMYC3-1 in promoting plant to bloom in advance and improving resistance to fungal pathogens; application of BrMYC3-2 in promoting plant to delay flowering, increasing plant seed yield, and improving resistance to fungal pathogens; use of BrMYC4-2 for delaying flowering in a plant and increasing resistance to a fungal pathogen.

Further, the plant is arabidopsis thaliana.

Further, the fungal pathogen is sclerotinia sclerotiorum.

The invention has the beneficial effects that:

the invention finds different applications of different copies of the BrMYC2/3/4 gene in plant growth, and the BrMYC2 and BrMYC4-1 can be applied to promoting plants to bloom in advance, increasing the yield of plant seeds and improving the resistance to fungal pathogens; BrMYC3-1 can be used for promoting plants to bloom in advance and improving resistance to fungal pathogens; BrMYC3-2 can be used for delaying flowering of plants, increasing seed yield of plants and improving resistance to fungal pathogens; BrMYC4-2 can be used for delaying flowering of plants and improving resistance to fungal pathogens.

The invention provides a new gene resource for the improvement and breeding of the Chinese cabbage, thereby promoting the breeding process of the Chinese cabbage.

Drawings

FIG. 1 shows the construction process of the plant expression vector pCAMBIA 2302.

FIG. 2 shows the results of the amplification sequencing alignment of plant expression vector pCAMBIA2301 vector nptII; (A) the pCAMBIA2301 vector nptII amplification sequencing DNA comparison result; (B) the pCAMBIA2301 vector nptII amplification sequencing amino acid alignment results.

FIG. 3 is the restriction enzyme digestion assay of the plant expression vector pCAMBIA 2302; abbreviations: lane M, DNA marker; lane H, ddH₂O。

FIG. 4 shows the sequencing alignment of the plasmid of the plant expression vector pCAMBIA 2302.

FIG. 5 shows the bands of Chinese cabbage total RNA electrophoresis.

FIG. 6 is the analysis of the PCR electrophoresis result of the overexpression vector; (A) a p2302MYC4-1 overexpression vector; (B) the overexpression vectors from left to right are: p2302MYC3-2, p2302MYC4-2, p2302MYC3-1, p2302MYC 2; abbreviations: lane M, DNA marker; lane H, ddH₂O。

FIG. 7 shows the sequencing comparison of PCR products of Escherichia coli transformed with p2302MYC2/3/4 overexpression vector.

FIG. 8 is T₃Seed growth indexes of the generation BrMYC2/3/4 transgenic Arabidopsis lines; (A) phenotype of mature seed; (B) phenotype of dissected mature siliques; (C) comparing the lengths of the seeds; (D) comparing the seed widths; (E) comparing thousand grain weight; (F) comparing the number of seeds of each silique; the tested transgenic lines are Ctrl and BrMYC2 respectively^OE、BrMYC3-1^OE、BrMYC3-2^OE、BrMYC4-1^OE、BrMYC4-2^OE(ii) a Randomly selecting seeds and siliques with healthy and more consistent growth states of all genotypes, and taking pictures under the same conditions; data are shown as mean ± SD from three independent biological replicates; statistical analysis using analysis of variance followed by Tukey's multiple comparison test (p)<0.05); scale bar 500 μm.

FIG. 9 is T₃Total and thousand kernel weights of individual seeds of the generation BrMYC2/3/4 transgenic Arabidopsis line.

FIG. 10 is T₃Root and hypocotyl length of the generation BrMYC2/3/4 transgenic Arabidopsis line; (A) phenotype of 6-day-old seedlings; (B) comparing root lengths; (C) comparing the length of hypocotyls; the transgenic lines are Ctrl and BrMYC2 respectively^OE、BrMYC3-1^OE、BrMYC3-2^OE、BrMYC4-1^OE、BrMYC4-2^OE(ii) a Data are shown as mean ± SD from three independent biological replicates; statistical analysis using analysis of variance followed by Tukey's multiple comparison test (p)<0.05); scale bar 1 cm.

FIG. 11 is T₃The transformation time difference of the generation BrMYC2/3/4 transgenic Arabidopsis strains in the nutrition phase; (A) a 28-day old transgenic arabidopsis phenotype; (B) leaf phenotype, number shows the first rosette leaf site with epidermal hair present; (C) the leaf growth rate of transgenic arabidopsis thaliana in a short time; counting the

leaf number

12, 16, 20, 24 and 28 days after planting; the transgenic lines are Ctrl and BrMYC2 respectively^OE、BrMYC3-1^OE、BrMYC3-2^OE、BrMYC4-1^OE、BrMYC4-2^OE(ii) a Data are shown as mean ± SD from three independent biological replicates; using analysis of varianceStatistical analysis followed by Tukey's multiple comparison test (p)<0.05); scale bar 1 cm.

FIG. 12 is T₃Plant height and flowering time of a generation BrMYC2/3/4 transgenic Arabidopsis line; (A) phenotype of 3-week old arabidopsis; (B) bolting time; (C) the number of rosette leaves during bolting; (D) phenotype of 7-week old arabidopsis; (E) plant height; (F) the number of branches is increased; the transgenic lines are Ctrl and BrMYC2 respectively^OE、BrMYC3-1^OE、BrMYC3-2^OE、BrMYC4-1^OE、BrMYC4-2^OE(ii) a Data are shown as mean ± SD from three independent biological replicates; statistical analysis using analysis of variance followed by Tukey's multiple comparison test (p)<0.05); scale bar 1 cm.

FIG. 13 is T₃Inhibition of the growth of sclerotinia on PDA by freeze-dried powder of rosette leaves of a generation BrMYC2/3/4 transgenic arabidopsis strain; from left to right are: ddH₂O，Ctrl、BrMYC2^OE、BrMYC3-1^OE、BrMYC3-2^OE、BrMYC4-1^OE、BrMYC4-2^OE(ii) a Placing a sclerotinia sclerotiorum in the center of each culture dish; sclerotinia sclerotiorum mycelium is white cotton-shaped mycelium plaque; scale bar 1 cm.

Detailed Description

The invention is explained in more detail below with reference to exemplary embodiments and the accompanying drawings. The following examples are provided only for illustrating the present invention and are not intended to limit the scope of the present invention.

Construction of 1 BrMYC2/3/4 overexpression vector

1.1 test materials

1.1.1 plant Material

The Chinese cabbage used in the research is 'Chiifu' (the important laboratory strain of agricultural product quality improvement technology research in Zhejiang province, namely the laboratory strain). Plants were planted in the laboratory light culture room under the conditions of light intensity of 600. mu. mol. m^-2·s^-1The photoperiod is 16h of illumination/8 h of darkness, the humidity is 65 percent, and the temperature is 16h, 28 ℃/8h and 20 ℃.

1.1.2 vectors and strains

The plasmid vectors used in this study were pCAMBIA2301, pCAMBIA1302 and pCAMBIA 2302. Wherein the plasmids pCAMBIA2301 and pCAMBIA1302 are vectors for constructing pCAMBIA2302, and are stored in the laboratory.

Sclerotinia Sclerotiorum (Sclerotiorum) strains are presented by the Shihaojie teachers at the college of agriculture and food science of agriculture and forestry university at Zhejiang.

1.1.3 preparation of solution and culture Medium

CTAB extracting solution: weighing CTAB 20g (2% W/V), PVP 4020 g (2% W/V), NaCl 55.84g (58.44 g. mol)^-1) 100mL of 1M Tris-HCl (pH 8.0), 40mL of 0.5M EDTA (pH 8.0), and a volume of 1L of distilled water. When in use, 1 mu L of beta-mercaptoethanol is added into each 1mL of extracting solution.

1L 1M Tris-HCl (pH 8.0): 121.1g Tris was weighed into a 1L beaker, and about 800mL deionized water was added and stirred well. After dissolving, adding a proper amount of HCL to the required pH value, and fixing the volume to 1L.

100mL of 0.5M EDTA (pH 8.0): 18.612g of EDTA was weighed, dissolved in deionized water, and NaOH pellets (about 2.0g) were added while dissolving, and after complete dissolution, the volume was adjusted to 100mL, and the pH was adjusted to 8.0.

100mL 50mg·mL^-1Kanamycin (Kanamycin, kana): weighing 5g of Kana and dissolving in 100mL of ddH₂And O, filtering and sterilizing after complete dissolution, and subpackaging and storing at-20 ℃.

20mL 50mg·mL^-1Gentamicin (Gentamicin, Gen): weigh 1g Gen in 20mL ddH₂And O, filtering and sterilizing after complete dissolution, and subpackaging and storing at-20 ℃.

20mL 50mg·mL^-1Rifampin (Rifampicin, Rif): weighing 1g of Rif, dissolving in 20mL of DMSO, filtering and sterilizing after complete dissolution, and subpackaging and storing at-20 ℃.

LB solid medium: peptone (Tryptone)10 g.L^-1，NaCl 10g·L^-1Yeast extract (Yeast extract)5 g.L^-1Agar 8 g. L^-1Sterilizing with high pressure steam at 121 deg.C for 20min and pH 7.0.

LB liquid medium: 10 g.L of Tryptone^-1，NaCl 10g·L^-1，Yeast extract 5g·L^-1Sterilizing with high pressure steam at 121 deg.C for 20min and pH 7.0.

1L of 1 XTAE electrophoresis solution: 242g Tris Base, 372g EDTA, 57.1mL glacial acetic acid were weighed and diluted 50 times to 1L volume for use.

20mL agarose electrophoresis gel: 0.24G of Agarose G-50 was weighed into 20mL of 1 XTAE, and 1. mu.l of Gelstain dye was added after the mixture was boiled in a microwave oven at a high temperature and cooled to a temperature at which the hands were not scalded.

1.1.4 primer Synthesis and sequencing analysis

Primer synthesis and sequencing analysis were performed by Zhejiang Youkang Biotechnology Ltd.

1.1.5 software and data analysis

Primer design software is Primer 5.0; the sequence analysis software comprises DNAMAN 6.0 and SnapGene v5.0.5; the picture processing software is Photoshop CS6 and Power Point 2019.

1.2 test methods

1.2.1 acquisition of BrMYC2/3/4 Gene sequence and its coding sequence

BrMYC3-1 and BrMYC3-2, and BrMYC4-1 and BrMYC4-2 are BrMYC2 paralogous genes. The gene numbers of BrMYC2/3/4 BraA05g023030.3C (BrMYC2), BraA09g022310.3C (BrMYC3-1), BraA06g041690.3C (BrMYC3-2), BraA01g009460.3C (BrMYC4-1), Bra01g009470.3C (BrMYC4-2) and Bra08g000150.3C (BrMYC4-3) were obtained from the Brassica database of nanoparticles and nanoparticles (http:// fibrous db. cn// nanoparticles /). The coding sequence was obtained from the Brassica database gene sequence (http:// fibrous db. cn/#/GeneSequence /) database.

1.2.2 reconstitution of pCAMBIA2302 vector

Plasmids of pCAMBIA2301 and PCAMBIA1302 were extracted, respectively. By using

The pCAMBIA2301 plasmid npt II gene is amplified by HS DNA Polymerase v 201; the amplification primer of the npt II gene is p2301 npt II RC-f: TACAAATCTATCTCTCTCGAGATGGGGATTGAACAAGATG, respectively; p2301 npt II RC-r: ATTATTATGGAGAAACTCGAGCTTGTCGATCGACTCTAGC (Tm: 47 ℃ C.). The PCR reaction procedure is as follows: 30cycles of 10s at 98 ℃, 5s at 47 ℃ and 1min at 72 ℃. The pCAMBIA1302 plasmid was digested with XhoI to obtain a linearized cloning vector. Insert amplification product and linearized cloning vectormu.L of each was run on Agarose Gel electrophoresis to check for amplification yield and specificity, and if the PCR product band was single and correct in size, Gel recovery was performed according to the method provided by TaKaRa MiniBEST Agarose Gel DNA Extraction Kit Ver.4.0: the agarose gel containing the insert amplification product and the linearized cloning vector was cut under an ultraviolet lamp into a 1.5mL centrifuge tube, 4 volumes of Buffer GM were added, and after uniform mixing, the centrifuge tube was placed in a 37 ℃ metal bath to fully dissolve the gel block. Transferring the solution to Spin Column, centrifuging for 1min at 12,000pm, and discarding the filtrate; this step was repeated 2 times to increase the DNA recovery. Add 700. mu.L of DNA Buffer WB, centrifuge at 12,000pm for 30s at room temperature, discard the filtrate, and repeat this step once. The mixture was isolated for 2min, Spin Column was transferred to a new 1.5mL centrifuge tube, and 30. mu.L ddH was added₂0, standing at room temperature for 2min, and centrifuging at 12,000pm for 1min to obtain purified product (which can be stored at-20 deg.C).

Then adopt

II One Step Cloning Kit was used to perform homologous recombination to construct the plant expression vector pCAMBIA2302 (FIG. 1). The recombinant product was transformed into DH 5. alpha. by the following method: mu.L of the cooled reaction solution was added to 50. mu.L of the competent cells thawed on ice, gently flicked off the tube wall, and mixed well, and allowed to stand on ice for 30 min. The heat was applied to the metal bath at 42 ℃ for 45s and quickly transferred to an ice water bath for incubation for 2 min. 1mL of liquid LB medium containing no antibiotic was added to the centrifuge tube and thawed at 37 ℃ at 200rpm for 60 min. Applying 100 μ L resuscitation solution on the affected part containing 50 mg/L^-1Kana was cultured in an inverted medium at 37 ℃ for 12 hours in LB solid medium. Several single colonies on the recombinant product transformation plate are picked and cultured in LB liquid medium containing kana with the same concentration overnight for colony PCR identification. Identification of pCAMBIA2302 was performed by amplifying the npt II gene, sequencing and colony PCR primers p2302 npt II-f: CTTCGCAAGACCTTCCTCTA, respectively; p2302 npt II-r; CTGGGAACTACTCACACATT (Tm is 50 ℃ C.). The PCR reaction procedure is as follows: 3min at 94 ℃; 35cycles of 94 ℃ for 3min, 50 ℃ for 30s and 72 ℃ for 1 min; 10min at 72 ℃. Blank control (without template DNA) was also included. Selecting the colony identified as positive by PCR, and carrying out first-generation sequencing on the bacterial liquid. SequencingAfter error-free, the plasmid pCAMBIA2302 was introduced into GV3101 competent cells by freeze-thaw method, and the specific transformation procedure was as follows:

(1) the GV3101 Agrobacterium strain preserved at-80 deg.C is naturally thawed on ice.

(2) Add 1. mu.g recombinant plasmid DNA (preferably, the volume should not exceed 10. mu.L) per 100. mu.L competence, flick the tube wall, and stand on ice for 5min, liquid nitrogen for 5min, water bath at 37 deg.C for 5min, and ice bath for 5 min.

(4) 1mL of liquid LB medium without antibiotics was added and shaking cultured on a shaker at 28 ℃ and 200rpm for 3 h.

(5) The cells were collected by centrifugation at 6000rpm for 1min, and 100. mu.L of the supernatant was collected and gently pipetted using a pipette gun to resuspend the pellet. It was spread on an LB plate containing kana and placed upside down in an incubator at 28 ℃ for 48 hours.

(6) Single colony was picked and inoculated in liquid LB medium (50 mg. L)^-1Gen、50mg·L^-1Rif and 50 mg.L^-1Kana), culturing at 28 ℃ and 200rpm for 48h in a shaking way, applying the bacterial liquid to PCR identification of the bacterial liquid, and storing the bacterial strain with a positive result at-20 ℃. Randomly picked 1 transformed single colony for plasmid sequencing analysis.

1.2.3 cloning of the coding region of the BrMYC2/3/4 transcription factor

1.2.3.1 Chinese cabbage Total RNA extraction and cDNA Synthesis

Selecting a 'Chiifu' wild type Chinese cabbage seedling with good growth state, and selecting a fifth functional leaf (the fifth functional leaf counted from the top to the bottom) of each plant to be used as an RNA extraction material when the seedling grows to a five-leaf one-heart stage. A Trizol method is adopted to extract plant genome RNA, and the specific method is as follows:

(1) test materials were prepared. Wrapping mortar, grinding rod, spoon, etc. with tinfoil paper, sterilizing at high temperature, and oven drying at 180 deg.C for 12 hr; treating the large, medium and small gun heads and a 2mL centrifugal tube by DEPC water at 72 ℃ for overnight drying; 75% ethanol was made up with DEPC deionized water, pre-chilled chloroform, isopropanol and Total RNA Extractor.

(2) 100mg of fresh sample was ground thoroughly in liquid nitrogen and ground at least three times with liquid nitrogen to ensure leaf cell disruption. Adding a proper amount of Total RNA Extractor, homogenizing in a 2mL centrifuge tube, standing the homogenate at room temperature for 5min, and centrifuging at 12,000rpm at 4 ℃ for 5min to completely separate the nucleoprotein and the nucleic acid.

(3) The supernatant was transferred to a new 2mL centrifuge tube. 0.2mL of chloroform was added, vortexed for 15s, and allowed to stand at room temperature for 3 min. Centrifuge at 12,000rpm for 10min at 4 ℃.

(4) Absorbing the upper water phase, transferring to a clean centrifuge tube, adding isopropanol with the same volume, mixing uniformly, and standing at room temperature for 20 min.

(5) Centrifuged at 12,000rpm at 4 ℃ for 10min, and the supernatant was discarded.

(6) The precipitate was washed by adding 1mL of 75% ethanol in DEPC treated water. Centrifuge at 12,000rpm for 3min at 4 ℃ and discard the supernatant. Drying at room temperature for 5 min.

(7) Adding 30 μ L of RNase-free ddH₂O, fully dissolving RNA. Detecting the concentration and purity of RNA, wherein the ratio of RNA purity A260/A280 is in the range of 1.8-2.1. Then 2. mu.L of the suspension was subjected to agarose gel electrophoresis. After detection, the obtained RNA solution is stored at-80 ℃ or used for subsequent tests. DNA digestion and cDNA Synthesis Using PrimeScript^TMII 1st Strand cDNA Synthesis Kit, the reverse transcription reaction system is shown in Table 1:

TABLE 1 reverse transcription reaction System

After mixing uniformly with a pipette tip, the mixture was incubated at 65 ℃ for 5min, cooled on ice for 2min, and then the reaction mixture was used to prepare the following mixture (Table 2).

TABLE 2

The samples were mixed slowly and uniformly with a pipette gun for PCR reverse transcription.

The PCR reaction procedure is as follows: 60min at 45 ℃ and 5min at 95 ℃. After the reaction is finished, the reaction product is immediately placed on ice for cooling, and a product obtained by RT-PCR amplification is stored at the temperature of-20 ℃ or is used for subsequent tests.

1.2.3.2 Chinese cabbage DNA extraction

The CTAB method is adopted to extract plant genome DNA, and the selection of DNA extraction materials is 1.2.3.1. The specific method comprises the following steps:

(1) after washing and airing the leaves, 0.2g of the leaves are put into a 1.5mL centrifuge tube, ground by liquid nitrogen, added with 700 μ L of 2% CTAB preheated at 65 ℃ and mixed evenly, and then put into a water bath at 65 ℃ for 1h, and gently shaken once every 10 min.

(2) Taking out the centrifuge tube, cooling to room temperature, adding 650 μ L of 24:1 chloroform-isoamyl alcohol solution, reversing, mixing, and standing for 10 min.

(3)13000rpm for 10min, taking supernatant, adding 550 μ L of 24:1 chloroform-isoamyl alcohol solution, reversing, mixing evenly, and standing for 10 min.

(4)13000rpm for 10min, and the supernatant was added to 400. mu.L of isopropanol in ice bath and stored at-20 ℃ for 20 min.

(5)13000rpm for 10min, discarding the supernatant, adding 500 μ L80% ethanol to the rest precipitate, washing twice (sucking, mixing evenly), and drying with a super clean bench.

(6) Before use, 30. mu.L ddH was added to the dried precipitate₂Dissolving O, standing at room temperature for 5min, sucking with pipette, mixing, and standing for 5 min.

(7) Sucking 1.5 mul for detecting DNA concentration and purity, and taking 2 mul for agarose gel electrophoresis detection. After the detection, the obtained DNA solution was stored at-20 ℃ for subsequent tests.

1.2.3.3 primer design and Synthesis

Primer Primer 5.0 was used for Primer design. Finally, the primer was synthesized by Zhejiang Youkang Biotechnology GmbH. Primer design is shown in table 3.

TABLE 3 Gene cloning primer design

1.2.3.4 insert PCR amplification and linearized vector acquisition

Plant genome DNA or cDNA obtained by reverse transcription is taken as an amplification template, the inserted segment is amplified by using high-fidelity KOD enzyme, and a PCR amplification reaction system is shown in Table 4:

TABLE 4 PCR amplification reaction System

The PCR program was set as follows: 3min at 94 ℃; 40cycles of 98 ℃ for 10s, 52 ℃ for 30s and 68 ℃ for 2 min; 10min at 68 ℃. The PCAMBIA2302 plasmid was digested with NcoI to obtain a linearized cloning vector. The amplified product of the insert fragment and the linearized cloning vector were subjected to Agarose Gel electrophoresis to check the amplification yield and specificity, and if the PCR product electrophoresis band was single and correct in size, Gel recovery was performed according to the method provided by TaKaRa MiniBEST Agarose Gel DNA Extraction Kit Ver.4.0.

1.2.4 construction of p2302MYC overexpression vector

Overexpression vectors employing

II One Step Cloning Kit homologous recombination method, the reaction system is shown in Table 5:

TABLE 5 homologous recombination System

After the system is prepared, the components are sucked, beaten and mixed uniformly. After 30min of reaction at 37 ℃, the reaction tube was immediately placed in an ice bath to cool for 5 min. Each 20. mu.L of the gene-cooled reaction solution was transformed into an appropriate amount of DH 5. alpha. by heat shock. Culturing at 37 ℃ overnight, picking positive clone to carry out colony PCR verification and agarose gel electrophoresis detection.

The verification primer is p2302 MYC-f: TCCCACTATCCTTCGCAAGA, respectively; p2302 MYC-r: GAATTGGGACAACTCCAGTG (Tm 52 ℃). And performing first-generation sequencing on the PCR product, and if the sequencing result is correct, extracting the gene over-expression vector plasmid for transforming the GV3101 competence by a freeze-thaw method.

1.3 results and analysis

1.3.1 construction and identification of pCAMBIA2302 plant expression vectors

The sequence analysis result of the amplified pCAMBIA2301 npt II gene is shown in FIG. 2. After homologous recombination, the product of the E.coli transformation with the plasmid pCAMBIA2302 was detected by digestion, with bands 1-13 being 13 single colonies picked at random, with a 982bp fragment cut off at the time of digestion, while ddH was added to the control (lane H)₂And O. The gel electrophoresis results were in agreement with expectations (fig. 3). The plasmid pCMABIA2302 is transformed into Agrobacterium, single clone activation is picked, and the results of plasmid sequencing alignment are shown in FIG. 4. The successful construction of the pCAMBIA2302 plant expression vector is demonstrated, the GUS gene of the vector is successfully replaced by the GDP gene, and the T-DNA segment contains only the npt II gene.

1.3.2 Chinese cabbage target Gene acquisition and target Gene amplification

The RNA of the Chinese cabbage extracted by the Trizol method is immediately subjected to agarose gel electrophoresis detection, three bands appear in the detection result, namely 5s, 18s and 28s bands from bottom to top, the brightness of the 18s band is 1/2 times of that of the 28s band, and the RNA band is bright and clear. The nucleic acid molecules contain basic groups to ensure that the nucleic acid has maximum absorption at 260nm, and the average concentration of the RNA extracted at this time is 2367.1 ng.mu.L measured by a NanoDrop2000 nucleic acid analyzer^-1The A260/A280 value was 1.98 and the A260/A230 value was 2.21, indicating good sample purity (FIG. 5). And carrying out cDNA reverse transcription according to the measured RNA concentration, carrying out agarose gel electrophoresis detection on the genomic DNA and the cDNA of the Chinese cabbage extracted by the CTAB method at the same time, and recombining the obtained BrMYC2/3/4 gene fragment and the pCAMBIA2302 linear vector, wherein the size of a band is correct.

1.3.3 construction and characterization of p2302MYC overexpression vector

After the amplification product is constructed into a pCAMBIA2302 vector, the pCAMBIA2302 vector is transferred into escherichia coli, and a single clone is selected for colony PCR identification, and the position of an electrophoresis band is consistent with that of a target gene band, and the colony can be preliminarily judged to be a positive colony with higher brightness. The target band sizes of MYC2, MYC3-1, MYC3-2, MYC4-1 and MYC4-2 amplification are 1860bp, 1734bp, 1785bp, 1317bp and 936bp respectively (FIG. 6). While BrMYC4-3 only has 163bp and is therefore not amplified. The PCR products of the target band were then sent to the company for sequence alignment. Colony PCR and sequencing results were in agreement with expectations (FIG. 7), and plasmids were extracted to transform Agrobacterium.

Acquisition and functional verification of 2 BrMYC2/3/4 overexpression transgenic Arabidopsis thaliana

2.1 test materials

2.1.1 plant Material

In this study, Columbia ecotype Arabidopsis thaliana was used for the genetic transformation of heterologous expression vectors. The planting conditions of the plants are the same as 1.1.1.

2.1.2 test strains

Agrobacterium transformed with the p2302MYC2/3/4 overexpression vector constructed at 1.2.4.

2.1.3 preparation of solution and Medium

MS suspension: 1/4MS + 6% sucrose + ddH₂O+0.02％silwet+L-77

100mL of 1M mannitol: 18.217g mannitol in 100mL ddH₂And O, heating to 25 ℃ for dissolution.

20mL of 5mM Sinigrin: 41.548mg of the composition was dissolved in 20mL of sonicated water and stored in aliquots at-20 ℃.

100mL DEAE Sephadex A25: 2.5g DEAE Sephadex A25+200mL distilled water is boiled for 2h, and split stored at 4 ℃.

25mL SiO₂：1g SiO₂+25mL of distilled water.

20mL of 0.1% sulfatase: 0.02g of sulfatase and 20mL of distilled water are subpackaged and stored at the temperature of minus 20 ℃.

The other solutions and culture media were prepared as in 1.1.3.

2.2 test methods

2.2.1 floral dip transformation and selection of Arabidopsis

Selecting a 5-w-old arabidopsis single plant which grows vigorously and grows out a plurality of inflorescences for inflorescence infection. The overexpression vector agrobacterium needs to be activated in advance, liquid LB with target strains is centrifuged to obtain bacterium blocks, and the solution OD is made after MS suspension is used for heavy suspension₆₀₀Approximatively 0.8, the suspension is poured into a suitably sized graduated cylinder in preparation for Arabidopsis infestation. The method comprises the following steps:

(1) arabidopsis seed pods and fully opened flower buds were removed.

(2) The fresh-keeping film covers the arabidopsis thaliana hole pot to prevent the base material from leaking when the inverted buckle is infected.

(3) The arabidopsis inflorescences containing the bracteal buds are inserted into the bacterial liquid suspension and infected for 60s, and all inflorescences are immersed in the suspension.

(4) After infection, sucking off redundant bacteria liquid on the arabidopsis thaliana flower shoots, putting the arabidopsis thaliana into a clean hole tray paved with newspaper and wetted in advance, covering a transparent tray cover and dry newspaper, and placing in a dark and cool place for infection for 24 hours.

(5) The next day, the wrapped preservative film is removed, the infected arabidopsis thaliana is straightened, and the arabidopsis thaliana is placed in an artificial climate box or an artificial climate chamber (the plant is not required to be placed under high temperature or strong light so as to avoid burning out).

(6) If Arabidopsis grows well, the Arabidopsis is infected 2 times after one week (the above steps are repeated).

(7) The soil is kept moist before the fruit clamp is ripe and falls off, and the principle of dryness and wetness is kept after watering.

(8) The individual plants were harvested and marked.

2.2.2 molecular detection and screening of transgenic Arabidopsis plants

(1) PCR detection of transgenic Arabidopsis thaliana. The rosette leaves of positive plants p2302MYC2/3/4 and pCAMBIA2302 were used as material for DNA extraction and PCR positive detection was performed using the detection primers p2302 npt II-f and p2302 npt II-r (same as 1.2.2) for the marker gene npt II in the pCAMBIA2302 vector.

(2) In the presence of Kana, according to T₂Series 3: 1 separation ratio at T₃Homozygous plants with a single copy of the transgene insert were selected for generation. Harvesting from T₃Leaf samples of transgenic plants, frozen in liquid nitrogen, and stored at-80 ℃ until later use. Three independent biological replicates were used for each experiment.

2.2.3 yield assessment of transgenic Arabidopsis seeds

To determine seed yield, T from each genotype₃Thirty plants are extracted from the strain. After the siliques are mature, the first five incompletely developed siliques are removed from the main rachis. The seed number per silique was then evaluated using the first complete silique. Mature siliques were spread on A4 paper and the carpel wall was removed with a dissecting needle, followed by a Leica stereomicroscope (MZ 16)FA, Leica, Germany) to calculate the seed number per silique. The remaining siliques were matured and seeds were selected from the siliques on the basis of the main inflorescence for observation. Approximately 2,000 mature seeds were randomly selected from the p2302MYC2/3/4 and pCAMBIA2302 transgenic lines using a Leica stereomicroscope and observed and photographed. The length and width of the seeds were estimated using ImageJ software (ImageJ, 1.47v, NIH, Bethesda, USA). Seed weight was measured using an electronic scale. Data represent the average of three biological replicates.

2.2.4 evaluation of the growth stage of transgenic Arabidopsis plants

To assess the differences in the transition in growth stages between different genotypes of overexpressing Arabidopsis thaliana, one would expect from each T₃About 30 seedlings were randomly selected from the line, transplanted into a sterilized peat soil and vermiculite (1: 1) medium, and placed in a greenhouse for about 2-3 weeks. To assess whether the seedlings have reached maturity, leaf back epidermal hair was observed using a Leica stereomicroscope and the appearance of epidermal hair was scored as an indicator of the time to transition between vegetative growth stages. For leaf shape analysis, the fully expanded leaf was removed, adhered to a cardboard with double sided tape, flattened with scotch tape, and then scanned using an Epson V700 Professional scanner (Epson, Suwa, Japan). And recording the bolting time and the number of rosette leaves during bolting to determine the flowering time of the arabidopsis thaliana. And determining the plant height and the number of branches of the plant after flowering. Photographs were taken from plants near the ruler, which was used to calibrate ImageJ software to accurately measure distance. The maximum height (from the growth point to the highest leaf tip, as indicated by the vertical line) was estimated from the profile of different sizes of Arabidopsis thaliana. All measurements were performed in triplicate independently from the biological replicates.

2.2.5 determination of the content of overexpressed transgenic Arabidopsis thaliana glucosinolates

Homozygous T for transgenic Arabidopsis lines₃The rosette leaves of the generation seedlings are used for measuring the content of the glucosinolate. HPLC analysis was performed using an Agilent1200 system (Agilent Technologies, Inc., Santa Clara, USA) and a C18 reverse phase column (250X 4mm, 5 μm, Bischoff, Germany). Within 60min at a rate of 1 mL/min^-1The flow rates of (A) and (B) are chromatographed in the following orderAnd (3) analysis: 100% H₂O (2min), linear gradient of 0% -20% ACN (32min), 20% ACN (6min), then 20% -100% ACN (5min) and 0% ACN were injected before the next sample was injected. The eluate was monitored at 229nm with a UV detector. Identifying each component of the detected glucosinolate according to the peak-appearing time of the liquid chromatogram, calculating the content according to the internal standard sinigrin amount and the corresponding response factor, and calculating the micromole number (mu mol. g) of the glucosinolate in each gram of dry weight^-1DW) is a unit. Three biological and three technical replicates were performed and the data were analyzed using SPSS software.

2.2.6 bioassay of antifungal Activity of transgenic Arabidopsis thaliana

Lyophilized leaf powder of each transgenic arabidopsis line was used to study the effect of different glucosinolates on the visible growth of sclerotinia sclerotiorum. Sclerotinia sclerotiorum (sclerotiorum) was stored at 4 ℃ and then reactivated in Petri dishes containing Potato Dextrose Agar (PDA) medium (Becton Dickinson, Columbia, Md.). The mycelium was inoculated into the center with a 5mm punch. The dishes were then incubated at 22 ℃ for 72h to provide actively growing mycelium for subsequent experiments. The edge of the hyphae in the PDA culture medium cultured for 72h was cut off with a hole puncher to obtain an agar sieve with a diameter of 5mm and with uniformly growing sclerotinia sclerotiorum. The agar sieve was placed in the center of the new PDA medium surface and then 3 discs of filter paper 10mm in diameter were placed evenly on the edge of the PDA medium. Each filter paper disc only received 25mg of lyophilized powder and 100. mu.L of ddH₂O, at 100. mu.L ddH₂O as a control. After incubating the dishes containing sclerotinia sclerotiorum and the lyophilized powder at 22 ℃ for 72h, the growth of sclerotinia sclerotiorum was evaluated by observing the visible hyphal growth and the number of sclerotia per dish. Three biological replicates and three technical replicates were performed.

2.3 results and analysis

2.3.1 Effect of overexpression of BrMYC2/3/4 on Arabidopsis seed yield

The transgenic Arabidopsis thaliana overexpressing BrMYC2/3/4 (named BrMYC2 respectively) was analyzed^OE、BrMYC3-1^OE、BrMYC3-2^OE、BrMYC4-1^OEAnd BrMYC4-2^OE) Andseed yield of transgenic arabidopsis (designated Ctrl) plants with empty vector pCAMBIA2302 as control, including seed size (length and width), thousand kernel weight, number of seeds per silique and total weight of individual seeds. To minimize the effect of environmental factors on seed development, all plants were maintained under identical growth conditions, including temperature, light, moisture and nutrients. As shown in fig. 8 and 9, there were significant differences in seed yield between the different transgenic plants. BrMYC2^OEThe length of the seeds of the strain is minimum; BrMYC2^OE，BrMYC3-2^OEAnd BrMYC4-1^OEC. BrMYC3-2^OE，BrMYC4-1^OEAnd BrMYC4-2^OEAnd BrMYC4-1^OE、BrMYC4-2^OEAnd BrMYC3-1^OEThere was no significant difference in seed length between, all of which were significantly smaller than the control (fig. 8C). BrMYC3-2^OEAnd BrMYC4-1^OELines had the smallest seed width followed by BrMYC4-2^OE、BrMYC2^OE、BrMYC3-1^OE、Ctrl，BrMYC3-2^OE、BrMYC4-1^OEAnd BrMYC4-2^OEAnd BrMYC4-2^OE、BrMYC2^OEAnd BrMYC3-1^OEAnd BrMYC3-1^OEThere was no significant difference from the control (fig. 8D). Thousand kernel weight was significantly reduced for all transgenic lines compared to the control (fig. 8E). BrMYC2^OEThe strain has the smallest thousand seed weight, and the second is BrMYC3-2^OE，BrMYC4-1^OE，BrMYC4-2^OEAnd BrMYC3-1^OE。BrMYC3-1^OEThe thousand seed weight of the seeds is slightly higher than that of BrMYC3-2^OEAnd BrMYC4-1^OEAnd BrMYC3-2^OE，BrMYC4-1^OEAnd BrMYC4-2^OEThe thousand seed weight and BrMYC4-2 of^OEAnd BrMYC3-1^OEThere was no significant difference in thousand seed weight between them. BrMYC2^OEThe number of seeds of single silique of the line was minimal, while the number of seeds of single silique of all other transgenic lines was significantly higher than the control (fig. 8B and 8F). Transgenic BrMYC4-1^OEThe number of seeds in a single silique was the greatest, followed by BrMYC3-2^OE，BrMYC3-1^OE，BrMYC4-2^OE. As shown in FIG. 9, BrMYC2^OETotal of individual seeds of the lineHighest in weight, second in weight BrMYC3-2^OE、BrMYC4-1^OE。BrMYC2^OE、BrMYC3-2^OE、BrMYC4-1^OEAll above the control. BrMYC4-2^OENot significantly different from the control, BrMYC3-1^OESignificantly lower than the control.

2.3.2 Effect of overexpression of BrMYC2/3/4 on Arabidopsis plant development

To determine whether BrMYC2/3/4 expression affected vegetative growth and reproductive development, the phenotype of BrMYC2/3/4 overexpressing transgenic arabidopsis plants was observed and analyzed at the arabidopsis seedling and bolting stages (fig. 10-12).

During the vegetative growth phase of the young, we studied the root and hypocotyl lengths of the seedlings. There were significant differences in root and hypocotyl length between control and transgenic plants (figure 10). BrMYC2^OEThe strain showed the shortest root length, followed by BrMYC3-1^OE，BrMYC3-2^OE，BrMYC4-1^OEAnd BrMYC4-2^OE(FIG. 10B). BrMYC2^OEAnd BrMYC3-1^OEThe root length of the strain was shorter than the control. Although BrMYC3-2^OE，BrMYC4-1^OEAnd BrMYC4-2^OEThere was no significant difference between lines, but their root length was significantly increased compared to the control. Transgenic BrMYC2^OEThe hypocotyl length of (A) is also shortest, followed by BrMYC3-1^OE，BrMYC4-2^OE，BrMYC4-1^OEAnd BrMYC3-2^OE(FIG. 10C). BrMYC2^OEHas a shorter hypocotyl length than the control, and BrMYC3-1^OE，BrMYC3-2^OE，BrMYC4-1^OEAnd BrMYC4-2^OEThe hypocotyl length of (a) was longer than that of the control. Thus, BrMYC2^OEAnd BrMYC3-1^OEThe expression of (A) inhibits root elongation in Arabidopsis, BrMYC3-2^OE、BrMYC4-1^OE、BrMYC4-2^OEThe expression of (a) promotes root elongation in Arabidopsis. BrMYC2^OEThe expression of (A) inhibits the elongation of the hypocotyl of Arabidopsis, BrMYC3-1^OE、BrMYC3-2^OE、BrMYC4-1^OE、BrMYC4-2^OEThe expression of (a) promotes elongation of the hypocotyl of Arabidopsis thaliana.

Approximately 3-4 weeks after seed sowing, arabidopsis seedlings transition from juvenile to adult vegetative stages (fig. 11). Transgenic plantsThe leaf shape of the material was normal and was not different from the control leaf. BrMYC2 compared to control^OE、BrMYC3-1^OE、BrMYC3-2^OE、BrMYC4-1^OEOverexpression of the transgenic plants resulted in the first leaf with epidermal hairs being low in leaf position, while BrMYC4-2^OEThere was no significant difference from the control (fig. 11B). For leaf growth rate, BrMYC2^OE、BrMYC3-1^OE、BrMYC4-1^OE、BrMYC4-2^OESignificantly faster than control, but BrMYC3-2^OESimilar to the control (fig. 11C).

As for the reproductive growth phase, we studied the bolting time, the rosette leaf number, plant height and tiller number at the bolting phase (FIG. 12). BrMYC2^OEThe bolting time is obviously faster, while BrMYC3-2^OEAnd BrMYC4-2^OEThe bolting time is slower than that of the control. BrMYC3-1^OEAnd BrMYC4-1^OEBolting time was similar to control (fig. 12A and 12B). BrMYC2 compared to control^OE、BrMYC3-1^OE、BrMYC4-1^OEThe number of rosette leaves is obviously reduced when the transgenic plants are over-expressed for bolting, while BrMYC3-2^OE、BrMYC4-2^OEIt is increased (fig. 12A and 12C). The number of rosette leaves can be used as the judgment basis of flowering time when bolting, and the rosette leaves of late flowering plants are more. Thus, in Arabidopsis, BrMYC2^OE，BrMYC3-1^OEAnd BrMYC4-1^OEThe heterologous overexpression of (A) promotes earlier flowering time, whereas BrMYC3-2^OEAnd BrMYC4-2^OEThe heterologous overexpression of (a) promotes delayed flowering time in Arabidopsis thaliana. In terms of plant height, BrMYC2 compared with the control^OEThe plant height of (1) is obviously increased, while BrMYC3-2^OE，BrMYC4-1^OEAnd BrMYC4-2^OEIs significantly reduced. Furthermore, BrMYC3-2^OEAnd BrMYC4-2^OEAnd BrMYC3-1^OEThere was no significant difference from the control (fig. 12A and 12E). BrMYC2^OEAnd BrMYC3-1^OEIs significantly higher than the control, while BrMYC3-2^OE，BrMYC4-1^OE，BrMYC4-2^OEThere was no significant difference from the control (fig. 12A and 12F).

2.3.3 analysis of the content of overexpressed transgenic Arabidopsis thaliana glucosinolates

To investigate the effect of heterologous overexpression of BrMYC2/3/4 on thioglycoside metabolism, T was determined using HPLC₃The variety and content of glucosinolate in the leaves of the strain. The levels of most short and long chain aliphatic and indole glucosinolates of the transgenic lines were significantly increased compared to the control (table 6). Glucoiberin (GBR) from high methionine in BrMYC2^OEThe strain is increased by 2.5 times. BrMYC2^OEIn the strain, the aliphatic glucosinolates Glucoerucin (GEC) and Glucorapanin (GRN) derived from dihomomethionine were increased by 3.0 times and 2.1 times, respectively. Glucolysin (GAS) from Tri-high methionine in BrMYC2^OEThe strain is increased by 2.2 times. Glucohirsutin (GHT) derived from pentamethylenethiamine in BrMYC2^OEThe increase of the strain is 3.9 times, and the strain is in BrMYC3-1^OEThe increase of the strain is 1.9 times, and the strain is in BrMYC4-1^OEIncrease 1.8 times. BrMYC2^OEThe major indoxyl glucosinolates, such as GBC, 4MeGBC and NeoGBC, are increased by 1.5 times, 8.7 times and 3 times, respectively. BrMYC3-1^OEThe 4MeGBC is increased by 4.6 times. In BrMYC3-1^OE、BrMYC3-2^OE、BrMYC4-1^OE、BrMYC4-2^OEIn the transgenic Arabidopsis, NeoGBC was increased by 2.8 times, 1.8 times, 2.6 times and 2.0 times, respectively. As shown in Table 7, in BrMYC2^OE、BrMYC3-1^OE、BrMYC4-1^OEIn the transgenic arabidopsis thaliana over-expression, the aliphatic glucosinolates were increased by 2.9, 1.7 and 1.6 times, respectively. In BrMYC2^OE、BrMYC3-1^OEIn the transgenic arabidopsis thaliana over-expression, the indole glucosinolates are increased by 4.6 times and 2.9 times respectively. In BrMYC2^OE、BrMYC3-1^OE、BrMYC4-1^OEIn the transgenic Arabidopsis, total GS was increased by 3.0-fold, 1.7-fold and 1.6-fold, respectively. Therefore, except BrMYC4-2^OEIn addition, the levels of most aliphatic and indole glucosinolates were significantly increased in all strains.

TABLE 6 individual thioglycoside GS content (. mu. mol. g)^-1DW)

Note: data represent mean ± standard deviation of triplicate samples. Statistical analysis was performed using ANOVA followed by Tukey's multiple comparison test (p < 0.05). Abbreviations: 4MeGBC, 4-methoxyglucopyranosasicin; 4-OHGBC, 4-hydroxygluconobarassicin; GAS, glucolysin; GBC, gluconobarassicin; GB, gluconapin; GRN, glucoraphanin; NeoGBC, neoglucobrassicin; GBR, glucoiberin; GBV, glucoiberverin; GEC, glucoerucin; GHT, glucohirsutin; GNA, gluconapin; GRN, glucoraphanin; NeoGBC, neoglucobrassicin.

TABLE 7 Total thioglycoside GS content (. mu. mol. g)^-1DW)

Note: data represent mean ± standard deviation of triplicate samples. Statistical analysis was performed using ANOVA followed by Tukey's multiple comparison test (p < 0.05). Abbreviations: AGS, alcoholic glucoside olate; IGS, indele gluconolactate.

2.3.4 in vitro antifungal Activity analysis of transgenic Arabidopsis

In order to study the resistance degree of transgenic arabidopsis to sclerotinia sclerotiorum, 25mg multiplied by 3 of freeze-dried powder of rosette leaves of each transgenic plant is uniformly distributed around hyphae. After 72 hours of culture, the patchy cotton mycelia grew with a change visible to the naked eye (fig. 13). In BrMYC2^OEThe thinnest sclerotinia plaque found in (1), followed by BrMYC3-1^OE，BrMYC4-1^OE，BrMYC3-2^OEAnd BrMYC4-2^OE. Control line expression vector control shows greater than ddH₂O control much thinner sclerotinia plaque, indicating that endogenous basal thioglycoside levels present in Ctrl inhibit the growth of sclerotinia to some extent. Notably, the control showed thicker sclerotinia plaques than the BrMYC2/3/4 overexpressing transgenic line. This is probably due to the higher content of thioglycoside accumulated in the BrMYC2/3/4 overexpression transgenic lines, which in turn inhibited the growth of sclerotinia hyphae.

Claims

1.BrMYC2The gene is over-expressed inUse in increasing the resistance of a plant to a fungal pathogen,BrMYC2the gene number is BraA05g023030.3C, the plant is Arabidopsis, and the fungal pathogen is Sclerotinia sclerotiorum.