CN102295690B - Disease tolerance related protein, and coding gene and application thereof - Google Patents

Abstract

The invention discloses a disease tolerance related protein, and a coding gene and application thereof. The disease tolerance related protein is a) or b) as follows: a) protein composed of an amino acid disclosed as SEQ ID NO:2; and b) protein derived from a), which is substitution and/or deletion and/or addition of one or more amino acid residues on the basis of the amino acid sequence disclosed as SEQ ID NO:2 and has the same functions as a). The experiment proves that the gene disclosed by the invention has the functions of enhancing plant disease tolerance and reducing plant anti-aging performance. Therefore, the gene disclosed by the invention has wide application prospects in the field of plant inheritance breeding.

Description

A kind of and disease resistance associated protein and encoding gene and application

Technical field

The present invention relates to a kind of and disease resistance associated protein and encoding gene and application.

Background technology

At occurring in nature, plant often is in process of growth in biological adverse circumstance and these two kinds of bad external environments of abiotic stress, and the former comprises fungi, bacterium, the plant mycoplasma, virus, microorganism or nematodes such as virusoid, the invasion and attack of insect, the latter similarly is cold damage, salt damage, adverse circumstances such as light evil.On average, each farm crop all can be infected by hundreds of or more pathogenic bacteria (pathogens), so each kind of plant has its special disease problem.Different phytopathogens can utilize different molecular mechanisms to go to infection plant and cause disease, and relatively plant can start defense mechanism and self exempt from the infection that what suffers pathogenic bacteria to protect when facing these biological adverse circumstances.

The disease resistance response of plant is the complicated regulation process of controlled by multiple genes.The gene of involved in plant disease resistance response can be divided into two classes: (1) disease-resistant (main effect) gene becomes R (Resistance) gene and (2) disease-resistant related gene again.According to the understanding of present people to the plant disease-resistant reaction, think that it is by determining from disease-resistant R (resistance) gene of what plant and nontoxic avr (avirulence) gene interaction from the what pathogenic bacteria accordingly that plant and pathogenic bacteria interact.Through the research of more than ten years, people have selected from different plants and have grown multiple disease-resistant gene.These disease-resistant gene encoded protein matter products generally have leucine enrichment tumor-necrosis factor glycoproteins territory (leucine rich repeats, be called for short LRR), silk amino acid/threonine kinase (serine/threonine kinase, be called for short STK), nucleotide binding site (nucleotide binding site, be called for short NBS), leucine zipper (leucine zippers, be called for short LZs) and white plain-1 acceptor similar structures (the Toll/interleukin-1 receptor simility that is situated between, be called for short TIR) wait one or more conserved structure, in plant disease-resistant, may mediate the identification of disease-resistant message, produce and transmittance process.The plant disease-resistant genes involved refers to that all participate in the gene of disease resistance response except disease-resistant gene, and their coded product participates in disease-resistant signaling molecule in the synthetic plant materials, participates in the signal conduction, stops the signal conduction or participates in defensive raction etc.The common feature of this genoid is that plant is obviously raise or reduction by its expression level of pathogeny evoked back.Through the research of nearly more than ten years, people are by the disease-resistant or susceptible mutant of extensive screening and screened by the methods such as change of gene expression dose according to plant to have obtained a lot of plant disease-resistant genes involveds.But people are also limited to the mechanism of action understanding of screen these plant disease-resistant genes involveds that obtain.At present people obtain generally understanding be exactly that these disease-resistant related genes are done the effect that its resistance against diseases of time spent is lower than resistant gene in plant separately.But because the disease-resistant gene that most of disease-resistant related genes participate in plant materials does not have antigen-specific, so these genes are the genetic resourceses with resistance of wide spectrum.So the biological function of developing and study these and plant disease-resistant genes involved has significant application value in the plant breeding process.

Paddy rice is one of most important food crop in the world, also is China's important crops, and sown area and ultimate production all account for the first place of food crop throughout the year.Disease and pest is one of principal element that causes the paddy rice underproduction and quality reduction, exploitation is also studied new paddy disease-resistant related gene to improving plant to the resistance of disease and pest, be conducive to utilize efficient approach to cultivate novel rice varieties, the control disease takes place, and improves the yield and quality of plant.

The rice blast of paddy rice and bacterial leaf-blight are the two big main diseases of paddy rice.Rice blast is main fungal disease, has had a strong impact on proterties such as rice yield, quality.Because Pyricularia oryzae has very strong adaptive capacity to environment, rice blast is extensively taken place in each paddy fields of the whole world.Bacterial leaf-blight is main Micobial Disease, and in a single day this disease takes place, and will cause Rice Production to have a strong impact on.The general underproduction 10%～20%, but the grave illness field underproduction more than 50%, even total crop failure.Research to the disease-resistant gene of the rice blast of paddy rice and bacterial leaf-blight over nearly 10 years has obtained many achievements.But because the disease resistance that mediates of single disease-resistant gene has the height specialization, can only resist limited microspecies, disease-resistant spectrum is narrow, so that pathogenic bacterium colony just faces the risk of resistant lose when changing.Therefore, utilize modern transgenation technology, make up new mutant library, screen the novel gene relevant with plant disease-resistant and have important significance for theories and using value.

Leaf senile (leaf senescence) is the final stage that plant leaf grows, its notable feature is that chlorophyll reduces, the cellular content degraded, but this does not represent finishing of life, because the composition of these degradeds is transferred in the reproductive organ seed as nutritive substance, therefore, leaf senile also is the programmed cell death process (Programmed cell death) of an active.Leaf senile is indispensable in a development of plants process developmental stage, is the final stage of development of plants.Therefore, the time of leaf senile generation is subjected to the adjusting at development of plants age.Yet aging course comprises that old and feeble speed and characterization of molecules etc. can be subjected to the influence of external environmental factor and inner hormonal readiness.The environmental factors that influences the plant leaf aging comprises adverse circumstance, arid, nutritive deficiency and pathogen infection etc.By comparing the gene expression pattern of plant in adverse circumstance reaction and leaf senile process, find that these two bioprocesss exist suitable cross reaction.There are 28 expression of gene induced by adverse circumstance in 43 transcription factors of for example, in the plant senescence process, being induced.But up to the present, we also are not very clear the detailed mechanism of environmental factors inducer blade aging.One widely understanding be hormone signal approach mediation or influenced the regulate process of environmental factors to development of plants.In the plant leaf aging course, there is multiple hormone signal pathway to participate in regulate process.Wherein, phytokinin is considered to one of most important hormone of regulating plant senescence.Studies show that external source applies the aging that phytokinin can delay blade effectively; By key gene-prenyltransferase (IPT) expression of gene in the promoters driven phytokinin building-up process of old and feeble specific expression gene SAG12, the level that improves endogenous raising phytokinin also can delay the aging course of transgenic plant significantly.Although phytokinin has unusual effect in delaying the leaf senile process, the detailed mechanism of its adjusting vane aging also is not very clear at present.Recent studies show that, (Histidine Kinase 3 AHK3) has vital role to one of acceptor of phytokinin histidine kinase 3 in the Arabidopis thaliana in the regulate process of the leaf longevity that phytokinin mediates.By analyzing the function acquisition type mutant ore1 2-1 of AHK3 gene, find that ore1 2-1 mutant has the phenotype that declines obvious evening.The result of this research has proved that also the phosphorylation of the downstream component Arabidopsis response regulator 2 (ARR2) of AHK3 has important effect in the leaf senile process of AHK3 regulation and control.The ARR2 of phosphorylation is expression how further to have regulated and control senescence-associated gene, also is not very clear at present.

Leaf senile is that the process of change in order all takes place for a cellularstructure and cell interior physiology, biochemistry and genetic expression, this process is subjected to the strict control of specific gene to a great extent except the influence that is subjected to environmental factors and various hormone signal pathways.1989, Davies etc. at first reported and leaf senile correlation gene.2003, Gepstein etc. utilize the mRNA differential display technique, screen the gene that raises in more than 800 aging course, be called as senescence-associated gene (SAGs:senescence-associated genes), wherein have more than 70 gene not report in the past, this has illustrated that the leaf senile process relates to the synthetic of new albumen.Opposite with SAG, between senescence phase, some gene then after aging began, obviously reduced by expression amount, thus these genes be referred to as old and feeble down-regulated gene (Senescence Down-regulated Genes, SDGs), for example: the gene relevant with photosynthesis.Although discovered the gene of adjusting vane aging, the mechanism of regulation and control leaf senile is not very clear that also a lot of problems are still arranged.

Summary of the invention

An object of the present invention is to provide a kind of albumen and encoding gene thereof.

Albumen provided by the present invention, be following a) or b) protein:

A), the protein of being formed by the aminoacid sequence shown in the SEQ ID NO:2;

B), with the aminoacid sequence shown in the SEQ ID NO:2 through the replacement of one or several amino-acid residue and/or disappearance and/or interpolation and tool identical function by the protein of a) deriving.

Described encoding gene is following 1) or 2) or 3) or 4) or 5) or 6) shown in:

1) dna molecular shown in the SEQ ID NO:3;

2) dna molecular shown in the Nucleotide of 33-1994 position among the SEQ ID NO:3;

3) dna molecular shown in the SEQ ID NO:1;

4) dna molecular shown in the Nucleotide of 2360-6020 position among the SEQ ID NO:1;

5) under stringent condition with 1) or 2) the dna sequence dna hybridization that limits and the dna molecular of encoding said proteins;

6) with 1) or 2) or 3) or 4) dna sequence dna that limits has homology more than 90% and the dna molecular of encoding said proteins.

The primer of above-mentioned arbitrary described full length gene or its any fragment of increasing is to also belonging to protection scope of the present invention.

Described primer is to shown in SEQ ID NO:4 and SEQ ID NO:5.

The recombinant vectors, reorganization bacterium, recombinant virus, transgenic cell line or the expression cassette that contain above-mentioned arbitrary described encoding gene also belong to protection scope of the present invention.

Another object of the present invention provides a kind of method that changes disease resistance of plant.

The method of change disease resistance of plant provided by the present invention is to import above-mentioned arbitrary described encoding gene in the plant that sets out, and obtains the transgenic plant that disease resistance is higher than the described plant that sets out.

In the method for above-mentioned change disease resistance of plant, described disease resistance is blast resisting.

In the method for above-mentioned change disease resistance of plant, described rice blast is caused by Pyricularia oryzae (Magnaporthe grisea) ZB15 or Pyricularia oryzae (Magnaporthe grisea) Z8-10-14;

In the method for above-mentioned change disease resistance of plant; The described plant that sets out is monocotyledons; Described monocotyledons is paddy rice.

Last purpose of the present invention provides a kind of method that changes the plants antisenescence performance.

The method of change plants antisenescence performance provided by the present invention is to import above-mentioned arbitrary described encoding gene in the plant that sets out, and obtains the transgenic plant that anti-ageing performance is lower than the described plant that sets out.

In the method for above-mentioned change plants antisenescence performance, the described plant that sets out is monocotyledons; Described monocotyledons is paddy rice.

Experiment showed, that gene of the present invention has the disease resistance that strengthens plant and the function that reduces the anti-ageing property of plant.Gene of the present invention has broad application prospects in the genetic breeding field of plant.

Description of drawings

Fig. 1 is eas1 mutant choice and phenotype analytical thereof.

Fig. 2 is the map based cloning of OsEAS1 gene.OsEAS1 is positioned on No. 3 karyomit(e), between mark RM81 and RM489.

Fig. 3 is the complementation test of eas1 mutant.

Fig. 4 is the blast resisting experiment of eas1 mutant.

Fig. 5 is the bacterial leaf spot resistant experiment of eas1 mutant.

Fig. 6 is the dark induction experiment of eas1 mutant blade.

Fig. 7 is transgenic paddy rice blast resisting result.

Fig. 8 is the anti-ageing detected result of transgenic paddy rice.

Embodiment

Employed experimental technique is ordinary method if no special instructions among the following embodiment.

Used material, reagent etc. if no special instructions, all can obtain from commercial channels among the following embodiment.

The discovery of embodiment 1, gene

The primer and probe are synthetic by Beijing AudioCodes biotech firm.

One, eas1 mutant choice and phenotype analytical thereof.

(1) utilize the Japanese fine rice paddy seed of EMS mutagenesis japonica rice background, by 2 generation self propagated obtain the genetic stability material of M2.It is candidate material that field observation namely shows old and feeble in advance paddy rice in seedling stage.According to investigation result, find eas1 under natural growthing condition, blade table reveals tangible early ageing phenotype, and being embodied in the mutant plant later stage, to show as blade tip withered, and the phenotype (Figure 1A) of early ageing such as brown spot appears in blade.Simultaneously, the eas1 mutant shows the feature of natural immunity forfeiture, and blade presents cape horn fever spot (Figure 1B), and fertility descends, the phenotype of tillering and reducing, and eas1 causes death when serious even when seedling stage.Reach and the fine genetic experiment of backcrossing of Japan by the hybridization with long-grained nonglutinous rice background paddy rice 93-11, determine that the phenotype of eas1 is controlled by single-gene, show as recessive mutation.

Among Fig. 1, A figure is the paddy rice that grew under field conditions (factors) 35 days, and left side plant is the wild-type paddy rice in the picture, and the right plant is the eas1 mutant; B figure is the blade of paddy rice among the A figure, and the left side is the wild-type rice leaf, and the right is eas1 mutant blade.

Two, the map based cloning of OsEAS1 gene

The target group that makes up in one by experiment, F2 obtains the material that 58 strains have phenotype.Utilize existing paddy rice database (GRAMENE, TIGR, NCBI) select the first location that molecule marker is used for OsEAS1,184 SSR marks that are distributed on 12 karyomit(e)s of paddy rice have been selected altogether for use, OsEAS1 is positioned on No. 3 karyomit(e), between mark RM81 and RM489,8 and 4 exchange strains are arranged respectively.Further develop F3 Fine Mapping colony, obtain the material that 680 strains have phenotype.The new SSR mark of design between RM546 and RM282, OsEAS1 is positioned between mark EAS1-4 and the EAS1-6,3 and 11 exchange strains are arranged respectively, the physical distance of these two marks is 99739bp, include 10 ORF, wherein Os03g05310 is candidate gene (Fig. 2).Through the order-checking experiment that 3 secondary pollutants repeat, find that the 1139th Nucleotide among the Os03g05310 sports thymus pyrimidine (T) by cytosine(Cyt) (C), thereby cause the 380th Threonine (T) to sport Isoleucine (I).

RM81F：GAGTGCTTGTGCAAGATCCA

RM81R：CTTCTTCACTCATGCAGTTC

RM489F：ACTTGAGACGATCGGACACC

RM489R：TCACCCATGGATGTTGTCAG

EAS1-4F：CTTGACATCATTGCCTCTGAA

EAS1-4R：GAAAATGTTGCTTTACCCTGG

EAS1-6F：GGTATTCTAGCTGGTTGCAGT

EAS1-6R：CAGTACAGTACCCCATCCATT

Fig. 2 is the map based cloning of OsEAS1 gene.OsEAS1 is positioned on No. 3 karyomit(e), between mark RM81 and RM489.The new SSR mark of design between RM546 and RM282, OsEAS1 is positioned between mark EAS1-4 and the EAS1-6,3 and 11 exchange strains are arranged respectively, the physical distance of these two marks is 99739bp, include 10 ORF, wherein Os03g05310 is candidate gene.The order-checking experiment finds that the 1853rd among the Os03g05310 (beginning number from ATG) position Nucleotide sports thymus pyrimidine (T) by cytosine(Cyt) (C), thereby causes the 380th Threonine (T) to sport Isoleucine (I).

Three, the disease-resistant experiment of eas1 mutant

After paddy rice ears a week, method by the needle tubing injection meets bacterium Pyricularia oryzae ZB15 and Z8-10-14 respectively from the rice stem base portion, each individual plant connects 3 of bacterium and tillers above, each germ connects 10 of bacterium more than the individual plant, connect the susceptible situation that bacterium is observed wild-type and mutant eas1 after one week, the result shows that the rice blast of eas1 shows higher susceptibility (Fig. 4).Fig. 4 is the blast resisting experiment of eas1 mutant.After paddy rice ears a week, method by the needle tubing injection meets bacterium Pyricularia oryzae ZB15 and Z8-10-14 respectively from the rice stem base portion, each individual plant connects 3 of bacterium and tillers above, each germ connects 10 of bacterium more than the individual plant, connect the susceptible situation that bacterium is observed wild-type and mutant eas1 after one week, the result shows that the rice blast of eas1 shows higher susceptibility.Three blades in the left side are wild-type among the figure, are respectively the negative contrasts that water is cooked, and wild-type plant meets Pyricularia oryzae ZB15 and Z8-10-14; Three blades in the right are the eas1 mutant, are respectively the negative contrasts that water is cooked, and wild-type plant meets Pyricularia oryzae ZB15 and Z8-10-14.

Connect the bacterium bacterial leaf spot pathogenic bacteria by the wound infection method, crop paddy rice blade tip (5-10 centimetre) with the scissors that speckles with bacterial leaf spot pathogenic bacteria P6, each individual plant all connects bacterium, connect 10 above individual plants of bacterium, the susceptible situation of observing wild-type and mutant eas1 after one week, the result shows that the bacterial leaf-blight of eas1 shows higher susceptibility (Fig. 5).Fig. 5 is the bacterial leaf spot resistant experiment of eas1 mutant.Connect the bacterium bacterial leaf spot pathogenic bacteria by the wound infection method, crop paddy rice blade tip (5-10 centimetre) with the scissors that speckles with bacterial leaf spot pathogenic bacteria P6, each individual plant all connects bacterium, connect 10 above individual plants of bacterium, the susceptible situation of observing wild-type and mutant eas1 after one week, the result shows that the bacterial leaf-blight of eas1 shows higher susceptibility.Left side picture is the susceptible situation that meets bacterium one all back wild-types and mutant eas1, and the right histogram is the statistics of colony growth.

The dark induction experiment of eas1 mutant

At square ware substratum upper seeding wheel WT and the eas1 of 1/2MS, in 28 degree 16 hours 1 weeks of illumination cultivation of greenhouse, get 3-4 sheet leaf and do dark induction experiment.The blade of intercepting equal length (5 centimetres) places the 8 hole culture dish that are added with MES buffered soln, wrap up the condition that reaches dark fully with masking foil, place 28 degree greenhouses secretly to induce then 0 day, 3 days and 5 days, biology more than 3 times repeats, and measures the chlorophyll content in leaf blades when 3 days and 5 days then respectively 0 day, the result shows that eas1 compares with WT, shows the phenotype (Fig. 6) that declines tangible evening.Fig. 6 is the dark induction experiment of eas1 mutant blade.At square ware substratum upper seeding wheel WT and the eas1 of 1/2MS, in 28 degree 16 hours 1 weeks of illumination cultivation of greenhouse, get 3-4 sheet leaf and do dark induction experiment.The blade of intercepting equal length (5 centimetres) places the 8 hole culture dish that are added with MES buffered soln, wrap up the condition that reaches dark fully with masking foil, place 28 degree greenhouses secretly to induce then 0 day, 3 days and 5 days, biology more than 3 times repeats, and measures the chlorophyll content in leaf blades when 3 days and 5 days then respectively 0 day, the result shows that eas1 compares with WT, shows the phenotype that declines tangible evening.The left side is being for secretly to induce 0 day, wild-type and the mutant blade of 3 days and 5 days, and the right is 0 day, the chlorophyll content in leaf blades measurement result when 3 days and 5 days.

The function of embodiment 2, gene OsEAS1

One, function complementation experiment

(1) preparation of gene

The BAC clone at OsEAS1 place

AC090485 (http://www.ncbi.nlm.nih.gov/nuccore/14495364) is provided by country of Chinese Academy of Sciences cara gene, and the public can obtain this BAC clone with developmental biology institute from Chinese Academy of Sciences's heredity.

Carrier pBluescript SK is available from Shanghai office of Merck ﹠ Co., Inc., and catalog number is ST212205.

Utilize a large amount of methods of extracting of plasmid, obtain BAC plasmid OSJNBa0067N01

(http://www.ncbi.nlm.nih.gov/nuccore/14495364?), use SpeI then, two kinds of restriction enzymes of EcoRV (NEB) carry out enzyme and cut, agarose gel electrophoresis 0.8% separates endonuclease bamhi, use the DNA available from ancient cooking vessel state company to reclaim the purpose fragment of the about 6366bp of test kit recovery length and it is carried out purifying, to reclaim fragment is connected to through SpeI, among the carrier pBluescript SK that the EcoRV enzyme is cut, to connect product heat shock method transformed into escherichia coli (E.coli) DH5 α competent cell again, screening positive clone, it is inoculated in the 5mL LB liquid nutrient medium that contains the 50mg/L penbritin, at 37 ℃, cultivated 12-16 hour under the 200rpm, the upgrading grain, and sequence verification, the result is at the SpeI of carrier pBluescript SK, the gene order of inserting between the EcoRV restriction enzyme site is shown in SEQ ID NO:1, the plasmid that shows structure is correct, will make up correct recombinant plasmid called after SK-OsEAS1g.Be OsEAS1 with the unnamed gene shown in the SEQ ID NO:1, the aminoacid sequence of the albumen of this genes encoding is shown in SEQ ID NO:2, with this albumen called after OsEAS1.Among the SEQ ID NO:1, ATG is positioned at 2360, and TAA is positioned at 6020.

(2) checking that has complementary functions of wild type gene

Get plasmid SK-OsEAS _1gCut (purchasing the China Branch in NEB) with restriction enzyme SpeI and EcoRV enzyme and obtain gene insertion fragment, reclaim test kit (available from ancient cooking vessel state company) with glue and reclaim the OsEAS1 gene fragment, fragment behind the purifying is connected with the pCAMBIA1300 (Cambia) that the EcoRV enzyme is cut with process SpeI with T4 ligase enzyme (Roche company), connect product heat shock method transformed into escherichia coli (E.coli) DH5 α bacterial strain, a resistance screening, selecting positive bacterium colony joins 5ml and contains in the LB liquid nutrient medium of 50mg/L kantlex, 37 ℃, 200rpm cultivated 12-16 hour, extract plasmid, carry out PCR evaluation and enzyme and cut evaluation.The recombinant plasmid that the result makes up is correct, and note is made recombinant expression vector p1300-OsEAS1g.

With the sharp Agrobacterium EHA105 (Cambia) that changes over to of recombinant expression vector p1300-OsEAS1g electricity, select positive colony in 28 ℃, 200rpm cultivated 12-16 hour, utilize this bacterium liquid to carry out rice callus and infect experiment (rice callus that is used for infecting is the callus of mutant eas1 described in the embodiment 1), callus after infecting places and contains the screening of 50mg/L Totomycin substratum, obtain being transferred to division culture medium after candidate's callus, place the root culture basal growth by differentiation culture basal growth gained callus, finally obtain positive transgenosis T1 for rice material (infecting the seedling that callus obtains thus is T1 generation).

T1 is for the checking of rice material: designed a forward primer at the OsEAS1 gene and (be positioned at 2548bp, sequence is 5 ' TCTGCAAGGGCAAGAGAAG3 '), carry out pcr amplification with the reverse primer (5 ' ATCGGTGCGGGCCTCTTC3 ') on the pCAMBIA1300 carrier, can amplify size is positive transgenic paddy rice for the specific DNA band of 1.5kb.The result shows, has obtained 5 independently positive transgenic lines altogether.

T1 is carried out field planting for paddy rice, and growth was observed paddy rice at the growing state in field after 35 days under the natural condition.Find that T1 is similar for growth and the wildness of transgenic paddy rice, complementation the blade early ageing of eas1 mutant and the disabled phenotype of the natural immunity (Fig. 3, WT represent the wild-type plant, and eas1 represents mutant, and Comp represents complementary plant).

Two, wild type gene is crossed and is expressed experiment

Pyricularia oryzae (Magnaporthe grisea) ZB15 and Z8-10-14 are at document " evaluation of Anhui Dao Qu physiological races of rice blast fungus " (Chen Li, Su Xianyan, the Dinke heavily fortified point, " Chinese agronomy circular " 2007 the 23rd the 04th phases of volume) disclosed in, the public can obtain with developmental biology institute from Chinese Academy of Sciences's heredity.

Extract total RNA of Japanese fine blade with TRIZAL reagent (available from Invitrogen company) and reference reagent box specification sheets, use Invitrogen Corporation's Super Script then ^TMIts first chain cDNA is synthesized in II Reverse Transcriptase test kit and the reverse transcription of reference reagent box specification sheets, be template with the cDNA that is synthesized again, under the guiding of primer OsEAS1F (5 ' AAGCTCCACCACACGACACCCCGCAAAA3 ') (SEQ ID NO:4) and OsEAS1R (5 ' ATCAATCTCAGCATGCACGTAATC3 ') (SEQ ID NO:5), carry out pcr amplification, after reaction finishes, pcr amplification product is carried out 1% agarose gel electrophoresis to be detected, use the DNA available from ancient cooking vessel state company to reclaim the purpose fragment of the about 1994bp of test kit recovery length and it is carried out purifying, reclaim the purpose fragment; Cut carrier pBluescript SK with enzyme EcoRV enzyme, carrier after enzyme cut with reclaim the purpose fragment and be connected, to connect product heat shock method transformed into escherichia coli (E.coli) DH5 α competent cell again, screening positive clone, it is inoculated in the 5mL LB liquid nutrient medium that contains the 50mg/L penbritin, at 37 ℃, cultivated 12-16 hour under the 200rpm, the upgrading grain, obtain containing the recombinant plasmid that reclaims fragment, called after vector-EAS1, it is checked order, and sequencing result shows that the nucleotide sequence of the dna fragmentation that inserts pBluescript SK is shown in SEQ ID NO:3.

The structure that contains the pCAMBIA1300 of 35S (cauliflower mosaic virus) promotor: 35S (cauliflowermosaic virus) promotor (nucleotide sequence of this promotor is shown in 47332-48139 position Nucleotide among the Genbank EF042581) is inserted between the EcoRI and KpnI site of pCAMBIA1300 (Australian Cambia institute), obtain containing the pCAMBIA1300 of 35S (cauliflower mosaic virus) promotor, note is made pCAMBIA1300-35S.

Extract plasmid vector-EAS1, with restriction enzyme A paI and XbaI enzyme cutting (purchasing the China Branch in NEB), obtain the OsEAS1 gene and insert fragment, reclaim test kit (available from ancient cooking vessel state company) with glue and reclaim the OsEAS1 gene fragment, fragment behind the purifying is connected with the pCAMBIA1300-35S of T4 ligase enzyme (Roche company) with process ApaI and XbaI enzyme cutting, connect product heat shock method transformed into escherichia coli (E.coli) DH5 α bacterial strain, resistance screening, selecting positive bacterium colony joins 5ml and contains in the LB liquid nutrient medium of 50mg/L kantlex, 37 ℃, 200rpm cultivated 12-16 hour, extract plasmid, carry out that PCR identifies and enzyme is cut evaluation, PCR identifies that used primer is primer (5 ' ATCGGTGCGGGCCTCTTC) on the pCAMBIA1300 carrier and the primer (5 ' TCTGCAAGGGCAAGAGAAG) on the OsEAS1.The result that PCR identifies obtains and the DNA band of estimating that purpose size (928bp) is consistent; Enzyme is cut the result of evaluation, utilizes the PstI enzyme to cut and obtains and the DNA band of estimating that purpose size (489bp) is consistent, utilizes the HindIII enzyme to cut and obtains and the DNA band of estimating that purpose size (2313bp) is consistent, illustrates that the recombinant plasmid of this structure is correct.Further carry out sequence verification, the result has inserted gene shown in the SEQ ID NO:3 (being cDNA) between the ApaI of carrier pCAMBIA1300-35S and XbaI enzyme cutting site, the recombinant plasmid that shows structure is correct, and note is made recombinant expression vector pCAMBIA1300-35S-OsEAS1.

Transform: recombinant expression vector pCAMBIA1300-35S-OsEAS1 electricity is swashed change Agrobacterium EHA105 (Australian Cambia institute) over to, select positive colony in 28 ℃, 200rpm cultivated 12-16 hour, utilize this bacterium liquid to carry out rice callus and infect experiment (paddy rice that is used for infecting is the fine callus of wild-type paddy rice Japan), callus after infecting places and contains the screening of 50mg/L Totomycin substratum, obtain being transferred to division culture medium after candidate's callus, place the root culture basal growth by differentiation culture basal growth gained callus, finally obtain positive transgenosis T1 for rice material.

T1 is for the checking of rice material: designed a forward primer (sequence is 5 ' TCTGCAAGGGCAAGAGAAG3 ') at the OsEAS1 gene, carry out pcr amplification with the primer (5 ' ATCGGTGCGGGCCTCTTC3 ') on the pCAMBIA1300 carrier, can amplify size is positive transgenic paddy rice for the specific DNA band of 928bp.The result shows, has obtained three independently positive transgenic lines altogether.In the transgenosis field, independently strain system and each function are identical if obtain 3 strains, then can fully prove the external source goal gene that changes over to and in the host, work, rather than gene along with some parts on the carrier in action.

Simultaneously with without the wild-type paddy rice of any processing in contrast.

Phenotype analytical: T1 carries out field cultivation for transgenic paddy rice with wild-type paddy rice and mutant material eas1 under identical condition, T1 is similar for growing state and the wild-type of transgenic paddy rice as a result, plant height and tiller number are also similar with the wild-type paddy rice, and the blade of transgenic paddy rice is the same with the wild-type rice leaf not to be shown the disabled phenotype of the tangible natural immunity (natural immunity ability there is not the judging criterion of forfeiture: rice leaf is green no scab; The disabled judging criterion of the natural immunity: the necrosis of similar scab appears in rice leaf), three independently the phenotype of positive transgenic line do not have significant difference.

Disease resistance detects:

Rice blast: after paddy rice ears a week, method by the needle tubing injection meets bacterium Pyricularia oryzae ZB15 and Pyricularia oryzae Z8-10-14 respectively from the rice stem base portion, each individual plant connects 3 of bacterium tillers, and every kind of germ connects 10 individual plants of bacterium, connects the susceptible situation of one week of bacterium back observation paddy rice.The result: lesion area maximum in the mutant eas1 blade, lesion area is big and be significantly less than mutant in the wild-type rice leaf, and lesion area is minimum and be significantly less than wild-type in the transgenic paddy rice blade.Illustrate that transgenic paddy rice shows higher resistance, the wild-type paddy rice is to rice blast performance responsive (Fig. 7).Three independently the phenotype of positive transgenic line do not have significant difference.

Anti-ageing Performance Detection: method: after paddy rice ears a week, choose WT respectively, the boot leaf of eas1 and pCAMBIA1300-35S-OsEAS1 transgenic paddy rice is done dark induction experiment.The blade of intercepting equal length (5 centimetres) places the 8 hole culture dish that are added with MES buffered soln, wrap up the condition that reaches dark fully with masking foil, place 28 degree greenhouses secretly to induce then 0 day, 3 days and 5 days, biology more than 3 times repeats, measured the chlorophyll content in leaf blades when 3 days and 5 days then respectively 0 day.How much chlorophyllous content represents blade, and old and feeble process takes place, and chlorophyll content is significantly to descend when the leaf senile flavescence, and its moiety chlorophyll a and chlorophyll b all can have significant decline.

The detection method of chlorophyll content: the most classical and commonly used acetone method.

1. get the fresh plant blade, clean the tissue surface dirt, shred mixing.

2. take by weighing the fresh sample 0.2g that shreds, totally 3 parts, put into mortar respectively, add a small amount of quartz sand and Paris white and 2～3ml, 80% acetone, be ground into homogenate.Leave standstill 30min on ice.

3.13000rpm centrifugal 10 minutes.

4. the chloroplast pigment extracting solution in the supernatant is poured in the cuvette of optical path 1cm.Be blank with 80% acetone, under wavelength 665nm, 649nm, measure absorbancy.

Experimental result is calculated: the formula below the light absorption value substitution that mensuration is obtained: Ca=13.95A665-6.88A649; Cb=24.96A649-7.32A665.Can obtain the concentration (Ca, Cb:mg/L) of chlorophyll a and chlorophyll b accordingly, sum of the two is total chlorophyllous concentration.

The detected result of total chlorophyll content is (Fig. 8,1 expression wild-type, 2 expression mutant, 3 expression transgenic paddy rices):

When secretly inducing 0 day, various plant chlorophyll contents following (mg/g): pCAMBIA1300-35S-OsEAS1 transgenic paddy rice 1.9113; Wild-type paddy rice 1.8796; Mutant eas1 2.0426;

When secretly inducing 5 days, various plant chlorophyll contents following (mg/g): pCAMBIA1300-35S-OsEAS1 transgenic paddy rice 0.1114; Wild-type paddy rice 0.3252; Mutant eas1 1.2065.

Three independently the result of positive transgenic line do not have significant difference.

The result shows that the pCAMBIA1300-35S-OsEAS1 transgenic paddy rice shows more obvious early ageing phenotype than eas1, also shows slightly Zao aging (Fig. 8) than WT.

Claims (2)

1. method that changes disease resistance of plant is to import following 1 in the plant that sets out)-4) in arbitrary dna molecular, obtain the transgenic plant that disease resistance is higher than the described plant that sets out;

1) dna molecular shown in the SEQ ID NO:3;

2) dna molecular shown in the Nucleotide of 33-1994 position among the SEQ ID NO:3;

3) dna molecular shown in the SEQ ID NO:1;

4) dna molecular shown in the Nucleotide of 2360-6020 position among the SEQ ID NO:1;

Described disease resistance is blast resisting;

Described rice blast is caused by Pyricularia oryzae (Magnaporthe grisea) ZB15 or Pyricularia oryzae (Magnaporthe grisea) Z8-10-14;

The described plant that sets out is paddy rice.

2. method that changes the plants antisenescence performance is to import following 1 in the plant that sets out)-4) in arbitrary dna molecular, obtain the transgenic plant that anti-ageing performance is lower than the described plant that sets out;

1) dna molecular shown in the SEQ ID NO:3;

2) dna molecular shown in the Nucleotide of 33-1994 position among the SEQ ID NO:3;

3) dna molecular shown in the SEQ ID NO:1;

4) dna molecular shown in the Nucleotide of 2360-6020 position among the SEQ ID NO:1;

The described plant that sets out is paddy rice.

Images