CN113308575A

CN113308575A - Method and kit for detecting and screening N439K mutation of new coronavirus

Info

Publication number: CN113308575A
Application number: CN202110650114.0A
Authority: CN
Inventors: 邢晨; 杜忆南; 柳燕; 周静; 祝亚亭; 王小凤; 李倩; 张宁; 王悦晨
Original assignee: Anhui Medical University
Current assignee: Anhui Medical University
Priority date: 2021-06-10
Filing date: 2021-06-10
Publication date: 2021-08-27
Anticipated expiration: 2041-06-10
Also published as: CN113308575B; WO2022257664A1

Abstract

A method and a kit for detecting and screening N439K mutation of new coronavirus comprise the steps of extracting nucleic acid to be detected; carrying out amplification reaction by using the designed primer to obtain a nucleic acid amplification product; and (3) preparing CRISPR reaction mixed liquor, adding 2 mu L of nucleic acid amplification product into the first CRISPR reaction mixed liquor or the second CRISPR reaction mixed liquor, incubating for 30 minutes at 37 ℃, and reading a detection result through fluorescence. The invention has the advantages of high detection speed, high accuracy, low cost and multi-scene real-time detection.

Description

Method and kit for detecting and screening N439K mutation of new coronavirus

Technical Field

The invention belongs to the technical field of biological detection, and relates to a method and a kit for detecting and screening N439K mutation of new coronavirus.

Background

The novel coronavirus (COVID-19), called new coronavirus for short, is a newly discovered single-stranded RNA virus, has a total length of 29903 nucleotides, is transmitted through respiratory tract and conjunctiva by droplets, has strong infectivity and wide transmission range, and is the seventh coronavirus which is known at present and causes diseases to human beings. Compared with acute symptoms caused by other coronaviruses, the novel coronaviruses have infection symptoms from mild symptoms, cough symptoms, fever symptoms to dangerous symptoms, and the infection symptoms are similar to common respiratory diseases, and have strong concealment and extremely strong infectivity.

With the spread of new coronaviruses, thousands of mutations of new coronaviruses have been monitored globally. Most mutations do not result in changes in the properties of the virus, but specific mutations that are partially located on the S protein of the new coronavirus may make the virus more harmful. The S protein (spike protein) of the novel coronavirus is a component of the outermost structure of the virus, and the novel coronavirus invades cells by recognizing the hACE2 receptor on the surface of host cells through the surface protein. The human body also achieves viral immunity by recognizing viral surface antigens and thereby producing corresponding antibodies. Most of the current new corona vaccines are also designed against the S protein of new corona virus. Thus mutations occurring in the S protein of the novel coronavirus may result in a change in the corresponding amino acid, thereby rendering the mode of virus entry more infectious. Amino acid changes may result in changes in viral epitopes that render vaccine-induced protective antibodies ineffective. The N439K mutation is that the base change from C to A or C to G occurs at the 3 rd base of the 439 th amino acid of the new coronavirus S protein, which results in the conversion of the amino acid from asparagine (N) to lysine (K). It was found that the strain carrying the N439K mutation was resistant to a variety of neocoronal monoclonal antibodies as well as polyclonal antibodies, possibly resulting in immune escape of the strain carrying the N439K mutation. Meanwhile, the strain carrying the N439K mutation has higher affinity for the hACE2 receptor, possibly resulting in the enhancement of infectivity of the mutant strain.

A Single Nucleotide Polymorphism (SNP) refers to a polymorphism of a nucleic acid sequence due to a change of a single nucleotide base. Single nucleotide polymorphism detection (SNP detection) is a detection technique used to detect DNA sequence polymorphisms at the genomic level caused by single nucleotide variations. The SNP detection methods are roughly classified into 3 types: known polymorphism detection based on gel, including polymerase chain reaction, restriction fragment length polymorphism labeling, oligonucleotide ligation analysis, small sequencing and the like; secondly, non-gel high-flux detection technology comprises a fluorescence energy resonance transfer detection method, a mass spectrum technology, a DNA chip and the like; third, conformation-based unknown mutation detection, including single-strand conformation polymorphism, chemical or enzyme mismatch modification analysis, denaturing gradient gel electrophoresis, denaturing high performance liquid chromatography, etc. At present, the monitoring of the new coronavirus mutation mainly relies on high-throughput sequencing to identify SNP, although the accuracy is high, the detection period is as long as 7 days, the cost is high, and the method cannot be suitable for rapid screening of the new coronavirus mutation. Therefore, the research and development of the rapid SNP detection and screening method for the new coronavirus mutation, which has the advantages of high speed, high accuracy and low cost, is of great significance.

CRISPR is an abbreviation for "Clustered regular interspersed short palindromic repeats" and refers to regularly Clustered, interspersed short palindromic repeats. Cas is the abbreviation for "CRISPR-associated", CRISPR-associated. The CRISPR/Cas system is an adaptive mechanism for resisting phage invasion developed by bacteria and archaea, and then discovered and developed into a technology for carrying out specific nucleic acid editing on a target gene by guiding a Cas nuclease by a guide RNA. The CRISPR/Cas system works on the principle that a crRNA (CRISPR-derived RNA) is combined with a tracrRNA (trans-activating RNA) through base pairing to form a tracrRNA/crRNA complex, and the complex guides a nuclease such as a Cas9 protein to cut double-stranded DNA at a sequence target site paired with the crRNA, so that the genome DNA sequence is edited; by artificially designing the two RNAs, a gRNA (guide RNA) with a guiding function can be transformed, and the gRNA (guide RNA) can be enough to guide the site-specific cleavage of the DNA by the Cas 9. At present, the CRISPR-based nucleic acid rapid detection technology is mainly divided into two major categories, namely a Cas12 a-dependent nucleic acid isothermal detection technology called DETECTR developed by Jennifer druudna in 2020, and a Cas13 a-dependent nucleic acid isothermal detection technology called SHERLOCK developed by the owner of CRISPR patents. The principle is that a target fragment is amplified and enriched by a constant temperature amplification method such as RPA, the amplified target fragment can be guided and targeted recognized by Cas protein through a section of crRNA, the Cas protein is activated to become a DNA cutter (Cas12a) or an RNA cutter (Cas13a), and all nearby single-stranded DNA (Cas12a) or single-stranded RNA (Cas13a) is cut. This property is used for reporting the detection result by acting on the single-stranded nucleic acid fluorescent probe.

The cutting detection of the CRISPR/Cas system needs CRISPR target RNA (crRNA) to combine and recognize a target sequence and activate a Cas protein, and the single base mutation (SNP) detection utilizes the base recognition specificity of the crRNA, and the crRNA can only recognize the mutant sequence but not the original sequence without the SNP by placing mutant bases at different positions of the crRNA or artificially introducing base mismatch, so that the mutation typing detection is realized.

As shown in fig. 1, mode principles of discrimination of SNPs by LwaCas13a and LbaCas12a are shown, respectively. SNP differentiation of Cas12 a: PAM (Protospace adjacent motif) is a fixed short sequence (TTTN) near the crRNA target binding region (spacer). PAM and a seed region (seed region) which is 1-6 bases close to the PAM are crucial for recognition and activation of the LbaCas12a, and base mismatch at the PAM and the seed region can reduce the cleavage activity of the LbaCas12a protein by about 1000 times. SNP identification can be performed by placing the mutant bases in the PAM or seed region, which can greatly affect the activation of LbaCas12 a. SNP differentiation of Cas13 a: unlike the high sensitivity of LbaCas12a to single bases, LwaCas13a has no region similar to PAM and can be activated and detected for cleavage with one base mismatch, but LwaCas13a cannot be activated with two base mismatches. Therefore, the critical point for detecting SNP can be reached by artificially introducing an additional base mismatch on crRNA of LwaCas13 a: when the SNP sequence is detected, only one human mismatch exists, and the crRNA activates the Cas protein to perform cleavage detection; when the original sequence without SNP is detected, because of two base mismatches, the crRNA can not activate the Cas protein to generate corresponding spatial structure change, and the detection is negative. The reported SNP typing of ZIKV virus by using LwaCas13a in the literature tends to place a mutant base at the third base of a spacer and place an artificially synthesized base mismatch at the 5 th base of the spacer corresponding to crRNA for SNP differential detection. However, due to different base composition sequences of different detection sites, the influence on the spatial variation of the LwaCas13a protein after the combination of the detection sites and crRNA is different, and the SNP identification design work of others can only be used as a reference and cannot be applied. Therefore, when the N439K mutation of the LwaCas13a is detected, the mutant bases are tried to be placed at different positions of the spacer, the artificial mismatch is tried to be placed at different positions of the crRNA, so that a plurality of sets of crRNAs are designed for screening, and finally, one crRNA sequence is screened, so that the N439K mutation can be detected with the highest specificity and sensitivity.

Disclosure of Invention

The invention aims to provide a method and a kit for detecting and screening N439K mutation of new coronavirus.

In order to achieve the above objects and other related objects, the present invention provides the following technical solutions: a kit for detecting and screening a new coronavirus N439K mutation, the kit comprising:

two sets of RT-RAA amplification primers:

the RT-RAA upstream primer is as follows:

5’-GAAATTAATACGACTCACTATAGGGcgctccagggcaaactggaaagattgctg-3’；

then the RT-RAA downstream primer is: 5'-aaggtttgagattagacttcctaaacaatc-3', respectively;

or:

the RT-RAA upstream primer is as follows:

5’-cgctccagggcaaactggaaagattgctg-3’；

three CRISPR-specific detection crrnas:

K1 crRNA:

5’-gauuuagacuaccccaaaaacgaaggggacuaaaacagaaucuuagaauuccaagcuauaacgc-3’；

P1 crRNA：

5’-gauuuagacuaccccaaaaacgaaggggacuaaaacagaauuuuagaauuccaagcuauaacgc-3’；

B2 crRNA:

5’-uaauuucuacuaaguguagauagaauuccaagcuauaacgc-3’；

RNA fluorescent probe:

5’-FAM-mArArUrGrGrCmAmArArUrGrGrCmA-BHQ1-3’；

wherein m represents an oxymethyl modification at position 2, r represents a ribonucleotide;

DNA fluorescent probe:

5’-FAM-TTATTATT-BHQ1-3’。

the preferable technical scheme is as follows: also comprises buffer A solution and buffer B solution; the preparation method of the buffer A solution comprises the following steps: adding 50mmol of Tris buffer solution, 100nmol of potassium acetate, 20g of polyethylene glycol powder and 2mmol of dithiothreitol into 1L of water; the BufferB solution is a magnesium acetate solution with the concentration of 280 mM.

The preferable technical scheme is as follows: further comprising: HEPES buffer, MgCl₂Solution, 10 XNEB buffer2.1 buffer, RNase inhibitor, T7 RNA polymerase, RNase-free water.

In order to achieve the above objects and other related objects, the present invention provides the following technical solutions: a method for detecting and screening a new coronavirus N439K mutation, comprising the following steps:

step 1: immersing a sample to be detected in a virus preservation solution, and then performing nucleic acid extraction by using an RNA extraction kit to obtain nucleic acid to be detected;

step 2: adding 41.5 mu L of buffer A solution, 2 mu L of RT-RAA upstream primer, 2 mu L of RT-RAA downstream primer and 2 mu L of nucleic acid to be detected into a reaction tube containing protease freeze-dried powder, then adding 2.5 mu L of buffer B solution, covering a tube cover of the reaction tube, and carrying out amplification reaction to obtain a nucleic acid amplification product;

the RT-RAA upstream primer is as follows:

5’-GAAATTAATACGACTCACTATAGGGcgctccagggcaaactggaaagattgctg-3’；

or:

the RT-RAA upstream primer is as follows:

5’-cgctccagggcaaactggaaagattgctg-3’；

and step 3: preparing a first CRISPR reaction mixed solution: 0.4. mu.L of 1M HEPES buffer solution and 0.18. mu.L of 1M MgCl₂Mixing the solution, 0.8 mu L of rNTP mix with the concentration of 10uM, 2 mu L of LwaCas13a with the concentration of 63.2 ng/mu L, 1 mu L of RNase inhibitor with the concentration of 40U/mu L, 0.1 mu L of T7 RNA polymerase with the concentration of 50U/mu L, 0.5 mu L of K1 crRNA or P1 crRNA with the concentration of 10 ng/mu L, 0.2 mu L of RNA fluorescent probe with the concentration of 100uM and 12.82 mu L of RNase-free water; preparing a second CRISPR reaction mixed solution: mu.L of LbaCas12a at a concentration of 1. mu.M, 1. mu.L of B2 crRNA at a concentration of 15 ng/. mu.L, 2. mu.L of 10 XNEB buffer2.1, 0.1. mu.L of DNA fluorescent probe at a concentration of 100. mu.M, and 12.9. mu.L of RNase-free water were mixed;

k1 crRNA: for detecting the N439K-G mutation;

5’-gauuuagacuaccccaaaaacgaaggggacuaaaacagaaucuuagaauuccaagcuauaacgc-3’；

p1 crRNA: for detecting the N439K-A mutation;

5’-gauuuagacuaccccaaaaacgaaggggacuaaaacagaauuuuagaauuccaagcuauaacgc-3’；

b2 crRNA: for detecting the N439K-A mutation;

5’-uaauuucuacuaaguguagauagaauuccaagcuauaacgc-3’；

RNA fluorescent probe:

5 '-FAM-mARUrGrCmAmArArArArrGrCmA-BHQ 1-3'; wherein m is 2-oxygen methyl modification, r is RNA

DNA fluorescent probe:

5’-FAM-TTATTATT-BHQ1-3’；

and 4, step 4: adding 2 mu L of the nucleic acid amplification product obtained in the step 2 into the first CRISPR reaction mixed solution or the second CRISPR reaction mixed solution obtained in the step 3, and incubating for 30 minutes at 37 ℃; the judgment is made by the following method:

1. incubating and simultaneously detecting fluorescence through a fluorescence quantitative PCR instrument, or directly bathing in water and finally observing fluorescence change by naked eyes;

2. reading a fluorescence value under a FAM channel by using a qPCR instrument when CRISPR reaction incubation is started, incubating for 20 cycles at 37 ℃, wherein each cycle is separated by 2 minutes, and recording a fluorescence signal once at the end of each cycle, judging an N439K detection result through the final fluorescence signal intensity, wherein the fluorescence value is more than 3000 and represents N439K detection positive, the fluorescence value is less than 2000 and represents N439K detection negative, if the fluorescence value is between 2000 and 3000, detecting once again, and if the fluorescence value is still 2000 and 3000, judging that the N439K detection positive; if no fluorescence reading instrument such as qPCR is arranged on the site, the reaction tube can be placed under a transmission light source with the excitation wavelength of 485nm to observe the color change after the reaction is finished to determine the detection result; the reaction tube with positive detection of N439K will emit yellow green fluorescence, and the reaction tube with negative detection of N439K will not emit fluorescence.

The preferable technical scheme is as follows: the preparation method of the buffer A solution comprises the following steps: adding 50mmol of Tris buffer solution, 100nmol of potassium acetate, 20g of polyethylene glycol powder and 2mmol of dithiothreitol into 1L of water; the BufferB solution is a magnesium acetate solution with the concentration of 280 mM.

Due to the application of the technical scheme, compared with the prior art, the invention has the advantages that:

the invention has the advantages of high detection speed, high accuracy and lower cost.

Drawings

FIG. 1 is a schematic diagram of modes for discriminating SNPs of LwaCas13a and LwaCas 12 a.

FIG. 2 is a diagram of optimal primer screening for RT-RAA at position N439K.

Fig. 3N439K (G) crRNA design and screening map of Cas13 a.

Fig. 4N439K (a) crRNA design and screening map of Cas12 a.

Fig. 5N439K (G) crRNA validation map of Cas13 a.

Fig. 6N439K (a) crRNA validation map of Cas12 a.

Detailed Description

The following description of the embodiments of the present invention is provided for illustrative purposes, and other advantages and effects of the present invention will become apparent to those skilled in the art from the present disclosure.

Please refer to fig. 1-6. It should be understood that the structures, ratios, sizes, and the like shown in the drawings and described in the specification are for illustrative purposes only and are not intended to limit the scope of the present invention. The following examples are provided for a better understanding of the present invention, and are not intended to limit the invention. The experimental procedures in the following examples are conventional unless otherwise specified. The experimental materials used in the following examples were all purchased from a conventional biochemical reagent store unless otherwise specified.

Example 1: method and kit for detecting and screening N439K mutation of new coronavirus

A method for detecting and screening N439K mutation of new coronavirus, which comprises the following technical steps.

(1) Extraction of novel coronavirus nucleic acids

Immersing the specimen to be tested in a virus preserving fluid containing 2-3ml (isotonic saline solution can also be used), discarding the tail part, and screwing the tube cover. The sample should be extracted and detected as soon as possible, and the sample which can be detected within 24 hours can be stored at 4 ℃; samples that could not be detected within 24 hours should be stored at-70 ℃ or below. Nucleic acid extraction using RNA extraction kit

Mini Kit (QIAGEN, Cat No.74106) for example: mu.L of the virus preservation solution is taken and added with 350 mu.L of Buffer RLT to be blown and mixed evenly, and 550 mu.L of 70 percent absolute ethyl alcohol is added to precipitate the virus RNA. The resulting turbid suspension was centrifuged through a filter column at 12000rpm for 2min at 4 ℃. The impurities were eluted using Buffer RW1 followed by Buffer RPE, and finally 80. mu.L of RNase-free water was added to the adsorption column and the viral nucleic acids were eluted by centrifugation.

(2) RT-RAA primer design

RT-RAA (Reverse-Transcription-recombination-aid Amplification) is a Reverse Transcription-Recombinase mediated Amplification reaction. Namely, reverse transcriptase carries out reverse transcription on RNA into cDNA, and then the target fragment is amplified at 37 ℃ under the mediation of a plurality of recombinase and a specific RT-RAA primer. The RT-RAA reaction is the first step in the CRISPR detection method and plays a role in amplifying signals so as to improve the detection sensitivity.

The design of the RT-RAA primer follows the following principles: 1. the length of the primer is 30-35 bases; 2. the GC content of the primer is more than 30 percent and less than 70 percent; 3. the length range of the amplified product is between 100bp and 200 bp; 4. the amplified region requires a GC content of 40% < GC < 60% avoiding single repeat sequences as well as palindromic sequences. And 3 groups of RT-RAA primers at the upstream and the downstream are designed around the detection site, and the RT-RAA primers with the best amplification effect are screened out by using a complete CRISPR detection cleavage reaction.

The invention designs 3 groups of primers aiming at the N439K mutation of a novel coronavirus, and obtains an optimal amplification primer through final screening, wherein the sequences of the amplification primers of a Cas12a system and a Cas13a system are the same, and the difference is only that a T7 promoter recognition site (shown in capital letters) is added at the 5' end of an upstream primer of the Cas13a system for RNA transcription during CRISPR detection.

Cas13-439-for1：

5’-GAAATTAATACGACTCACTATAGGGcgctccagggcaaactggaaagattgctg-3’

Cas13-439-rev1：5’-aaggtttgagattagacttcctaaacaatc-3’

Cas12-439-for1：5’-cgctccagggcaaactggaaagattgctg-3’

Cas12-439-rev1：5’-aaggtttgagattagacttcctaaacaatc-3’

(3) RT-RAA nucleic acid amplification

And amplifying the extracted sample nucleic acid by using the Hangzhou mass RT-RAA nucleic acid amplification basic kit and a corresponding RT-RAA primer, and incubating for 20 minutes at 37 ℃. The specific operation steps are as follows:

a50 mu L RT-RAA amplification system is prepared by taking a reaction tube filled with protease freeze-dried powder, and sequentially adding 41.5 mu L buffer A solution (50mM Tris pH 7.9,100nM Potassium acetate (Potassium acetate), 5% polyethylene glycol (PEG), 2mM Dithiothreitol (DTT)), 2 mu L RT-RAA upstream primer (10 mu M), 2 mu L RT-RAA downstream primer (10 mu M) and 2 mu L nucleic acid to be detected into the reaction tube. mu.L of Buffer B solution (280mM Magnesium Acetate) was added to the cap, and the amplification reaction was initiated by removing the reaction tube immediately after the cap was closed. The reaction tube was incubated at 39 ℃ in a water bath for 20 minutes or directly held in the palm and incubated with body temperature for 20 minutes.

(4) Method for rapid SNP detection and screening of N439K mutation of novel coronavirus by configuring CRISPR reaction system

The invention designs 25 crRNAs for distinguishing and identifying N439K mutation of a novel coronavirus, 3 crRNAs for detecting N439K-A mutation by utilizing LwaCas 12a, 11 crRNAs for detecting N439K-A mutation by utilizing LwaCas13a and 11 crRNAs for detecting N439K-G mutation by utilizing LwaCas13 a. Of these 3 crrnas for mutation detection using LbaCas12a were designed by placing the mutation in the PAM region. 11 kinds of crRNAs for detecting mutation by using LwaCas13a are designed by combining the mutant bases at the 3 rd, 4 th and 6 th bases of the spacer and the artificial mismatch bases at the 2 nd, 3 rd, 4 th, 5 th and 6 th bases of the spacer corresponding to the crRNA. The N439K-A and N439K-G mutation sites were designed to have 22 crRNAs each. The strength of fluorescence signals when the crRNA sites are respectively detected for mutant strains and original strains is compared, and the designed crRNA sites are subjected to complete fluorescence cutting detection screening.

The final screening of 3 specific and sensitive crRNA sequences can be used for identifying and distinguishing N439K mutation, and the invention is disclosed as follows:

K1 crRNA:

5’-gauuuagacuaccccaaaaacgaaggggacuaaaacagaaucuuagaauuccaagcuauaacgc-3’

detection of N439K-G mutation using CRISPR/Cas13a system

P1 crRNA：

5’-gauuuagacuaccccaaaaacgaaggggacuaaaacagaauuuuagaauuccaagcuauaacgc-3’

Detection of N439K-A mutation using CRISPR/Cas13a system

B2 crRNA:

5’-uaauuucuacuaaguguagauagaauuccaagcuauaacgc-3’

Detection of N439K-A mutation using CRISPR/Cas12a system

The CRISPR reaction was configured with the components, volumes and concentrations as described in the following table:

the CRISPR Cas13a reaction mixture configuration system is as follows:

the CRISPR Cas12a reaction mixture configuration system is as follows:

RNA fluorescent probe: m is an oxymethyl modification at the 2-position, r is RNA.

5’-FAM-mArArUrGrGrCmAmArArUrGrGrCmA-BHQ1-3’；

DNA fluorescent probe:

5’-FAM-TTATTATT-BHQ1-3’。

the effect of the CRISPR reaction system on SNP detection is mainly embodied in specificity, namely the specific base recognition characteristic of the CRISPR system endows the CRISPR reaction system with the capability of carrying out SNP detection. The crRNA provided by the invention can effectively recognize the N439K mutation sequence and activate the corresponding Cas protein, and the fluorescence report probe around the cleavage shows that the N439K mutation detection is positive. While the crRNA was negative in detecting the original sequence without mutation because the base mismatch failed to activate the corresponding Cas protein, indicating that the N439K mutation was negative.

(5) Fluorescence detection and result reading of N439K mutation

Add 2. mu.L of nucleic acid amplification product to the prepared 18. mu.L of CRISPR reaction mixture and incubate at 37 ℃ for 30 minutes. The fluorescence can be detected by incubation with a fluorescent quantitative PCR instrument or by direct water bath and visual observation of the fluorescence change. According to different Cas proteases, the CRISPR reaction mixed liquor is divided into two kinds, namely CRISPR Cas13a reaction mixed liquor for mutation detection by using LwaCas13a effector protein and CRISPR Cas12a reaction mixed liquor for mutation detection by using LwaCas 12a effector protein.

Fluorescence values under FAM channels can be read at the beginning of CRISPR reaction incubation using a qPCR instrument (berle CFX96), incubated for 20 cycles at 37 ℃ with 2min intervals between each cycle, and the fluorescence signal recorded once at the end of each cycle. And judging the detection result of the N439K according to the final fluorescence signal intensity, namely judging that the detection result of the N439K is positive if the fluorescence value is more than 3000, the detection result of the N439K is negative if the fluorescence value is less than 2000, the detection result of the N439K is negative if the fluorescence value is between 2000 and 3000, and judging that the detection result of the N439K is positive if the fluorescence value is still 2000 and 3000. If no fluorescence reading instrument such as qPCR is arranged on site, the reaction tube can be placed under a transmission light source with the excitation wavelength of 485nm to observe color change after the reaction is finished, so as to determine the detection result. The reaction tube with positive detection of N439K will emit yellow green fluorescence, and the reaction tube with negative detection of N439K will not emit fluorescence.

The FAM channel is a fluorescence detection channel when a qPCR instrument reads fluorescence, and reads a fluorescence signal with the wavelength of 450nm-490 nm.

Establishment of N439K mutation detection method

1. Materials and methods

1.1 materials

The RT-RAA amplification primers, crRNA and single-stranded probes were synthesized by Nanjing Ongbenaceae and Nanjing Kingsry. RT-RAA nucleic acid based amplification kit was purchased from Hangzhou Mass testing Biometrics. LbaCas12a protein was purchased from NEB. The LwaCas13a protein was purchased from tsingsback bio-company. The pseudovirus containing the mutant sequence is obtained by packaging in a laboratory, or a company can be entrusted with packaging the pseudovirus containing the corresponding mutant sequence.

1.2 methods

1.2.1: design of RT-RAA primers

RT-RAA amplification primers of the N439K mutation site were designed according to the sequence of a new original strain of coronavirus (NC-045512.2) which has been published in GenBank. 3 pieces of upstream primers and 3 pieces of downstream primers are designed according to the design requirements of RT-RAA, and the specific sequences are as follows:

1.2.2 selection of RT-RAA optimal amplification primers:

a primer combination with the highest amplification efficiency is screened out through a complete RT-RAA-CRISPR Cas13a experiment, firstly, a Cas13a is designed to detect crRNA of a 439N original site, and the sequence is as follows:

5’-GAUUUAGACUACCCCAAAAACGAAGGGGACUAAAACUUGUUAGAAUUCCAA GCUAUAACG

CAGC-3’；N439K-crRNA0

the three pairs of upstream and downstream primers of RT-RAA are verified by using the crRNA, and 9 combinations are paired in pairs

And (3) verifying the amplification efficiency of each group of primers by using the new coronavirus S fragment RNA templates with different concentration gradients, and calculating the molecular weight according to the length of the RNA templates, wherein the copy number of the molecules is about 1.4 multiplied by 1011 cp/muL in a conversion mode of 50 ng/. mu.L of the RNA templates. It was diluted 10-fold to 1400, 140, 14, 1.4, 0.7 and 0 cp/. mu.L with gradients. Then, RT-RAA-CRISPR Cas13 cutting detection is used, amplification efficiency verification is carried out on 9 primer combinations in total according to the 6 concentration gradients, the amplification efficiency of the primers is judged according to fluorescence intensity, and finally a group of optimal amplification primers is selected.

1.2.3 design of LwaCas13a crRNA for detection of the N439K mutation

According to the N439K mutant strain sequence (EPI _ ISL _732451) published by the global shared influenza initiative (GISAID), the N439K mutation resulted in the 3 rd base of amino acid 439 of the S protein of the novel coronavirus from cytosine (C) to adenine (a) or guanine (G). The N439K mutation, namely the type of the base, is detected, and the LwaCas13a is used in the embodiment for detecting the mutation of N439K cytosine (C) to guanine (G) as an example.

The crRNA is a guide RNA, and consists of a fixed framework (scaffold) and a region (spacer) complementary to a target sequence, and the existing report Cas13a can tolerate the mismatching of one base on the spacer and successfully activate the spacer, so that when the N439K mutation is detected, under the condition that one mismatching exists, an artificial mismatching is additionally introduced on the spacer, namely, the crRNA can only recognize the mutant sequence but not the original sequence, so that the purpose of mutation typing is achieved. After comprehensively analyzing the spatial structure of the Cas13a protein when the protein and the crRNA act, aiming at the guanine (G) mutation of N439K (named as N439K (G)), the invention artificially introduces base mismatches in different regions of the spacer, and designs 11 crRNAs for subsequent screening. Specific sequences are shown in the following Table, and sequence display is shown in FIG. 3

TABLE 5

1.2.4 design of LbaCas12a crRNA for detection of the N439K mutation

The mutation of cytosine (C) to adenine (A) of N439K provides a PAM for the area to be specifically recognized by Cas12a, the PAM is a key sequence for recognition and activation of Cas12a, and 3 Cas12a crRNAs are designed for recognition of the N439K adenine (A) mutation according to the characteristic. The sequences are shown in the following table, and the sequences are shown in FIG. 4:

name (R)	Sequence 5 '-3'	Numbering
			Cas12-439-PAM1	uaauuucuacuaaguguagaugaauuccaagcuauaacgca	B1
Cas12-439-PAM2	uaauuucuacuaaguguagauagaauuccaagcuauaacgc	B2
			Cas12-439-PAM3	uaauuucuacuaaguguagauuagaauuccaagcuauaacg	B3

1.2.5 screening of crRNA efficiently discriminating N439K (G) Using the complete RT-RAA CRISPR Cas13a reaction

A pseudovirus mock virus mutation positive sample containing the N439K mutant sequence was used, and a pseudovirus containing the original sequence was used as a negative control. The 11 crRNAs designed above were screened with two pseudoviral samples at 100 cp/. mu.L. Cas13a crRNA which can detect N439K (G) mutation but can not detect 439N original sequence is screened out by fluorescence intensity detected by RT-RAA-CRISPR Cas13a cutting.

1.2.6 Using the complete RT-RAA CRISPR Cas12a reaction, crRNAs that effectively discriminate N439K (A) were screened.

A pseudovirus mock virus mutation positive sample containing the N439K mutant sequence was used, and a pseudovirus containing the original sequence was used as a negative control. The above designed 3 crRNAs were screened with two pseudoviral samples at 100 cp/. mu.L. The fluorescence intensity detected by RT-RAA-CRISPR Cas12a cleavage selected Cas12a crRNA that detected the N439K (a) mutation but not the 439N original sequence.

1.2.6 further validation of the selected crRNA

The screened crRNA is further verified to have effect by using 5 pseudovirus samples with different concentrations of 1400 cp/muL, 140 cp/muL, 14 cp/muL, 1.4 cp/muL and 0.7 cp/muL.

2. Results

2.1 selection of optimal amplification primers for RT-RAA at N439K site

The fluorescence intensities of the different primer groups are compared by the complete RT-RAA-CRISPR Cas13a cutting detection reaction of the nine RT-RAA primer combinations, and the fluorescence signals are collected by Berle CFX 96. As shown in FIG. 2, the combination of the primers F1+ R1(Cas13-439-for1+ Cas13-439-rev1) has the highest detection sensitivity, can stably detect the virus nucleic acid with the concentration of 0.7cp// mu L, and has the highest primer amplification efficiency, so the combination is selected as the optimal RT-RAA amplification primer.

2.2 CRISPR Cas13a CrRNA screening results for efficient discrimination of N439K (G)

Positive samples containing mutations and negative samples without mutations were used to screen for potent crRNA by RT-RAA-CRISPR Cas13a cleavage detection reaction. The concentration of the pseudovirus sample is 100 cp/. mu.L, two repeats are set, and nucleic acid is extracted by using a nucleic acid extraction kit. And isothermal amplification was performed using a mass-detection RT-RAA nucleic acid based amplification kit. Preparing an independent CRISPR reaction system for each crRNA, adding 2 mu L of RT-RAA amplification product into 18 mu L of CRISPR reaction system, incubating at 37 ℃ for 20 cycles, and collecting fluorescence through Brillo CFX96 in the whole incubation process. The mutation distinguishing capability of each crRNA is judged by comparing the fluorescence intensity of the mutant sample and the original sample. Cas13a crRNA K1 was able to efficiently detect the N439K (G) mutation without detecting the original template as shown in fig. 3.

2.3 CRISPR Cas12a CrRNA screening results for efficiently differentiating N439K (A)

Positive samples containing mutations and negative samples without mutations were used to screen for potent crRNA by RT-RAA-CRISPR Cas12a cleavage detection reaction. The concentration of the pseudovirus sample is 100 cp/. mu.L, two repeats are set, and nucleic acid is extracted by using a nucleic acid extraction kit. And isothermal amplification was performed using a mass-detection RT-RAA nucleic acid based amplification kit. Preparing an independent CRISPR reaction system for each crRNA, adding 2 mu L of RT-RAA amplification product into 18 mu L of CRISPR reaction system, incubating at 37 ℃ for 20 cycles, and collecting fluorescence through Brillo CFX96 in the whole incubation process. The mutation distinguishing capability of each crRNA is judged by comparing the fluorescence intensity of the mutant sample and the original sample. As shown in fig. 4, Cas12a crRNA B2 was able to efficiently detect the N439K (a) mutation without detecting the original template.

2.4 further validation of the differentiating Effect of Cas13a crRNA K1

The screened Cas13a crRNA K1 is further subjected to SNP discrimination verification. Two false viruses, mutation positive and mutation negative, were diluted to 1400cp/μ L, 140cp/μ L, 14cp/μ L, 1.4cp/μ L and 0.7cp/μ L, respectively. Multiple concentration gradients of the two sets of samples were detected by cleavage of the complete RT-RAA-CRISPR Cas13a, again verifying the SNP discrimination ability of crRNA K1. FIG. 5 shows that the crRNA K1 can effectively detect the N439K-G mutation at 1400cp/μ L, 140cp/μ L, 14cp/μ L, 1.4cp/μ L and 0.7cp/μ L, and the original template at the corresponding concentration shows that the detection is negative. After the reaction is finished, the reaction tube is placed under a 485nm transmission light source, so that the reaction tube of the mutant template can be observed to emit obvious yellow-green fluorescence, and the reaction hole of the original template has no fluorescence.

2.5 further validation of the differentiating Effect of Cas12a crRNA B2

Further SNP discrimination validation was performed on the screened Cas12a crRNA B2. Two false viruses, namely mutation positive virus and mutation negative virus, are respectively diluted to 14000 cp/mu L, 1400 cp/mu L, 140 cp/mu L, 14 cp/mu L and 7 cp/mu L in a gradient manner. Multiple concentration gradients of the two sets of samples were detected by complete RT-RAA-CRISPR Cas12a cleavage, again verifying the SNP discrimination ability of Cas12a crRNA B2. FIG. 6 shows that the crRNA B2 can effectively detect the N439K-A mutation at 14000cp/μ L, 1400cp/μ L, 140cp/μ L, 14cp/μ L and 7cp/μ L, and the original template with the corresponding concentration shows that the detection is negative. After the reaction is finished, the reaction tube is placed under a 485nm transmission light source, so that the reaction tube of the mutant template can be observed to emit obvious yellow-green fluorescence, and the reaction hole of the original template has no fluorescence.

FIG. 1: the principle of mutation detection by using CRISPR/Cas13a and CRISPR/Cas12a is shown respectively. I.e., the mutant strain is more matched with the guide rna (crrna), thereby activating the Cas protein for cleavage detection.

FIG. 2: the screening result of the RT-RAA primer at the N439K site is shown. The three groups of primers at the upstream and the downstream are pairwise matched to form 9 combinations, and the fluorescence intensity of each primer combination when detecting virus templates with different concentration gradients is shown in the figure. The screening result shows that the primer F1+ R1 has the best amplification effect.

FIG. 3: the first part of the base sequence diagram shows that 11 LwaCas13a are designed for distinguishing the crRNA with the N439K mutation. By artificially introducing base mismatch on crRNA, the Cas effector protein can be identified and activated when detecting mutant strains and cannot be identified when detecting original strains. The second part shows a screening effect graph of various crRNA detection mutations, and each designed crRNA is used for detecting an N439K mutant sample and an original strain sample respectively, and the detection effects of the mutations are compared. The screening result shows that the K1 crRNA has the strongest capacity of distinguishing the mutation.

FIG. 4: the first part base sequence diagram shows that 3 LbaCas12a were designed to distinguish between the N439K mutated crRNA. The mutation site is placed in the PAM recognition region of Cas12a, so that the Cas effector protein can be recognized and activated when detecting mutant strains, and cannot be recognized when detecting original strains. The second part shows a screening effect graph of various crRNA detection mutations, and each designed crRNA is used for detecting an N439K mutant sample and an original strain sample respectively, and the detection effects of the mutations are compared. The screening result shows that the B2 crRNA has the strongest capacity of distinguishing the mutation.

FIG. 5: further validation results for the selected K1 crRNA. The K1 crRNA and CRISPR/Cas13a system are used for detecting mutant strain samples with different concentration gradients and original strain samples, and the K1 crRNA can achieve a good mutation detection effect. The second panel shows that after the reaction is finished, the yellow-green fluorescence of the mutant group can be observed by naked eyes when the reaction tube is placed under 485nm exciting light.

FIG. 6: further validation results for the selected B2 crRNA. B2 crRNA and a CRISPR/Cas12a system are used for detecting mutant strain samples with different concentration gradients and original strain samples, and the result shows that the B2 crRNA can achieve a good mutation detection effect. The second panel shows that after the reaction is finished, the yellow-green fluorescence of the mutant group can be observed by naked eyes when the reaction tube is placed under 485nm exciting light.

Example 2: method and kit for detecting and screening N439K mutation of new coronavirus

A kit for detecting and screening a new coronavirus N439K mutation, the kit comprising:

two sets of RT-RAA amplification primers:

the RT-RAA upstream primer is as follows:

5’-GAAATTAATACGACTCACTATAGGGcgctccagggcaaactggaaagattgctg-3’；

or:

the RT-RAA upstream primer is as follows:

5’-cgctccagggcaaactggaaagattgctg-3’；

three CRISPR-specific detection crrnas:

K1 crRNA:

5’-gauuuagacuaccccaaaaacgaaggggacuaaaacagaaucuuagaauuccaagcuauaacgc-3’；

P1 crRNA：

5’-gauuuagacuaccccaaaaacgaaggggacuaaaacagaauuuuagaauuccaagcuauaacgc-3’；

B2 crRNA:

5’-uaauuucuacuaaguguagauagaauuccaagcuauaacgc-3’；

RNA fluorescent probe:

5’-FAM-mArArUrGrGrCmAmArArUrGrGrCmA-BHQ1-3’；

DNA fluorescent probe:

5’-FAM-TTATTATT-BHQ1-3’。

also comprises buffer A solution and buffer B solution; the preparation method of the buffer A solution comprises the following steps: adding 50mmol of Tris buffer solution, 100nmol of potassium acetate, 20g of polyethylene glycol powder and 2mmol of dithiothreitol into 1L of water; the BufferB solution is a magnesium acetate solution with the concentration of 280 mM.

Further comprising: HEPES buffer, MgCl₂Solution, 10 XNEB buffer2.1 buffer, RNase inhibitor, T7 RNA polymerase, RNase-free water.

A method for detecting and screening a new coronavirus N439K mutation, comprising the following steps:

step 1: immersing a sample to be detected in a virus preservation solution, and then performing nucleic acid extraction by using an RNA extraction kit to obtain nucleic acid to be detected; the sample to be tested is extracted from the door handle.

the RT-RAA upstream primer is as follows:

5’-GAAATTAATACGACTCACTATAGGGcgctccagggcaaactggaaagattgctg-3’；

or:

the RT-RAA upstream primer is as follows:

5’-cgctccagggcaaactggaaagattgctg-3’；

k1 crRNA: for detecting the N439K-G mutation;

5’-gauuuagacuaccccaaaaacgaaggggacuaaaacagaaucuuagaauuccaagcuauaacgc-3’；

p1 crRNA: for detecting the N439K-A mutation;

5’-gauuuagacuaccccaaaaacgaaggggacuaaaacagaauuuuagaauuccaagcuauaacgc-3’；

b2 crRNA: for detecting the N439K-A mutation;

5’-uaauuucuacuaaguguagauagaauuccaagcuauaacgc-3’；

RNA fluorescent probe:

DNA fluorescent probe:

5’-FAM-TTATTATT-BHQ1-3’；

The foregoing is illustrative of the preferred embodiment of the present invention and is not to be construed as limiting thereof in any way, and any modifications or variations thereof that fall within the spirit of the invention are intended to be included within the scope thereof.

Claims

1. A kit for detecting and screening N439K mutation of new coronavirus is characterized in that: the kit comprises:

two sets of RT-RAA amplification primers:

the RT-RAA upstream primer is as follows:

5’-GAAATTAATACGACTCACTATAGGGcgctccagggcaaactggaaagattgctg-3’；

or:

the RT-RAA upstream primer is as follows:

5’-cgctccagggcaaactggaaagattgctg-3’；

three CRISPR-specific detection crrnas:

K1 crRNA:

5’-gauuuagacuaccccaaaaacgaaggggacuaaaacagaaucuuagaauuccaagcuauaacgc-3’；

P1 crRNA：

5’-gauuuagacuaccccaaaaacgaaggggacuaaaacagaauuuuagaauuccaagcuauaacgc-3’；

B2 crRNA:

5’-uaauuucuacuaaguguagauagaauuccaagcuauaacgc-3’；

RNA fluorescent probe:

5’-FAM-mArArUrGrGrCmAmArArUrGrGrCmA-BHQ1-3’；

DNA fluorescent probe:

5’-FAM-TTATTATT-BHQ1-3’。

2. the kit for detecting and screening N439K mutation of new coronavirus according to claim 1, wherein: also comprises buffer A solution and buffer B solution; the preparation method of the buffer A solution comprises the following steps: adding 50mmol of Tris buffer solution, 100nmol of potassium acetate, 20g of polyethylene glycol powder and 2mmol of dithiothreitol into 1L of water; the BufferB solution is a magnesium acetate solution with the concentration of 280 mM.

3. The kit for detecting and screening N439K mutation of new coronavirus according to claim 1, wherein: further comprising: HEPES buffer, MgCl₂Solution, 10 XNEB buffer2.1 buffer, RNase inhibitor, T7 RNA polymerase, RNase-free water.

4. A method for detecting and screening N439K mutation of new coronavirus, which is characterized by comprising the following steps: comprises the following steps:

the RT-RAA upstream primer is as follows:

5’-GAAATTAATACGACTCACTATAGGGcgctccagggcaaactggaaagattgctg-3’；

or:

the RT-RAA upstream primer is as follows:

5’-cgctccagggcaaactggaaagattgctg-3’；

and step 3: preparing a first CRISPR reaction mixed solution: 0.4. mu.L of 1M HEPES buffer solution and 0.18. mu.L of 1M MgCl₂Mixing the solution, 0.8 mu L of rNTP mix with the concentration of 10uM, 2 mu L of LwaCas13a with the concentration of 63.2 ng/mu L, 1 mu L of RNase inhibitor with the concentration of 40U/mu L, 0.1 mu L of T7 RNA polymerase with the concentration of 50U/mu L, 0.5 mu L of K1 crRNA or P1 crRNA with the concentration of 10 ng/mu L, 0.2 mu L of RNA fluorescent probe with the concentration of 100uM and 12.82 mu L of RNase-free water; is configured asTwo CRISPR reaction mixtures: mu.L of LbaCas12a at a concentration of 1. mu.M, 1. mu.L of B2 crRNA at a concentration of 15 ng/. mu.L, 2. mu.L of 10 XNEB buffer2.1, 0.1. mu.L of DNA fluorescent probe at a concentration of 100. mu.M, and 12.9. mu.L of RNase-free water were mixed;

k1 crRNA: for detecting the N439K-G mutation;

5’-gauuuagacuaccccaaaaacgaaggggacuaaaacagaaucuuagaauuccaagcuauaacgc-3’；

p1 crRNA: for detecting the N439K-A mutation;

5’-gauuuagacuaccccaaaaacgaaggggacuaaaacagaauuuuagaauuccaagcuauaacgc-3’；

b2 crRNA: for detecting the N439K-A mutation;

5’-uaauuucuacuaaguguagauagaauuccaagcuauaacgc-3’；

RNA fluorescent probe:

DNA fluorescent probe:

5’-FAM-TTATTATT-BHQ1-3’；

5. The method for detecting and screening N439K mutation of new coronavirus according to claim 4, wherein the method comprises the following steps: the preparation method of the buffer A solution comprises the following steps: adding 50mmol of Tris buffer solution, 100nmol of potassium acetate, 20g of polyethylene glycol powder and 2mmol of dithiothreitol into 1L of water; the BufferB solution is a magnesium acetate solution with the concentration of 280 mM.