CN114015810B - Detection kit for simultaneous detection of coronavirus RNA double genes and identification of mutant strains - Google Patents

Abstract

The invention provides a detection kit for simultaneous detection of coronavirus RNA double genes and identification of mutant strains, which consists of a loop-mediated amplification reaction solution, an enzyme, a primer and detection probe mixed solution and a target sequence RNA standard substance. In the invention, target RNA is subjected to reverse transcription to generate a corresponding DNA chain, LAMP amplification is carried out in the presence of an amplification primer, and an amplification product is combined with a detection probe-Molecular Beacon (MB) or a strand displacement nucleic acid (OSD) to generate a fluorescent signal, thereby realizing target RNA detection. According to the invention, different fluorophores are used for marking the MB probe, so that two target genes can be simultaneously detected in the same system, and the target genes are used for simultaneously detecting the new coronavirus ORF1ab gene and the N gene; the identification of wild strain, Alpha variant strain and Delta variant strain of the new coronavirus is realized by marking OSD probes with different fluorescent groups for distinguishing spike protein (S) gene sequences with single-site base difference.

Description

Detection kit for simultaneous detection of coronavirus RNA double genes and identification of mutant strains

Technical Field

The invention belongs to the field of biotechnology, relates to a novel technology for detecting coronavirus RNA and identifying mutation, and particularly relates to an RNA detection kit for simultaneously detecting coronavirus RNA double genes and identifying mutant strains, which is based on reverse transcription loop-mediated isothermal amplification (RT-LAMP) for simultaneously detecting coronavirus RNA double genes and identifying different strains. Can provide judgment basis for early diagnosis of clinical new coronavirus infected patients and identification of different strains.

Background

Coronaviruses are RNA viruses having an envelope and a linear single-stranded positive strand genome, and are among the currently known RNA viruses, the largest genome. To date, approximately 15 different strains of coronavirus have been discovered, which are capable of infecting a wide variety of mammals and birds, some of which can cause illness in humans. Human coronavirus causes the common cold, severe acute respiratory syndrome and middle east respiratory syndrome in humans, and has certain differences in epidemiological characteristics.

The new type of coronavirus, named SARS-CoV-2, is a new strain of coronavirus that has never been found in humans before, and it has high infectivity and high stealth. The SARS-CoV-2 virus seriously threatens the personal safety of the people and hinders normal economic activities. As SARS-CoV-2 has a long latent period and is also infectious in the latent period, large-scale nucleic acid detection is just needed, and a detection kit with high detection speed, high sensitivity and strong specificity is urgently needed.

The SARS-CoV-2 virus detection kit includes mainly RT-qPCR method, colloidal gold immunity method, enzyme-linked immunity method, etc. these methods have their own advantages and also have some limitations. For example, the colloidal gold method (test paper) is used for virus antibody detection, is simple and quick to operate, can realize quick screening, but brings the problem of high false negative rate due to low sensitivity, and the enzyme-linked immunosorbent assay is restricted by instruments and sensitivity. The RT-qPCR method is used as a gold standard for detecting virus nucleic acid at present, has high requirements on detection environment and equipment, needs complex thermal cycling to be connected with denaturation, annealing and subsequent amplification extension, needs an expensive thermal cycling device, and has certain limitation on application in a resource-limited or instant detection platform.

The virus nucleic acid detection method based on isothermal nucleic acid amplification receives more and more attention in recent years, overcomes the limitations of some traditional methods, such as constant reaction temperature and no need of variable temperature cycle of PCR reaction, so that the requirements on experimental operation skills and instruments and equipment are low, a new space is opened for nucleic acid detection research, and the yield of nucleic acid amplification is improved. LAMP is a common isothermal nucleic acid amplification technology with high sensitivity, and the technology utilizes Bst DNA polymerase with strand displacement activity to identify and extend a target under a constant temperature condition, and can realize 10 minutes within 15-60 minutes ⁹ -10 ¹⁰ The amplification is multiplied, has the characteristics of high specificity, high sensitivity, simplicity, convenience and low cost, and is widely used for disease detection, food and cosmetic safety inspection and the like caused by various viruses, bacteria, parasites and the like.

Disclosure of Invention

The invention aims to provide an RNA detection kit for simultaneous detection of coronavirus RNA double genes and identification of mutant strains, which is an RNA detection kit for simultaneous detection of coronavirus RNA double genes and identification of mutant strains based on RT-LAMP, and comprises: the kit comprises a loop-mediated amplification reaction solution (magnesium sulfate, deoxyribonucleotide triphosphate, betaine, a mixture solution of Thermopol buffer and AMV RT buffer and the like), enzymes (Bst 2.0DNA polymerase and AMV reverse transcriptase), primers (ORF1ab gene, N gene primer and S gene amplification primer), a signal probe (ORF1ab gene and N gene are MB probes, different strains are identified as OSD probes) and a standard product (ORF1ab gene, N gene and S gene RNA samples of different strains), wherein the probe solution needs to be stored in a brown tube. Wherein the sequences of the primers and the signal probe are as follows:

the primers required for simultaneous detection of ORF1ab gene and N gene:

F3-ORF1ab

CAGCATTTCTTCACAAAGCT

B3-ORF1ab

ATGTAAAGTGCACATCAGTAG

FIP-ORF1ab

ACTGAAGCCTTTGAAAAAATGGTTTTAT GTCTACAGCACCCTG

BIP-ORF1ab

ACACATTGAGCCCACAATTTAGACTTACTCTCAGTTTTGCAACAA

F3-N

GCCAAAAGGCTTCTACGCA

B3-N

TTGCTCTCAAGCTGGTTCAA

FIP-N

TCCCCTACTGCTGCCTGGAGGCAGTCAAGCCTCTTCTCG

BIP-N

TCTCCTGCTAGAATGGCTGGCATCTGTCAAGCAGCAGCAAAG

ORF1ab gene and N gene are simultaneously detected by the required signal probe:

MB-ORF1ab-FAM

FAM-CACACCATACTTTCTGTTTTGCTTTCCATTGGTGTG-BHQ1

MB-N-NED

NED-AGCGGCTCTCATCACGTAGTCGCAACAGTAGCCGCT-BHQ2

primers for identifying S genes of different strains are as follows:

F3-S

CATGCAGATCAACTTACTCC

B3-S

TTTCTGCACCAAGTGACA

FIP-S

GCCCCTATTAAACAGCCTGCATGGCGTGTTTATTCTACAGG

BIP-S

ACCCATTGGTGCAGGTATATGCGGATTGACTAGCTACACTACG

signal probes required for identification of S genes of different strains:

OSD-F-wild type

NED-GCCCGCCGAGGAGAATTAGTCTGAGTCTGATAACTAG-Inverted dT

OSD-Q-wild type

AGACTAATTCTCCTCGGCGGGC-BHQ2

OSD-F-Delta

FAM-GCCCGCCGACGAGAATTAGTCTGAGTCTGATAACTAG-Inverted dT

OSD-Q-Delta

AGACTAATTCTCGTCGGCGGGC-BHQ1

the kit can be applied to high-throughput detection of SARS-CoV-2RNA of the novel coronavirus and is used for diagnosing patients infected by the novel coronavirus. The target RNA is subjected to RT-LAMP amplification in the presence of a primer and an enzyme in an RT-LAMP amplification reaction buffer system, the formed amplification product generates four stem-loop structures, the MB probe specifically identifies one of the stem-loop structures, the MB probe is opened to generate a fluorescent signal, and the fluorescent signal of the target product is detected by a real-time fluorescent quantitative PCR instrument, so that the target RNA is detected. The MB probe corresponding to ORF1ab gene adopts FAM as a fluorescent group, the MB probe corresponding to N gene adopts NED as a fluorescent group, and fluorescence signals are detected in two fluorescence channels, so that two target RNA genes in the same system are detected simultaneously.

The second application of the kit is to detect single base mutation of different mutant strains in the S gene of the SARS-CoV-2RNA sequence of the new coronavirus, and realize the identification of wild type strains, Alpha variant strains and Delta variant strains.

In order to achieve the purpose of high-throughput detection of ORF1ab and N genes in the same system at the same time, the invention adopts the technical scheme that:

(1) designing amplification primers F3, B3, FIP and BIP according to ORF1ab and the N gene sequence respectively;

(2) designing MB probes through a stem-loop structure sequence in an LAMP amplification product according to ORF1ab and an N gene sequence respectively, wherein two ends of the MB probe corresponding to ORF1ab gene are modified by FAM fluorescent group and BHQ1 quenching group respectively, and two ends of the MB probe corresponding to the N gene are modified by NED fluorescent group and BHQ2 quenching group respectively;

(3) target RNAs (ORF1ab and N) with known concentrations were diluted 10-fold in gradient to give a concentration of 10 ² copies/μL～10 ⁷ Performing RT-LAMP reaction on the solutions of copies/mu L in a real-time fluorescence quantitative PCR instrument, observing fluorescence signals in an FAM fluorescence channel and an NED fluorescence channel, and respectively establishing working curves of Ct value/target RNA concentration in the two channels;

in order to achieve the identification of wild strains, Alpha variant strains and Delta variant strains of the new coronavirus, the technical scheme adopted by the invention is as follows:

(1) designing amplification primers F3, B3, FIP and BIP according to an S gene sequence in a new coronavirus RNA sequence, and designing a mutation base to be detected between B1c and B2c regions;

(2) designing OSD probes F chains OSD-F-wild type and OSD-F-Delta which are completely complementary with the region according to the sequences between the wild strains and the Delta variant B1c and B2c regions, wherein the 5 'end of the OSD-F-wild type is modified by NED fluorescent group, the 5' end of the OSD-F-Delta is modified by FAM fluorescent group, and designing corresponding Q chains which are completely complementary with the OSD-F-wild type and the OSD-F-Delta according to the two probes;

(3) s gene RNA (wild type, Alpha and Delta) with known concentration is respectively diluted by 10 times in gradient to prepare the S gene RNA with the concentration of 10 ⁵ copies/μL～10 ⁷ Performing RT-LAMP reaction on the solution of copies/mu L in a real-time fluorescent quantitative PCR instrument, monitoring FAM and NED fluorescent channel signals, and observing fluorescent signals generated by amplification of S gene sequences corresponding to different strains;

the novel coronavirus RNA detection and different strain S gene identification kit provided by the invention needs to be stored at-20 ℃, and RNA standard products need to be stored at-80 ℃, so that repeated freeze thawing is reduced as much as possible; MB probe and OSD probe need to be preserved in dark condition.

The use method of the kit comprises the following steps: the method is used for simultaneously detecting the RNA double genes of the new coronavirus, a following standard curve is carried in each sample detection, and the RNA concentration is calculated by substituting the Ct value of the detected sample in a fluorescence quantitative PCR instrument into the standard curve. The fluorescent signal intensity of the sample in the two fluorescent channels is detected and compared with the fluorescent intensity of a standard substance, so that the S gene RNA of different strains of the new coronavirus can be distinguished.

Preparation of target RNA (plasmid DNA in vitro transcription)

(1) And (3) plasmid amplification: taking 50 mu L of target gene plasmid glycerol bacteria, adding 5mL of LB culture medium containing 100 mu g/mL ampicillin, shaking at 37 ℃ and 200rpm overnight, extracting plasmids according to the instructions of an endotoxin-free plasmid miniprep medium kit (TIANGEN, DP118), and measuring the concentration by using Nanodrop 2000;

(2) plasmid DNA restriction linearization: 20. mu.L of plasmid DNA at a concentration of 250 ng/. mu.L was taken, 10. mu.L of 10 XBuffer R, 10. mu.L of Eco 32I restriction enzyme and 60. mu.L of DEPC-treated water were added, and the mixture was pipetted and mixed, incubated overnight in a water bath at 37 ℃ and 20min in a water bath at 80 ℃ to inactivate the enzyme, and purification and recovery were instructed according to the general-purpose DNA purification recovery kit (TIANGEN, DP 214).

(3) In vitro transcription of linearized plasmid DNA into RNA and purification: the linearized plasmid DNA was quantified using NanoDrop 2000 and then

T7High Yield RNA Synthesis Kit (NEB, E2040) was transcribed in vitro by first taking 20. mu.L of linearized plasmid DNA (250 ng/. mu.L), adding 7.5. mu.L of 10 × reaction buffer, 7.5. mu.L ATP, 7.5. mu.L GTP, 7.5. mu.L UTP, 7.5. mu.L CTP, 10. mu. L T7 RNA Polymerase Mix and 32.5. mu.L DEPC treated water, pipetting the mixture, dispensing the mixture into PCR tubes, 20. mu.L each, placing the PCR tubes in a PCR gradient cycler, and incubating overnight at 37 ℃. The reaction solution was treated with DNase I RNase Free (Thermo Scientific, EN0521) to remove template DNA, and 100. mu.L of the in vitro transcription reaction solution was taken, 50. mu.L of 10 XDnase I buffer, 10. mu.L of DNase I (RNase-Free) and 340. mu.L of DEPC-treated water were added, and after being blown and mixed by a pipette, the mixture was incubated in a 37 ℃ water bath for 15min to remove template DNA. The reaction product was purified and recovered according to the instructions of the Monarch RNA clean Kit (NEB, T2050), and the concentration was measured by using NanoDrop 2000, and then the reaction product was separatedThe PCR tube was filled and kept at-80 ℃ for further use.

The detection of the new coronavirus RNA double genes simultaneously:

the total reaction volume was 25. mu.L, 5. mu.L of target RNA (ORF1ab and N), 2.8. mu.L dNTP (10mmol/L), 1. mu.L of F3/B3 and FIP/BIP primer mixture of ORF1ab gene, 1. mu.L of F3/B3 and FIP/BIP primer mixture of L N gene, and 1.2. mu.L of DEPC-treated water, heated at 65 ℃ for 3min, and allowed to stand on ice for 2 min. It was then added to a buffer containing 2.5. mu.L of 10 XThermoPol buffer, 1.25. mu.L of 10 XAMV reverse transcription buffer, 6. mu.L of betaine (5mol/L), 0.3. mu.L of MgSO 2 ₄ (100mmol/L), 0.4. mu.L AMV reverse transcriptase (10U/. mu.L), 0.75. mu.L Bst 2.0DNA polymerase (8U/. mu.L), 1.25. mu.L MB-ORF1ab-FAM probe (2. mu. mol/L), 1.25. mu.L MB-N-NED probe (8. mu. mol/L) and 0.3. mu.L DEPC treated water were incubated isothermally at 54 ℃ on a 7500fast fluorescence quantitative PCR instrument, and data were collected for 30s every 2.5min for 60 cycles.

Identifying and detecting S genes of different strains of the new coronavirus:

the total reaction volume was 25. mu.L, 5. mu.L of S gene RNA of different strains (wild type, or Alpha variant, or Delta variant), 2.8. mu.L dNTP (10mmol/L), 1. mu. L S gene F3/B3 and FIP/BIP primer mixture, and 2.2. mu.L of DEPC-treated water, heated at 65 ℃ for 3min, and left on ice for 2 min. It was then added to a buffer containing 2.5. mu.L of 10 × ThermoPol buffer, 1.25. mu.L of 10 × AMV reverse transcription buffer, 6. mu.L of betaine (5mol/L), 0.3. mu.L of MgSO 2 ₄ (100mmol/L), 0.4. mu.L AMV reverse transcriptase (10U/. mu.L), 0.75. mu.L Bst 2.0DNA polymerase (8U/. mu.L), 0.5. mu.L OSD-Delta-FAM probe (F chain concentration 600nmol/L, Q chain concentration 1.2. mu. mol/L), 1. mu.L OSD-wild type-NED probe (F chain concentration 600nmol/L, Q chain concentration 1.2. mu. mol/L) and 1.3. mu.L DEPC treated water, incubated isothermally at 58 ℃ on a 7500fast fluorescence quantitative PCR instrument, data were collected for 30s every 2.5min for 60 cycles.

Fluorescent quantitative results report (two-gene simultaneous assay): establishing a standard curve by using Ct values detected by two corresponding fluorescence channels of two target RNA standards with different concentrations in the kit and the target RNA concentration as a sample quantitative standard. And secondly, detecting the Ct value of the sample, and calculating the concentration of target RNA corresponding to different fluorescence channels in the sample to be detected according to the standard curves obtained by the two fluorescence channels.

Fluorescence intensity results report (different strain identification assay): the fluorescence intensity detected by two fluorescence channels of S gene RNA standard products of different strains (wild strains, Alpha variants and Delta variants) in the kit is used as the fluorescence intensity standard of S gene RNA of different strains. And secondly, detecting the fluorescence intensity of the sample in the two fluorescence channels, and identifying the strain S gene in the sample to be detected according to the obtained fluorescence intensity of the standard substance in the two fluorescence channels.

The invention provides a kit for simultaneously detecting new coronavirus SARS-CoV-2RNA double genes by a double fluorescence channel detection method based on RT-LAMP technology, which is a high-throughput and high-sensitivity new coronavirus SARS-CoV-2RNA detection technology, in order to overcome the problems of complexity, long time consumption and the like of the existing detection method. The invention also provides a simple and convenient identification technology of S gene RNA of different strains, namely a kit for identifying S gene RNA of different strains by double fluorescence channel detection based on RT-LAMP technology. The kit is a product which has high sensitivity, high flux, short detection time, simple and convenient operation and is suitable for popularization.

FIG. 1 is a schematic diagram of the in vitro transcription of plasmid DNA into target RNA in the kit.

FIG. 2 is a schematic diagram of the simultaneous detection of two genes in the kit.

FIG. 3 is a schematic diagram of the identification and detection of mutant strains in the kit.

FIG. 4 shows the selectivity of RT-LAMP-MB method in the kit for detection of different genes (a: ORF1ab gene FAM fluorescence channel selectivity, b: N gene NED fluorescence channel selectivity, c: Ct value of each fluorescence channel of double genes).

FIG. 5 shows the selectivity of RT-LAMP-OSD method in the kit for detecting S gene RNA of three different strains (a: FAM fluorescence channel; b: NED fluorescence channel).

FIG. 6 shows a standard curve and an amplification curve for simultaneous detection of RNA of two genes by RT-LAMP-MB method in the kit (a, b: ORF1ab gene; c, d: N gene).

FIG. 7 is a comparison of RT-LAMP-OSD method and classical RT-qPCR method standard curve in the kit (a: ORF1ab gene; b: N gene).

Detailed Description

The invention will be further elucidated by means of specific embodiments, which are only illustrative and not limiting of the scope of the invention, in conjunction with the accompanying drawings.

Example 1

An RNA detection kit for simultaneous detection of coronavirus RNA double genes and identification of mutant strains based on RT-LAMP. The kit comprises: the loop-mediated amplification reaction solution (magnesium sulfate, deoxyribonucleotide triphosphate, betaine, a mixed solution of Thermopol b buffer solution and AMV RT buffer solution and the like), enzyme (Bst 2.0DNA polymerase and AMV reverse transcriptase), primers (ORF1ab gene, N gene primer and S gene amplification primer), a signal probe (ORF1ab gene and N gene are MB probe and mutant strain is identified as OSD probe) and a standard product (ORF1ab gene, N gene and different mutant strain S gene RNA samples), and the probe solution needs to be stored in a brown tube.

The kit for simultaneously detecting the RNA double genes of the new coronavirus based on the RT-LAMP-MB probe double-fluorescence channel detection method adopts MB probes modified by different fluorescent groups, so that the concentration of two target RNAs is simultaneously detected in the same system. Selecting ORF1ab and N gene RNA as detection objects as examples, selecting a section of sequence of target RNA, respectively designing two sets of LAMP primers F3/B3 and FIP/BIP, when the target RNA appears, combining the two sets of LAMP primers with respective corresponding RNA respectively, and carrying out reverse transcription under the action of AMV reverse transcriptase to generate a character-complementary DNA chain and a dumbbell-shaped amplicon with stem-loop structures at two ends. The DNA strands and amplicons were further combined with FIP/BIP primers, driven by Bst 2.0DNA polymerase with strand displacement activity to initiate DNA synthesis, form new hairpin structures and extend, undergoing cyclic amplification and strand displacement processes, and finally producing cauliflower-like DNA products containing repetitive sequences and multiple loops (fig. 2). These amplicon sequences having many stem-loop structures can be divided into four types, one stem-loop structure is selected as the recognition unit (ORF1ab gene is B1-B2c-B1c loop, N gene is F1-F2c-F1c loop), and MB probe is designed according to the base on the stem-loop structure. When no RT-LAMP amplification product is generated, the bases of the stem sequence of the MB probe are complemented to form a stem-loop structure, the fluorescent group and the quenching group are close to each other, and the fluorescent signal is quenched. With the continuous generation of the amplification product of the stem-loop structure along with the RT-LAMP reaction, when the stem-loop structure in the amplification product is complementarily matched with the loop sequence base of the signal probe, the MB signal probe is opened, the fluorescent group and the quenching group are separated to generate a fluorescent signal, the quantitative detection of the amplification product is realized, and the MB signal probe has high selectivity and can distinguish the single nucleotide base difference. Wherein one end of the MB probe corresponding to ORF1ab gene is modified by FAM fluorophore, the other end is modified by BHQ1 quenching group, one end of the MB probe corresponding to N gene is modified by NED fluorophore, and the other end is modified by BHQ2 quenching group. The detection reaction of the two genes is carried out in the same system, the two genes can be simultaneously detected by respectively detecting the fluorescent signals of FAM and NED channels, and the method has the characteristic of high flux.

The kit for identifying and detecting the three strains of the new coronavirus based on an RT-LAMP-OSD probe two-channel detection method comprises the following steps: and modifying the F chains of the OSD probes corresponding to the two RNAs by using the two fluorescent groups respectively, so as to realize the discrimination of different strains by detecting fluorescent signals in the two fluorescent channels. In the experiment, SARS-CoV-2 virus S gene is taken as a research object, and single base difference of P681 sites in S genes of different strains is detected, so that identification of different strains is realized, and the method is mainly used for identifying wild strains and Delta variant strains. As shown in figure 3, specific primers are designed aiming at the P681 locus of SARS-CoV-2 virus, the locus sequence is designed to the position where the stem-loop structure product is complementary with the F chain, the stem-loop structure product with base difference is generated after LAMP amplification, the base of the locus of the wild strain is C, the Alpha variant is A, and the Delta variant is G. According to the difference, a specific OSD probe with single base difference is designed, wherein the F chain of the OSD probe which is completely complementary with the wild type strain RT-LAMP product in the region is modified by NED fluorescent group, and the F chain of the OSD probe which is completely complementary with the Delta variant strain RT-LAMP product is modified by FAM fluorescent group, and different fluorescence intensity is generated due to different efficiency of opening the OSD probe caused by the single base difference. The wild strain S gene sequence with the strongest fluorescence intensity of the NED channel is Alpha and Delta, the lower two are Alpha variant S gene sequences, the lower two are Alpha variant and wild strain S gene sequences, and the blank sample does not generate signals in the two channels. Therefore, the RT-LAMP-OSD probe fluorescence channel detection method can realize the identification of three mutant strains on the fluorescence intensity by identifying the single base difference on the stem-loop structure in the amplification products of S gene sequences of different strains and simultaneously detecting fluorescence signals in two channels of FAM and NED, and is particularly used for identifying wild strains and Delta variant strains.

The sequences of an external primer, an internal primer, an MB probe and an OSD probe of the coronavirus RNA double-gene simultaneous detection and mutant strain identification RNA detection kit based on the RT-LAMP method are as follows:

the primers required for simultaneous detection of ORF1ab gene and N gene:

F3-ORF1ab

CAGCATTTCTTCACAAAGCT

B3-ORF1ab

ATGTAAAGTGCACATCAGTAG

FIP-ORF1ab

ACTGAAGCCTTTGAAAAAATGGTTTTAT GTCTACAGCACCCTG

BIP-ORF1ab

ACACATTGAGCCCACAATTTAGACTTACTCTCAGTTTTGCAACAA

F3-N

GCCAAAAGGCTTCTACGCA

B3-N

TTGCTCTCAAGCTGGTTCAA

FIP-N

TCCCCTACTGCTGCCTGGAGGCAGTCAAGCCTCTTCTCG

BIP-N

TCTCCTGCTAGAATGGCTGGCATCTGTCAAGCAGCAGCAAAG

ORF1ab gene and N gene are simultaneously detected by the required signal probe:

MB-ORF1ab-FAM

FAM-CACACCATACTTTCTGTTTTGCTTTCCATTGGTGTG-BHQ1

MB-N-NED

NED-AGCGGCTCTCATCACGTAGTCGCAACAGTAGCCGCT-BHQ2

primers for identifying S genes of different strains are as follows:

F3-S

CATGCAGATCAACTTACTCC

B3-S

TTTCTGCACCAAGTGACA

FIP-S

GCCCCTATTAAACAGCCTGCATGGCGTGTTTATTCTACAGG

BIP-S

ACCCATTGGTGCAGGTATATGCGGATTGACTAGCTACACTACG

different strains recognize the required signal probes:

OSD-F-wild type

NED-GCCCGCCGAGGAGAATTAGTCTGAGTCTGATAACTAG-Inverted dT

OSD-Q-wild type

AGACTAATTCTCCTCGGCGGGC-BHQ2

OSD-F-Delta

FAM-GCCCGCCGACGAGAATTAGTCTGAGTCTGATAACTAG-Inverted dT

OSD-Q-Delta

AGACTAATTCTCGTCGGCGGGC-BHQ1

the kit for detecting the RNA of the novel coronavirus and identifying S genes of different strains needs to be stored at the temperature of-20 ℃, and the RNA standard substance needs to be stored at the temperature of-80 ℃, so that repeated freeze thawing is reduced as much as possible; MB probe and OSD probe need to be preserved in dark condition.

Example 2

1. Materials and methods

1.1 primers and probes

The primers required for simultaneous detection of ORF1ab gene and N gene:

F3-ORF1ab

CAGCATTTCTTCACAAAGCT

B3-ORF1ab

ATGTAAAGTGCACATCAGTAG

FIP-ORF1ab

ACTGAAGCCTTTGAAAAAATGGTTTTAT GTCTACAGCACCCTG

BIP-ORF1ab

ACACATTGAGCCCACAATTTAGACTTACTCTCAGTTTTGCAACAA

F3-N

GCCAAAAGGCTTCTACGCA

B3-N

TTGCTCTCAAGCTGGTTCAA

FIP-N

TCCCCTACTGCTGCCTGGAGGCAGTCAAGCCTCTTCTCG

BIP-N

TCTCCTGCTAGAATGGCTGGCATCTGTCAAGCAGCAGCAAAG

ORF1ab gene and N gene are simultaneously detected by the required signal probe:

MB-ORF1ab-FAM

FAM-CACACCATACTTTCTGTTTTGCTTTCCATTGGTGTG-BHQ1

MB-N-NED

NED-AGCGGCTCTCATCACGTAGTCGCAACAGTAGCCGCT-BHQ2

primers for identifying S genes of different strains are as follows:

F3-S

CATGCAGATCAACTTACTCC

B3-S

TTTCTGCACCAAGTGACA

FIP-S

GCCCCTATTAAACAGCCTGCATGGCGTGTTTATTCTACAGG

BIP-S

ACCCATTGGTGCAGGTATATGCGGATTGACTAGCTACACTACG

signal probes required for identification of S genes of different strains:

OSD-F-wild type

NED-GCCCGCCGAGGAGAATTAGTCTGAGTCTGATAACTAG-Inverted dT

OSD-Q-wild type

AGACTAATTCTCCTCGGCGGGC-BHQ2

OSD-F-Delta

FAM-GCCCGCCGACGAGAATTAGTCTGAGTCTGATAACTAG-Inverted dT

OSD-Q-Delta

AGACTAATTCTCGTCGGCGGGC-BHQ1

1.2 in vitro transcription of plasmid DNA into RNA

(1) And (3) plasmid amplification: taking 50 mu L of target gene plasmid glycerol bacteria, adding 5mL of LB culture medium containing 100 mu g/mL ampicillin, shaking at 37 ℃ and 200rpm overnight, extracting plasmids according to the instructions of an endotoxin-free plasmid miniextract medium kit (TIANGEN, DP118), and measuring the concentration by using Nanodrop 2000;

(2) plasmid DNA restriction linearization: 20. mu.L of plasmid DNA at a concentration of 250 ng/. mu.L was taken, 10. mu.L of 10 XBuffer R, 10. mu.L of Eco 32I restriction enzyme and 60. mu.L of DEPC-treated water were added, and the mixture was pipetted and mixed, incubated overnight in a water bath at 37 ℃ and 20min in a water bath at 80 ℃ to inactivate the enzyme, and purification and recovery were instructed according to the general-purpose DNA purification recovery kit (TIANGEN, DP 214).

(3) In vitro transcription of linearized plasmid DNA into RNA and purification: the linearized plasmid DNA was quantified using NanoDrop 2000 and then

T7High Yield RNA Synthesis Kit (NEB, E2040) was transcribed in vitro by first taking 20. mu.L of linearized plasmid DNA (250 ng/. mu.L), adding 7.5. mu.L of 10 × reaction buffer, 7.5. mu.L ATP, 7.5. mu.L GTP, 7.5. mu.L UTP, 7.5. mu.L CTP, 10. mu. L T7 RNA Polymerase Mix and 32.5. mu.L DEPC treated water, pipetting the mixture, dispensing into PCR tubes, 20. mu.L each, placing in a PCR gradient cycler, and incubating overnight at 37 ℃. The reaction solution was treated with DNase I RNase Free (Thermo Scientific, EN0521) to remove template DNA, and 100. mu.L of the in vitro transcription reaction solution was first taken, added with 50. mu.L of 10 XDnase I buffer, 10. mu.L of DNase I (RNase-Free) and 340. mu.L of DEPC-treated water, pipetted and mixed well, and incubated in a 37 ℃ water bath for 15min to remove template DNA. The reaction product was purified and recovered according to the instructions of the Monarch RNA clean Kit (NEB, T2050), the concentration was measured with NanoDrop 2000, and the reaction product was dispensed into a PCR tube and kept at-80 ℃ for further use. The principle of in vitro transcription of plasmid DNA into target RNA is shown in FIG. 1.

1.2 optimization of the Experimental conditions

According to the requirements of experiments, the method optimizes the experimental conditions of LAMP primer concentration, dNTP concentration, Betaine concentration, Mg2+ concentration, AMV reverse transcriptase enzyme amount, Bst 2.0DNA polymerase enzyme amount, MB probe concentration, RT-LAMP-MB method amplification temperature and the like in the experiments to establish the optimal detection method. We evaluated each experimental parameter by the Δ Ct value (Ct negative control-Ct sample), taking the maximum value of Δ Ct as the optimal experimental condition.

In order to enable fluorescent signals of amplification products of S gene sequences of wild strains, Alpha and Delta variant strains to achieve the maximum distinguishing effect and identify the sequences and blank samples, OSD probe concentration and amplification reaction temperature are optimized, the Ct value of an RT-LAMP-OSD method amplification curve and the fluorescence difference value of different sequence amplification curves are influenced by changing experimental conditions, the influence of the change of the experimental conditions on the two parameters is comprehensively considered, and the most appropriate experimental conditions are searched.

1.3 determination of two RNA standards

The mixed solution of ORF1ab and N gene RNA standard was diluted to different concentrations, i.e., 10 ² copies/μL、10 ³ copies/μL、10 ⁴ copies/μL、10 ⁵ copies/μL、10 ⁶ copies/μL、10 ⁷ And (3) performing RT-LAMP-MB double fluorescence channel detection by using the kit for copies/mu L, and drawing a standard curve by taking the logarithmic value of the target RNA concentration as the abscissa and the Ct value as the ordinate.

1.4 identification of S gene RNA standard of three different strains of new coronavirus

Respectively diluting S gene RNA standard substances of wild strains, Alpha variant strains and Delta variant strains to different concentrations, namely 10 ⁵ copies/μL、10 ⁶ copies/μL、10 ⁷ And (3) performing RT-LAMP-OSD double fluorescence channel detection by using the kit for copies/mu L, and drawing an amplification curve by taking the abscissa as detection time and the ordinate as fluorescence signal intensity detected by a corresponding channel.

2 results

2.1 Simultaneous detection reaction System and reaction conditions for RNA double genes of New coronavirus

The total reaction volume was 25. mu.L, 5. mu.L of target RNA (ORF1ab and N), 2.8. mu.L dNTP (10mmol/L), 1. mu.L of F3/B3 and FIP/BIP primer mixture of ORF1ab gene, 1. mu.L of F3/B3 and FIP/BIP primer mixture of L N gene, and 1.2. mu.L of DEPC-treated water, heated at 65 ℃ for 3min, and allowed to stand on ice for 2 min. This was then added to a solution containing 2.5. mu.L of 10 XThermoPol buffer, 1.25. mu.L of 10 XAMV reverse transcription buffer, 6. mu.L of betaine (5mol/L), 0.3. mu.L of MgSO4(100mmol/L), 0.4. mu.L of AMV reverse transcriptase (10U/. mu.L), 0.75. mu.L of Bst 2.0DNA polymerase (8U/. mu.L), 1.25. mu.L of MB-ORF1ab-FAM probe (2. mu. mol/L), 1.25. mu.L of MB-N-NED probe (8. mu. mol/L) and 0.3. mu.L of DEPC treated water, incubated isothermally at 54 ℃ on a 7500fast fluorogenic quantitative PCR instrument, data were collected for 30s at 2.5min intervals, for 60 cycles.

2.2 identification and detection reaction system and reaction conditions for S genes of different strains of the novel coronavirus

The total reaction volume was 25. mu.L, 5. mu.L of S gene RNA of different strains (wild type, or Alpha variant, or Delta variant), 2.8. mu.L dNTP (10mmol/L), 1. mu. L S gene F3/B3 and FIP/BIP primer mixture, and 2.2. mu.L of DEPC-treated water, heated at 65 ℃ for 3min, and left on ice for 2 min. This was then added to a solution containing 2.5. mu.L of 10 × ThermoPol buffer, 1.25. mu.L of 10 × AMV reverse transcription buffer, 6. mu.L of betaine (5mol/L), 0.3. mu.L of MgSO4(100mmol/L), 0.4. mu.L of AMV reverse transcriptase (10U/. mu.L), 0.75. mu.L of Bst 2.0DNA polymerase (8U/. mu.L), 0.5. mu.L of OSD-Delta-FAM probe (600 nmol/L F chain concentration, 1.2. mu. mol/L Q chain concentration), 1. mu.L of OSD-wild type-NED probe (600 nmol/L F chain concentration, 1.2. mu. mol/L Q chain concentration) and 1.3. mu.L of DEPC treated water, and isothermal incubation was carried out at 58 ℃ on a 7500fast quantitative PCR instrument, and data was collected at 30s intervals for 2.5min for 60 cycles.

2.3 Selectivity experiments

The method provided by the invention takes ORF1ab gene and N gene RNA sequences as target RNAs for detection. Therefore, the experiments selectively examined the genomic DNA, the total cellular RNA and the MERS1a, MERS1b and NRP2 genes for detecting the interference of the target RNA by the method. The selectivity of the RT-LAMP-MB method was analyzed by Ct value under the conditions of ORF1ab and N concentration of 105 copies/. mu.L, and 3 replicates of each sample were tested. As shown in FIG. 4, the Ct values of the samples containing the target RNA were about 25 for ORF1ab, about 40 for N, and about 60 for the samples containing no target RNA. The established method is shown to be capable of effectively distinguishing MERS1a, MERS1b and NRP2, and the results of genomic DNA and cell total RNA also show that the method has stronger matrix interference resistance.

The RT-LAMP-OSD double-fluorescence detection channel method established by the invention uses S gene RNA sequences of S-Alpha, S-wild type and S-Delta strains as target RNA to identify three strains on the instrumentAnd (5) detecting an experiment. Thus, the concentration was 10 in each experiment ⁶ RNA sequences of S genes of different mutant strains of copies/. mu.L are added into a reaction system containing two OSD probes to explore the identification effect of the OSD probes on different strains in different fluorescence channels. As shown in FIG. 5, in FAM channel, the fluorescence value of the S gene RNA sequence of Delta variant strain is the highest, and is much higher than that of Alpha and wild strain, while the fluorescence value of blank sample is almost zero. The NED channel results show that the wild strain S gene RNA sequence has the highest fluorescence value which is far higher than that of Alpha and Delta variant strains, and the fluorescence value of blank samples is almost equal to zero. The result indicates that the detection method can not only identify wild strains and Delta variant strains, but also have certain distinguishing effect on Alpha variant strains, and a blank sample does not interfere with the detection result.

Respectively preparing the total concentration of 10 ⁷ copies/μL、10 ⁶ copies/. mu.L and 10 ⁵ The copies/. mu.L of S-Alpha, S-wild type and S-Delta solution are added into an RT-LAMP-OSD reaction system containing two OSD probes. Because the RT-LAMP amplification reaction can be continuously carried out at constant temperature until dNTP or primers are completely consumed, the quantities of the final RT-LAMP amplification products are theoretically consistent under the dNTP and the primers with the same concentration, and the fluorescence intensities of the final amplification products are basically the same for S genes of the same strain and samples with different concentrations. In the RT-LAMP-OSD double-fluorescence-channel detection method, the identification of the S genes of different strains in the two fluorescence detection channels is only related to the final fluorescence intensity and is not related to the initial concentration of a sample.

2.4ORF1ab and establishment of standard curve for N gene RNA detection

The mixed solution of ORF1ab and N gene RNA standard was diluted to different concentrations, i.e., 10 ² copies/μL、10 ³ copies/μL、10 ⁴ copies/μL、10 ⁵ copies/μL、10 ⁶ copies/μL、10 ⁷ And (3) performing RT-LAMP-MB double fluorescence channel detection by using the kit for copies/mu L, and drawing a standard curve by taking the logarithmic value of the target RNA concentration as the abscissa and the Ct value as the ordinate. RT-LAMP-MB double-fluorescence-channel detection method for simultaneously quantifying ORF1ab gene RNA and N gene RNAThe amplification curves of (A) are shown in FIG. 6. from the results we can see that the amplification curves for different concentrations of RNA are well separated. ORF1ab and N Gene RNA concentration at 10 ² copies/μL～10 ⁷ In the copies/. mu.L range (FIG. 6), the standard curve is very linear (ORF1ab gene, R) ² 0.9869; n gene: r is ² 0.9900). The established reverse transcription-loop-mediated isothermal amplification-MB double-fluorescence channel detection method can realize the quantitative detection of the concentration of the target RNA by measuring the Ct value of a sample.

Example 3

Detection of RNA simulation samples of ORF1ab and N genes with different concentrations obtained by plasmid reverse transcription

The RNA concentration of the mock sample was set to a quantitative lower limit of 100 copies/. mu.L and a low concentration of 5X 10 ³ copies/. mu.L, medium concentration 5X 10 ⁵ copies/. mu.L and high concentration 5X 10 ⁷ And (4) determining the delta Ct value of the RNA sample with each concentration by taking the sample without the target RNA as a negative control, detecting 5 samples in parallel at each concentration, and substituting the samples into a standard curve to calculate the determined RNA concentration of the sample. The precision of the detection method of the kit is 16.99%, 17.25%, 14.11% and 12.1% respectively at the lower limit of quantification and the low, medium and high concentrations of ORF1ab, the accuracy is 89.62%, 120%, 93.96% and 102.89%, the precision is 3.72%, 14.16%, 3.16% and 19.18% respectively at the lower limit of quantification and the low, medium and high concentrations of N sequence, and the accuracy is 84.24%, 109.38%, 114.96% and 86.38%. Reference "The MIQE Guidelines: the kit has the advantages of high precision and accuracy and can be used as a detection kit for coronavirus RNA.

Example 4

The quantitative detection method of the kit is compared with the RT-qPCR method

The RT-LAMP-MB dual-fluorescence channel detection method is compared with a linear RT-qPCR method, Ct values of target RNAs with series concentrations are determined under the optimal experimental condition, a standard curve is drawn by taking the logarithm of the target RNA concentration as an abscissa x and the Ct values as an ordinate y, and each sample is parallelly detected by 3 parts.

The experimental results are shown in FIG. 7, where the Ct values of both RNA detection methods and the target RNA concentration show a negative correlation trend. The linear range of RT-LAMP-MB double-fluorescence channel detection method for ORF1ab and N gene RNA detection is 10 ² copies/μL～10 ⁷ copies/mu L, up to 6 orders of magnitude, R detected by ORF1ab gene RNA ² 0.9869, R of N Gene RNA assay ² The detection range of the classical RT-qPCR method is 10 under 0.9900 ³ copies/μL～10 ⁷ copies/. mu.L, up to 5 orders of magnitude. The invention finds a high-flux RT-LAMP method for simultaneously detecting two different gene RNAs by two channels, and obtains a better detection result.

Sequence listing

<110> Zhejiang university

<120> detection kit for simultaneous detection of coronavirus RNA double genes and identification of mutant strains

<160> 18

<170> SIPOSequenceListing 1.0

<210> 1

<211> 20

<212> DNA

<213> Artificial sequence (Unknow)

<400> 1

cagcatttct tcacaaagct 20

<210> 2

<211> 21

<212> DNA

<213> Artificial sequence (Unknow)

<400> 2

atgtaaagtg cacatcagta g 21

<210> 3

<211> 43

<212> DNA

<213> Artificial sequence (Unknow)

<400> 3

actgaagcct ttgaaaaaat ggttttatgt ctacagcacc ctg 43

<210> 4

<211> 45

<212> DNA

<213> Artificial sequence (Unknow)

<400> 4

acacattgag cccacaattt agacttactc tcagttttgc aacaa 45

<210> 5

<211> 19

<212> DNA

<213> Artificial sequence (Unknow)

<400> 5

gccaaaaggc ttctacgca 19

<210> 6

<211> 20

<212> DNA

<213> Artificial sequence (Unknow)

<400> 6

ttgctctcaa gctggttcaa 20

<210> 7

<211> 39

<212> DNA

<213> Artificial sequence (Unknow)

<400> 7

tcccctactg ctgcctggag gcagtcaagc ctcttctcg 39

<210> 8

<211> 42

<212> DNA

<213> Artificial sequence (Unknow)

<400> 8

tctcctgcta gaatggctgg catctgtcaa gcagcagcaa ag 42

<210> 9

<211> 36

<212> DNA

<213> Artificial sequence (Unknow)

<400> 9

cacaccatac tttctgtttt gctttccatt ggtgtg 36

<210> 10

<211> 36

<212> DNA

<213> Artificial sequence (Unknow)

<400> 10

agcggctctc atcacgtagt cgcaacagta gccgct 36

<210> 11

<211> 20

<212> DNA

<213> Artificial sequence (Unknow)

<400> 11

catgcagatc aacttactcc 20

<210> 12

<211> 18

<212> DNA

<213> Artificial sequence (Unknow)

<400> 12

tttctgcacc aagtgaca 18

<210> 13

<211> 41

<212> DNA

<213> Artificial sequence (Unknow)

<400> 13

gcccctatta aacagcctgc atggcgtgtt tattctacag g 41

<210> 14

<211> 43

<212> DNA

<213> Artificial sequence (Unknow)

<400> 14

acccattggt gcaggtatat gcggattgac tagctacact acg 43

<210> 15

<211> 37

<212> DNA

<213> Artificial sequence (Unknow)

<400> 15

gcccgccgag gagaattagt ctgagtctga taactag 37

<210> 16

<211> 22

<212> DNA

<213> Artificial sequence (Unknow)

<400> 16

agactaattc tcctcggcgg gc 22

<210> 17

<211> 37

<212> DNA

<213> Artificial sequence (Unknow)

<400> 17

gcccgccgac gagaattagt ctgagtctga taactag 37

<210> 18

<211> 22

<212> DNA

<213> Artificial sequence (Unknow)

<400> 18

agactaattc tcgtcggcgg gc 22

Claims (3)

1. The application of a detection reagent for coronavirus RNA double genes in preparing a detection kit for simultaneous detection and mutant strain identification is characterized in that the kit consists of a loop-mediated amplification reaction solution, an enzyme, a primer, a signal probe and a standard substance, wherein the sequences of the primer and the signal probe are as follows:

wherein, the ORF1ab gene and the N gene are simultaneously detected by the required primers:

F3-ORF1ab：CAGCATTTCTTCACAAAGCT

B3-ORF1ab：ATGTAAAGTGCACATCAGTAG

FIP-ORF1ab：ACTGAAGCCTTTGAAAAAATGGTTTTAT GTCTACAGCACCCTG

BIP-ORF1ab：ACACATTGAGCCCACAATTTAGACTTACTCTCAGTTTTGCAACAA

F3-N：GCCAAAAGGCTTCTACGCA

B3-N：TTGCTCTCAAGCTGGTTCAA

FIP-N：TCCCCTACTGCTGCCTGGAGGCAGTCAAGCCTCTTCTCG

BIP-N：TCTCCTGCTAGAATGGCTGGCATCTGTCAAGCAGCAGCAAAG

wherein ORF1ab gene and N gene are used for simultaneously detecting the required signal probe:

MB-ORF1ab-FAM：FAM-CACACCATACTTTCTGTTTTGCTTTCCATTGGTGTG-BHQ1

MB-N-NED：NED-AGCGGCTCTCATCACGTAGTCGCAACAGTAGCCGCT-BHQ2

wherein, the primers for identifying the S genes of different strains are as follows:

F3-S：CATGCAGATCAACTTACTCC

B3-S：TTTCTGCACCAAGTGACA

FIP-S：GCCCCTATTAAACAGCCTGCATGGCGTGTTTATTCTACAGG

BIP-S：ACCCATTGGTGCAGGTATATGCGGATTGACTAGCTACACTACG

wherein, the S genes of different strains identify the required signal probes:

OSD-F-wild type：NED-GCCCGCCGAGGAGAATTAGTCTGAGTCTGATAACTAG-Inverted dT

OSD-Q-wild type：AGACTAATTCTCCTCGGCGGGC-BHQ2

OSD-F-Delta：FAM-GCCCGCCGACGAGAATTAGTCTGAGTCTGATAACTAG-Inverted dT

OSD-Q-Delta：AGACTAATTCTCGTCGGCGGGC-BHQ1；

the standard substance is an ORF1ab gene, an N gene and S gene RNA synthetic sample of different strains; the detection of coronavirus RNA is realized by detecting fluorescent signals of FAM and NED channels and simultaneously detecting virus ORF1ab gene and N gene RNA; the identification of different strains of coronavirus is realized by detecting the fluorescence signal intensity of two channels of FAM and NED to distinguish the mutation of virus S gene RNA.

2. The use of claim 1, wherein the loop-mediated amplification reaction solution is a mixture of magnesium sulfate, deoxyribonucleotide triphosphates, betaine, ThermoPol buffer solution, and AMV RT buffer solution, and the enzyme is AMV reverse transcriptase, Bst 2.0DNA polymerase.

3. The use of claim 1, wherein the probe solution is stored in a brown tube.

Images