CN113355459B

CN113355459B - Method and kit for detecting and screening N501Y mutation of new coronavirus

Info

Publication number: CN113355459B
Application number: CN202110648729.XA
Authority: CN
Inventors: 杜忆南; 邢晨; 柳燕; 祝亚亭; 李倩; 王小凤; 张智康; 张宁; 王悦晨
Original assignee: Anhui Medical University
Current assignee: Anhui Medical University
Priority date: 2021-06-10
Filing date: 2021-06-10
Publication date: 2022-04-01
Anticipated expiration: 2041-06-10
Also published as: WO2022257663A1; CN113355459A

Abstract

A method and a kit for detecting and screening N501Y mutation of new coronavirus comprise extracting nucleic acid to obtain nucleic acid to be detected; carrying out amplification reaction by using the designed primer to obtain a nucleic acid amplification product; and (3) preparing CRISPR reaction mixed liquor, adding 2 mu L of nucleic acid amplification product into the CRISPR reaction mixed liquor, incubating for 30 minutes at 37 ℃, and reading a detection result through fluorescence. The invention has the advantages of high detection speed, high accuracy, low cost and multi-scene real-time detection.

Description

Method and kit for detecting and screening N501Y mutation of new coronavirus

Technical Field

The invention belongs to the technical field of biological detection, and relates to a method and a kit for detecting and screening N501Y mutation of a new coronavirus.

Background

The novel coronavirus (COVID-19), called new coronavirus for short, is a newly discovered single-stranded RNA virus, has a total length of 29903 nucleotides, is transmitted through respiratory tract and conjunctiva by droplets, has strong infectivity and wide transmission range, and is the seventh coronavirus which is known at present and causes diseases to human beings. Compared with acute symptoms caused by other coronaviruses, the novel coronaviruses have infection symptoms from mild symptoms, cough symptoms, fever symptoms to dangerous symptoms, and the infection symptoms are similar to common respiratory diseases, and have strong concealment and extremely strong infectivity.

With the spread of new coronaviruses, thousands of mutations of new coronaviruses have been monitored globally. Most mutations do not result in changes in the properties of the virus, but specific mutations that are partially located on the S protein of the new coronavirus may make the virus more harmful. The S protein (spike protein) of the novel coronavirus is a component of the outermost structure of the virus, and the novel coronavirus invades cells by recognizing the hACE2 receptor on the surface of host cells through the surface protein. The human body also achieves viral immunity by recognizing viral surface antigens and thereby producing corresponding antibodies. Most of the current new corona vaccines are also designed against the S protein of new corona virus. Thus mutations occurring in the S protein of the novel coronavirus may result in a change in the corresponding amino acid, thereby rendering the mode of virus entry more infectious. Amino acid changes may result in changes in viral epitopes that render vaccine-induced protective antibodies ineffective. The N501Y mutation is that the 1 st base of the 501 th amino acid of the new coronavirus S protein has A to T base change, which results in the conversion of the amino acid from asparagine (N) to tyrosine (Y). Several studies have demonstrated that the new corona strain carrying the N501Y mutation, which renders the virus resistant to a variety of monoclonal as well as polyclonal antibodies, has a very strong immune escape capacity. In a recent immunological experiment against the strain N501Y.V2, it was found that the strain carrying the N501Y mutation not only greatly reduced the neutralizing potency of serum in convalescent patients; in the convalescent serum induced by the application of the vaccine, N501Y.V2 reduced the protective efficacy of the Pfizer-BioNTech vaccine BNT162b2 and the modern vaccine (modern RNA-1273) and the Oxford-Aslikam vaccine (AZD1222) to only 10.4%. The N501Y mutation poses a significant challenge to the work of controlling new coronavirus through vaccines.

A Single Nucleotide Polymorphism (SNP) refers to a polymorphism of a nucleic acid sequence due to a change of a single nucleotide base. Single nucleotide polymorphism detection (SNP detection) is a detection technique used to detect DNA sequence polymorphisms at the genomic level caused by single nucleotide variations. The SNP detection methods are roughly classified into 3 types: known polymorphism detection based on gel, including polymerase chain reaction, restriction fragment length polymorphism labeling, oligonucleotide ligation analysis, small sequencing and the like; secondly, non-gel high-flux detection technology comprises a fluorescence energy resonance transfer detection method, a mass spectrum technology, a DNA chip and the like; third, conformation-based unknown mutation detection, including single-strand conformation polymorphism, chemical or enzyme mismatch modification analysis, denaturing gradient gel electrophoresis, denaturing high performance liquid chromatography, etc. At present, the monitoring of the new coronavirus mutation mainly relies on high-throughput sequencing to identify SNP, although the accuracy is high, the detection period is as long as 7 days, the cost is high, and the method cannot be suitable for rapid screening of the new coronavirus mutation. Therefore, the research and development of the rapid SNP detection and screening method for the new coronavirus mutation, which has the advantages of high speed, high accuracy and low cost, is of great significance.

CRISPR is an abbreviation for "Clustered regular interspersed short palindromic repeats" and refers to regularly Clustered, interspersed short palindromic repeats. Cas is the abbreviation for "CRISPR-associated", CRISPR-associated. The CRISPR/Cas system is an adaptive mechanism for resisting phage invasion developed by bacteria and archaea, and then discovered and developed into a technology for carrying out specific nucleic acid editing on a target gene by guiding a Cas nuclease by a guide RNA. The CRISPR/Cas system works on the principle that a crRNA (CRISPR-derived RNA) is combined with a tracrRNA (trans-activating RNA) through base pairing to form a tracrRNA/crRNA complex, and the complex guides a nuclease such as a Cas9 protein to cut double-stranded DNA at a sequence target site paired with the crRNA, so that the genome DNA sequence is edited; by artificially designing the two RNAs, a gRNA (guide RNA) with a guiding function can be transformed, and the gRNA (guide RNA) can be enough to guide the site-specific cleavage of the DNA by the Cas 9. At present, the CRISPR-based nucleic acid rapid detection technology is mainly divided into two major categories, namely a nucleic acid isothermal detection technology called DETECTR which is developed by Jennifer Doudna in nobel chemical prize-winning step 2020 and relies on Cas12a, and a nucleic acid isothermal detection technology called SHERLOCK which is developed by CRISPR boundary and relies on Cas13 a. The principle is that a target fragment is amplified and enriched by a constant-temperature amplification method such as RT-RAA, then the Cas protein can be guided by crRNA to target and recognize the amplified target fragment and be activated, the activated Cas protein becomes a DNA cutter (Cas12a) or an RNA cutter (Cas13a), and all nearby single-stranded DNA (Cas12a) or single-stranded RNA (Cas13a) is cut. This property is used for reporting the detection result by acting on the single-stranded nucleic acid fluorescent probe.

The CRISPR/Cas protein is required to be combined with crRNA and to be recognized and combined with a sequence to be detected under the guidance of the crRNA, so that the Cas protein is activated for cleavage detection. crRNA is a guide RNA composed of an immobilized backbone (scaffold) and a region complementary to the targeting sequence (spacer). Single base mutation (SNP) detection utilizes the base recognition specificity of crRNA, and by placing mutant bases at different positions of crRNA or artificially introducing base mismatches, crRNA can only recognize mutant sequences but not original sequences without SNPs, thereby realizing mutation typing detection. The invention uses LwaCas13a (LeptotrichiawadeideiCas 13a) derived from the bacterium Vasella to carry out the differential identification of the N501Y mutation of the new coronavirus.

As shown in fig. 1, the mode principle of LwaCas13a for discriminating SNPs is demonstrated. LwaCas13a can tolerate one base mismatch and activate for cleavage detection when recognizing crRNA, but LwaCas13a cannot recognize activation in the case of two base mismatch. The critical point for SNP detection was reached by artificially introducing an additional base mismatch on the crRNA of LwaCas13 a: when the SNP sequence is detected, only one human mismatch exists, and the crRNA activates the Cas protein to perform cleavage detection; when the original sequence without SNP is detected, because of two base mismatches, the crRNA can not activate the Cas protein to generate corresponding spatial structure change, and the detection is negative. The reported SNP typing of ZIKV virus by using LwaCas13a in the literature tends to place a mutant base at the third base of a spacer and place an artificially synthesized base mismatch at the 5 th base of the spacer corresponding to crRNA for SNP differential detection. However, due to different base composition sequences of different detection sites, the influence on the spatial variation of the LwaCas13a protein after the combination of the detection sites and crRNA is different, and the SNP identification design work of others can only be used as a reference and cannot be applied. Therefore, when the N501Y mutation of LwaCas13a is detected, the mutant bases are tried to be placed at different positions of the spacer, the artificial mismatch is tried to be placed at different positions of the crRNA, so that a plurality of sets of crRNAs are designed for screening, and finally, one crRNA sequence is screened, so that the N501Y mutation can be detected with the highest specificity and sensitivity.

Disclosure of Invention

The invention aims to provide a method and a kit for detecting and screening N501Y mutation of a novel coronavirus.

In order to achieve the above objects and other related objects, the present invention provides the following technical solutions: a kit for detecting and screening for a mutation in N501Y of a novel coronavirus, the kit comprising:

a set of RT-RAA amplification primers:

RT-RAA upstream primer:

5’-GAAATTAATACGACTCACTATAGGGccttgtaatggtgttgaaggttttaattgttac-3’；

RT-RAA downstream primer: 5'-gttcaaaagaaagtactactactctgtatgg-3', respectively;

a crRNA sequence that specifically detects the N501Y mutation:

M1crRNA:

5’-gauuuagacuaccccaaaaacgaaggggacuaaaacaccuuaaguggguuggaaaccauaugau-3’；

RNA fluorescent probe:

5 '-FAM-mARUrGrCmAmArArArArrGrCmA-BHQ 1-3'; wherein m is an oxymethyl modification at the 2-position, and r represents a ribonucleotide.

The preferable technical scheme is as follows: also comprises buffer A solution and buffer B solution; the preparation method of the buffer A solution comprises the following steps: adding 50mmol of Tris buffer solution, 100nmol of potassium acetate, 20g of polyethylene glycol powder and 2mmol of dithiothreitol into 1L of water; the BufferB solution is a magnesium acetate solution with the concentration of 280 mM.

The preferable technical scheme is as follows: further comprising: HEPES buffer, MgCl₂Solution, 10 XNEB buffer2.1 buffer, RNase inhibitor, T7 RNA polymerase, RNase-free water.

In order to achieve the above objects and other related objects, the present invention provides the following technical solutions: a method for detecting and screening N501Y mutation of new coronavirus, comprising the following steps:

step 1: immersing a sample to be detected in a virus preservation solution, and then performing nucleic acid extraction by using an RNA extraction kit to obtain nucleic acid to be detected;

step 2: adding 41.5 mu L of buffer A solution, 2 mu L of RT-RAA upstream primer, 2 mu L of RT-RAA downstream primer and 2 mu L of nucleic acid to be detected into a reaction tube containing protease freeze-dried powder, then adding 2.5 mu L of buffer B solution, covering a tube cover of the reaction tube, and carrying out amplification reaction to obtain a nucleic acid amplification product;

RT-RAA upstream primer:

5’-GAAATTAATACGACTCACTATAGGGccttgtaatggtgttgaaggttttaattgttac-3’；

RT-RAA downstream primer: 5'-gttcaaaagaaagtactactactctgtatgg-3', respectively;

and step 3: preparing a CRISPR reaction mixed solution: 0.4. mu.L of 1M HEPES buffer solution and 0.18. mu.L of 1M MgCl₂Mixing the solution, 0.8 mu L of rNTP mix with the concentration of 10uM, 2 mu L of LwaCas13a with the concentration of 63.2 ng/mu L, 1 mu L of RNase inhibitor with the concentration of 40U/mu L, 0.1 mu L of T7 RNA polymerase with the concentration of 50U/mu L, 0.5 mu L of M1crRNA with the concentration of 10 ng/mu L, 0.2 mu L of RNA fluorescent probe with the concentration of 100uM and 12.82 mu L of RNase-free water;

M1crRNA:

5’-gauuuagacuaccccaaaaacgaaggggacuaaaacaccuuaaguggguuggaaaccauaugau-3’；

RNA fluorescent probe:

5 '-FAM-mARUrGrCmAmArArArArrGrCmA-BHQ 1-3'; wherein m is 2-oxygen methyl modification, and r is RNA;

and 4, step 4: adding 2 mu L of the nucleic acid amplification product obtained in the step 2 into the CRISPR reaction mixed solution obtained in the step 3, and incubating for 30 minutes at 37 ℃; the judgment is made by the following method:

1. incubating and simultaneously detecting fluorescence through a fluorescence quantitative PCR instrument, or directly bathing in water and finally observing fluorescence change by naked eyes;

2. reading a fluorescence value under a FAM channel by using a qPCR instrument at the beginning of CRISPR reaction incubation, incubating for 20 cycles at 37 ℃, wherein each cycle is separated by 2 minutes, a fluorescence signal is recorded once at the end of each cycle, and judging the detection result of N501Y according to the final fluorescence signal intensity, wherein the fluorescence value is more than 3000 and represents N501Y detection positive, the fluorescence value is less than 2000 and represents N501Y detection negative, if the fluorescence value is between 2000 and 3000, the detection is carried out once again, and if the fluorescence value is still 2000 and 3000, the detection of N501Y is judged to be positive; if no fluorescence reading instrument such as qPCR is arranged on the site, the reaction tube can be placed under a transmission light source with the excitation wavelength of 485nm to observe the color change after the reaction is finished to determine the detection result; the reaction tube with positive detection of N501Y will emit yellow green fluorescence, and the reaction tube with negative detection of N501Y will not emit fluorescence.

The preferable technical scheme is as follows: the preparation method of the buffer A solution comprises the following steps: adding 50mmol of Tris buffer solution, 100nmol of potassium acetate, 20g of polyethylene glycol powder and 2mmol of dithiothreitol into 1L of water; the BufferB solution is a magnesium acetate solution with the concentration of 280 mM.

Due to the application of the technical scheme, compared with the prior art, the invention has the advantages that:

the invention has the advantages of high detection speed, high accuracy and lower cost.

Drawings

FIG. 1 shows the schematic diagram of the mode principle of SNP discrimination of LwaCas13 a.

FIG. 2 is a diagram of optimal primer screening for RT-RAA at the site N501Y.

FIG. 3 shows the crRNA design of N501YCas13 a.

Fig. 4N 501Y crRNA screening map of Cas13 a.

FIG. 5 shows crRNA verification pattern of N501YCas13 a.

FIG. 6 shows direct visual reading of the results under excitation light.

Detailed Description

The following description of the embodiments of the present invention is provided for illustrative purposes, and other advantages and effects of the present invention will become apparent to those skilled in the art from the present disclosure.

Please refer to fig. 1-6. It should be understood that the structures, ratios, sizes, and the like shown in the drawings and described in the specification are for illustrative purposes only and are not intended to limit the scope of the present invention. The following examples are provided for a better understanding of the present invention, and are not intended to limit the invention. The experimental procedures in the following examples are conventional unless otherwise specified. The experimental materials used in the following examples were all purchased from a conventional biochemical reagent store unless otherwise specified.

Example 1: method and kit for detecting and screening N501Y mutation of new coronavirus

A method for detecting and screening N501Y mutation of new coronavirus comprises the following technical steps.

(1) Extraction of novel coronavirus nucleic acids

Immersing the specimen to be detected in a virus preservation solution containing 2-3ml (isotonic saline solution can also be used), and screwing the tube cover. The sample should be extracted and detected as soon as possible, and the sample which can be detected within 24 hours can be stored at 4 ℃; samples that could not be detected within 24 hours should be stored at-70 ℃ or below. Nucleic acid extraction using RNA extraction kit

Mini Kit (QIAGEN, Cat No.74106) for example: 200. mu.L of the virus preservation solution was added to 350. mu.L of LBufferrLT and mixed by pipetting, and 550. mu.L of 70% absolute ethanol was added to precipitate the viral RNA. The resulting turbid suspension was centrifuged through a filter column at 12000rpm for 2min at 4 ℃. The impurities were eluted using bufferrW1 followed by bufferrPE, and finally 80. mu.L of RNase-free water was added to the adsorption column and the viral nucleic acids were eluted by centrifugation.

(2) RT-RAA primer design

RT-RAA (Reverse-Transcription-recombination-aid Amplification) is a Reverse Transcription-Recombinase mediated Amplification reaction. Namely, reverse transcriptase carries out reverse transcription on RNA into cDNA, and then the target fragment is amplified at 37 ℃ under the mediation of a plurality of recombinase and a specific RT-RAA primer. The RT-RAA reaction is the first step in the CRISPR detection method and plays a role in amplifying signals so as to improve the detection sensitivity.

The design of the RT-RAA primer follows the following principles: 1. the length of the primer is 30-35 bases; 2. the GC content of the primer is more than 30 percent and less than 70 percent; 3. the length range of the amplified product is between 100bp and 200 bp; 4. the amplified region requires a GC content of 40% < GC < 60% avoiding single repeat sequences as well as palindromic sequences. And 3 groups of RT-RAA primers at the upstream and the downstream are designed around the detection site, and the RT-RAA primers with the best amplification effect are screened out by using a complete CRISPR detection cleavage reaction.

The invention designs 3 groups of primers aiming at the mutation of the novel coronavirus N501Y, and the optimal amplification primers are obtained by final screening as follows:

Cas13-501-for2：5’-GAAATTAATACGACTCACTATAGGGccttgtaatggtgttgaaggttttaattgttac-3’；

Cas13-501-rev1：5’-gttcaaaagaaagtactactactctgtatgg-3’；

(3) RT-RAA nucleic acid amplification

And amplifying the extracted sample nucleic acid by using the Hangzhou mass RT-RAA nucleic acid amplification basic kit and a corresponding RT-RAA primer, and incubating for 20 minutes at 37 ℃. The specific operation steps are as follows:

50 mu L of RT-RAA amplification system, a reaction tube filled with protease freeze-dried powder is taken, and 41.5 mu L of buffer A solution (50mM Tris pH 7.9, 100nM Potassium acetate (Potasium acetate), 5% polyethylene glycol (PEG), 2mM Dithiothreitol (DTT)), 2 mu L of RT-RAA upstream primer (Cas13-501-for2) (10 mu M), 2 mu L of RT-RAA downstream primer (Cas13-501-rev1) (10 mu M) and 2 mu L of nucleic acid to be detected are sequentially added into the reaction tube. mu.L of buffer B solution (280mM magnesium acetate) was added to the cap, and the amplification reaction was initiated by removing the reaction tube immediately after the cap was closed. The reaction tube was incubated at 39 ℃ in a water bath for 20 minutes or directly held in the palm and incubated with body temperature for 20 minutes.

(4) Method for rapid SNP detection and screening of new coronavirus N501Y mutation by configuring CRISPR reaction system

The invention designs 11 kinds of LwaCas13a crRNA for distinguishing and identifying N501Y mutation of novel coronavirus, which is designed by combining mutant bases at the 3 rd, 4 th and 6 th bases of a spacer (a region where the crRNA is complementary with a target sequence) and artificial mismatch bases at the 2 nd, 3 rd, 4 th, 5 th and 6 th bases of the spacer corresponding to the crRNA. The strength of fluorescence signals when the crRNA sites are respectively detected for mutant strains and original strains is compared, and the designed crRNA sites are subjected to complete fluorescence cutting detection screening.

The invention finally screens 1 specific and sensitive crRNA sequences which can be used for identifying and distinguishing N501Y mutation, and the invention is disclosed as follows:

M1crRNA:

5’-gauuuagacuaccccaaaaacgaaggggacuaaaacaccuuaaguggguuggaaaccauaugau-3’；

the N501Y mutation was detected using the CRISPR/Cas13a system.

The CRISPR reaction was configured with the components, volumes and concentrations as described in the following table:

the preparation system of the CRISPRCS 13a reaction mixed liquid is as follows:

RNA fluorescent probe:

the effect of the CRISPR reaction system on SNP detection is mainly embodied in specificity, namely the specific base recognition characteristic of the CRISPR system endows the CRISPR reaction system with the capability of carrying out SNP detection. The crRNA provided by the invention can effectively recognize the N501Y mutation sequence and activate the corresponding Cas protein, and the fluorescence report probe around the cleavage shows that the N501Y mutation detection is positive. When the crRNA detects an original sequence without mutation, the corresponding Cas protein cannot be activated due to base mismatch, so that the detection of the N501Y mutation is negative.

(5) Fluorescence detection and result reading of N501Y mutation

mu.L of the nucleic acid amplification product was added to the prepared 18. mu.L of LCRISPR reaction mixture and incubated at 37 ℃ for 30 minutes. The fluorescence can be detected by incubation with a fluorescent quantitative PCR instrument or by direct water bath and visual observation of the fluorescence change. The fluorescence values at the FAM channel (FAM channel, which is the channel corresponding to the qPCR instrument reading fluorescence at wavelengths 450nm-490 nm) can be read at the beginning of the CRISPR reaction incubation using the qPCR instrument (berle CFX96), incubated at 37 ℃ for 20 cycles, with 2min intervals between each cycle, and the fluorescence signal recorded once at the end of each cycle. And judging the detection result of the N501Y according to the final fluorescence signal intensity, namely judging that the detection result of the N501Y is positive if the fluorescence value is more than 3000, the detection result of the N501Y is positive if the fluorescence value is less than 2000, the detection result of the N501Y is negative if the fluorescence value is between 2000 and 3000, and judging that the detection result of the N501Y is positive if the fluorescence value is still 2000 and 3000. If no fluorescence reading instrument such as qPCR is arranged on site, the reaction tube can be placed under a transmission light source with the excitation wavelength of 485nm to observe color change after the reaction is finished, so as to determine the detection result. The reaction tube with positive detection of N501Y will emit yellow green fluorescence, and the reaction tube with negative detection of N501Y will not emit fluorescence.

Example 2: method and kit for detecting and screening N501Y mutation of new coronavirus

Establishment of detection method

1. Materials and methods

1.1 materials

The RT-RAA amplification primers, crRNA and single-stranded probes were synthesized by Nanjing Ongbenaceae and Nanjing Kingsry. RT-RAA nucleic acid based amplification kit was purchased from Hangzhou Mass testing Biometrics. The LwaCas13a protein was purchased from tsingsback bio-company. The pseudovirus containing the mutant sequence is obtained by packaging in a laboratory, or a company can be entrusted with packaging the pseudovirus containing the corresponding mutant sequence.

1.2 methods

1.2.1: design of RT-RAA primers

RT-RAA amplification primers of the N501Y mutation site were designed according to the sequence of a new original strain of coronavirus (NC-045512.2) which has been published in GenBank. 3 pieces of upstream primers and 3 pieces of downstream primers are designed according to the design requirements of RT-RAA, and the specific sequences are as follows:

name of RT-RAA primer	Sequence (5 '-3')
		Cas13-501-for1	GAAATTAATACGACTCACTATAGGGaatggtgttgaaggttttaattgttactttcc
Cas13-501-for2	GAAATTAATACGACTCACTATAGGGccttgtaatggtgttgaaggttttaattgttac
		Cas13-501-for3	GAAATTAATACGACTCACTATAGGGgccggtagcacaccttgtaatggtgttgaagg
Cas13-501-rev1	gttcaaaagaaagtactactactctgtatgg
		Cas13-501-rev2	ggtgcatgtagaagttcaaaagaaagtactac
Cas13-501-rev3	tccacaaacagttgctggtgcatgtagaag

1.2.2 selection of RT-RAA optimal amplification primers:

a primer combination with the highest amplification efficiency is screened out through a complete RT-RAA-CRISPRCs 13a experiment, a Cas13a is firstly designed to detect crRNA of 501N original site, and the sequence is as follows:

5’-GAUUUAGACUACCCCAAAAACGAAGGGGACUAAAACAUUAGUGGGUUGGAAACCAUAUGAUUGU-3’；N501Y-crRNA0

the three pairs of upstream and downstream primers of RT-RAA are verified by using the crRNA, and 9 combinations are paired in pairs

And (3) verifying the amplification efficiency of each group of primers by using the new coronavirus S fragment RNA templates with different concentration gradients, and calculating the molecular weight according to the length of the RNA templates, wherein the copy number of the molecules is about 1.4 multiplied by 1011 cp/muL in a conversion mode of 50 ng/. mu.L of the RNA templates. It was diluted 10-fold to 1400, 140, 14, 1.4, 0.7 and 0 cp/. mu.L with gradients. Then, RT-RAA-CRISPRCs 13 cutting detection is used, amplification efficiency verification is carried out on the 9 primer combinations according to the 6 concentration gradients, the amplification efficiency of the primers is judged according to the fluorescence intensity, and finally, a group of optimal amplification primers is selected.

1.2.3 design of LwaCas13acrRNA for detection of the N501Y mutation

According to the N501Y mutant strain sequence (EPI _ ISL _732451) published by the global shared influenza initiative (GISAID), the N501Y mutation results in the mutation of the 1 st base of the 501 th amino acid of the S protein of the novel coronavirus from adenine (a) to thymine (T). The N501Y mutation, i.e., the change of the base, was detected, and this example used LwaCas13a to detect the mutation of N501Y adenine (A) to thymine (T).

The crRNA is a guide RNA, and consists of a fixed framework (scaffold) and a region (spacer) complementary to a target sequence, and the mismatch of one base on the spacer can be tolerated and successfully activated according to the existing report Cas13a, so that when the N501Y mutation is detected, under the condition that one mutation mismatch exists, an artificial mismatch is additionally introduced on the spacer, namely, the crRNA only can recognize the mutant sequence but not the original sequence, so that the purpose of mutation typing is achieved. After comprehensively analyzing the space structure of the Cas13a protein when acting with the crRNA, the invention artificially introduces base mismatch at

bases

3, 4, 5, 6 and the like of the spacer, and designs 11 crRNAs for subsequent screening. The specific sequences are shown in the table below and are shown in FIG. 3.

TABLE 5

1.2.4 screening of crRNA effective in discriminating N501Y Using the complete RT-RAACRIPRCas 13a reaction

A pseudovirus mock virus mutation positive sample containing the N501Y mutant sequence was used, and a pseudovirus containing the original sequence was used as a negative control. The 11 crRNAs designed above were screened with two pseudoviral samples at 100 cp/. mu.L. Cas13acrRNA which can detect N501Y mutation but can not detect 501N original sequence is screened out through the fluorescence intensity detected by RT-RAA-CRISPRCs 13a cutting.

1.2.5 further validation of the selected M1crRNA

The selected M1crRNA is used for CRISPR detection at different concentrations of 1400 cp/muL, 140 cp/muL, 14 cp/muL, 1.4 cp/muL and 0.7 cp/muL by respectively using the pseudovirus carrying the N501Y mutation and the pseudovirus not carrying the N501Y mutation, and the accuracy and the sensitivity of the M1crRNA for identifying the N501Y mutation are analyzed in a comparison manner.

2.1 selection of optimal amplification primers for RT-RAA at N501Y site

The fluorescence intensities of the different primer sets were compared by complete RT-RAA-CRISPRCs 13a cleavage detection reactions using nine RT-RAA primer combinations, and the fluorescence signals were collected by BerleCFX 96. As shown in FIG. 2, the combination of the primers F2+ R1(Cas13-501-for2+ Cas13-501-rev1) has the highest detection sensitivity, can stably detect the virus nucleic acid with the concentration of 0.7cp// muL, and has the highest primer amplification efficiency, so that the combination is selected as the optimal RT-RAA amplification primer.

2.2 CRISPRCs 13a CRRNA screening results for effectively distinguishing N501Y

Positive samples containing the mutation and negative samples containing no mutation were used to screen for effective crRNA by RT-RAA-CRISPRCas13a cleavage detection reaction. The concentration of the pseudovirus sample is 100 cp/. mu.L, two repeats are set, and nucleic acid is extracted by using a nucleic acid extraction kit. And isothermal amplification was performed using a mass-detection RT-RAA nucleic acid based amplification kit. Preparing an independent CRISPR reaction system for each crRNA, adding 2 mu LRT-RAA amplification products into the 18 mu LCRISPR reaction system, incubating at 37 ℃ for 20 cycles, and collecting fluorescence through Brillo CFX96 in the whole incubation process. The mutation distinguishing capability of each crRNA is judged by comparing the fluorescence intensity of the mutant sample and the original sample. Cas13acrRNAM1 was able to efficiently detect the N501Y mutation without detecting the original template as shown in fig. 4.

2.3 further validation of the differentiating Effect of Cas13acrRNAM1

The screened Cas13acrRNAM1 was further subjected to SNP discrimination validation. Two false viruses, mutation positive and mutation negative, were diluted to 1400cp/μ L, 140cp/μ L, 14cp/μ L, 1.4cp/μ L and 0.7cp/μ L, respectively. Multiple concentration gradients of both sets of samples were tested by cleavage of the complete RT-RAA-CRISPRCas13a, again verifying the SNP discrimination ability of crRNA K1. FIG. 5 shows that the CRRNAM1 can effectively detect the N501Y-G mutation at 1400cp/μ L, 140cp/μ L, 14cp/μ L, 1.4cp/μ L and 0.7cp/μ L, and the original template at the corresponding concentration shows that the detection is negative. After the reaction is finished, the reaction tube is placed under a 485nm transmission light source, so that the reaction tube of the mutant template can be observed to emit obvious yellow-green fluorescence, and the reaction hole of the original template has no fluorescence.

FIG. 1: the principle of mutation detection using CRISPR/Cas13a is shown. I.e., the mutant strain is more matched with the guide rna (crrna), thereby activating the Cas protein for cleavage detection.

FIG. 2: the screening result of the RT-RAA primer at the N501Y site is shown. The three groups of primers at the upstream and the downstream are pairwise matched to form 9 combinations, and the fluorescence intensity of each primer combination when detecting virus templates with different concentration gradients is shown in the figure. The screening result shows that the primer F2+ R1 has the best amplification effect.

FIG. 3: the base sequence diagram shows that 11 LwaCas13a are designed for distinguishing the crRNA of the N501Y mutation. By artificially introducing base mismatch on crRNA, the Cas effector protein can be identified and activated when detecting mutant strains and cannot be identified when detecting original strains.

FIG. 4: the screening effect graph of various crRNA detection mutations is shown, and each designed crRNA is used for detecting the N501Y mutant sample and the original strain sample respectively, and the detection effects of the mutations are compared. The screening result shows that the M1crRNA has the strongest capacity of distinguishing the mutation.

FIG. 5: further validation results for the selected M1 crRNA. The M1crRNA and CRISPR/Cas13a system are used for detecting mutant strain samples with different concentration gradients and original strain samples, and the M1crRNA can achieve good mutation detection effect.

FIG. 6: showing direct reading of the assay results without relying on a fluorescence reading machine. The reaction tube was placed under 485nm excitation light, and the yellow-green fluorescence of the mutant group was observed with the naked eye.

Example 3: method and kit for detecting and screening N501Y mutation of new coronavirus

A kit for detecting and screening for a mutation in N501Y of a novel coronavirus, the kit comprising:

a set of RT-RAA amplification primers:

RT-RAA upstream primer:

5’-GAAATTAATACGACTCACTATAGGGccttgtaatggtgttgaaggttttaattgttac-3’；

RT-RAA downstream primer: 5'-gttcaaaagaaagtactactactctgtatgg-3', respectively;

a crRNA sequence that specifically detects the N501Y mutation:

M1crRNA:

5’-gauuuagacuaccccaaaaacgaaggggacuaaaacaccuuaaguggguuggaaaccauaugau-3’；

RNA fluorescent probe:

Also comprises buffer A solution and buffer B solution; the preparation method of the buffer A solution comprises the following steps: adding 50mmol of Tris buffer solution, 100nmol of potassium acetate, 20g of polyethylene glycol powder and 2mmol of dithiothreitol into 1L of water; the BufferB solution is a magnesium acetate solution with the concentration of 280 mM.

Further comprising: HEPES buffer, MgCl₂Solution, 10 XNEB buffer2.1 buffer, RNase inhibitor, T7 RNA polymerase, RNase-free water.

A method for detecting and screening N501Y mutation of new coronavirus, comprising the following steps:

step 1: immersing a sample to be detected in a virus preservation solution, and then performing nucleic acid extraction by using an RNA extraction kit to obtain nucleic acid to be detected; the sample to be tested is extracted from the door handle.

RT-RAA upstream primer:

5’-GAAATTAATACGACTCACTATAGGGccttgtaatggtgttgaaggttttaattgttac-3’；

RT-RAA downstream primer: 5'-gttcaaaagaaagtactactactctgtatgg-3', respectively;

M1crRNA:

5’-gauuuagacuaccccaaaaacgaaggggacuaaaacaccuuaaguggguuggaaaccauaugau-3’；

RNA fluorescent probe:

The foregoing is illustrative of the preferred embodiment of the present invention and is not to be construed as limiting thereof in any way, and any modifications or variations thereof that fall within the spirit of the invention are intended to be included within the scope thereof.

Claims

1. A kit for detecting and screening N501Y mutation of a new coronavirus is characterized in that: the kit comprises:

a set of RT-RAA amplification primers:

RT-RAA upstream primer:

5’-GAAATTAATACGACTCACTATAGGGccttgtaatggtgttgaaggttttaattgttac-3’；

RT-RAA downstream primer: 5'-gttcaaaagaaagtactactactctgtatgg-3', respectively;

a crRNA sequence that specifically detects the N501Y mutation:

M1crRNA :

5’-gauuuagacuaccccaaaaacgaaggggacuaaaacaccuuaaguggguuggaaaccauaugau -3’；

RNA fluorescent probe:

2. The kit for detecting and screening N501Y mutation of new coronavirus according to claim 1, which is characterized in that: also comprises buffer A solution and buffer B solution; the preparation method of the buffer A solution comprises the following steps: adding 50mmol of Tris buffer solution, 100nmol of potassium acetate, 20g of polyethylene glycol powder and 2mmol of dithiothreitol into 1L of water; the BufferB solution is a magnesium acetate solution with the concentration of 280 mM.

3. The kit for detecting and screening N501Y mutation of new coronavirus according to claim 1, which is characterized in that: further comprising: HEPES buffer, MgCl₂Solution, 10 XNEB buffer2.1 buffer, RNase inhibitor, T7 RNA polymerase, RNase-free water.

4. A method for non-diagnostic detection screening for the mutation of N501Y in a novel coronavirus, comprising: comprises the following steps:

RT-RAA upstream primer:

5’-GAAATTAATACGACTCACTATAGGGccttgtaatggtgttgaaggttttaattgttac-3’；

RT-RAA downstream primer: 5'-gttcaaaagaaagtactactactctgtatgg-3', respectively;

and step 3: preparing a CRISPR reaction mixed solution: 0.4. mu.L of 1M HEPES buffer solution and 0.18. mu.L of 1M MgCl₂Mixing the solution, 0.8 μ L of rNTP mix with the concentration of 10 μ M, 2 μ L of LwaCas13a with the concentration of 63.2ng/μ L, 1 μ L of RNase inhibitor with the concentration of 40U/μ L, 0.1 μ L of T7 RNA polymerase with the concentration of 50U/μ L, 0.5 μ L of M1crRNA with the concentration of 10ng/μ L, 0.2 μ L of RNA fluorescent probe with the concentration of 100 μ M and 12.82 μ L of RNase-free water;

M1crRNA :

5’-gauuuagacuaccccaaaaacgaaggggacuaaaacaccuuaaguggguuggaaaccauaugau -3’；

RNA fluorescent probe:

(1) incubating and simultaneously detecting fluorescence through a fluorescence quantitative PCR instrument, or directly bathing in water and finally observing fluorescence change by naked eyes;

(2) reading a fluorescence value under an FAM channel by using a qPCR instrument when CRISPR reaction incubation is started, incubating for 20 cycles at 37 ℃, wherein each cycle is separated by 2 minutes, a fluorescence signal is recorded once after each cycle is ended, and judging the detection result of N501Y according to the final fluorescence signal intensity, wherein the fluorescence value is more than 3000 and represents N501Y detection positive, the fluorescence value is less than 2000 and represents N501Y detection negative, if the fluorescence value is between 2000 and 3000, the detection is carried out once again, and if the fluorescence value is still 2000 and 3000, the detection of N501Y is judged to be positive; if no fluorescence reading instrument such as qPCR is arranged on the site, the reaction tube can be placed under a transmission light source with the excitation wavelength of 485nm to observe the color change after the reaction is finished to determine the detection result; the reaction tube with positive detection of N501Y will emit yellow green fluorescence, and the reaction tube with negative detection of N501Y will not emit fluorescence.

5. The method for detecting and screening N501Y mutation of new coronavirus according to claim 4, wherein the method comprises the following steps: the preparation method of the buffer A solution comprises the following steps: adding 50mmol of Tris buffer solution, 100nmol of potassium acetate, 20g of polyethylene glycol powder and 2mmol of dithiothreitol into 1L of water; the BufferB solution is a magnesium acetate solution with the concentration of 280 mM.