CN116287388A

CN116287388A - Identification method, primer pair and kit for cryptococcus

Info

Publication number: CN116287388A
Application number: CN202310144307.8A
Authority: CN
Inventors: 薛新颖; 张力烨; 王晨; 赵晟; 唐玮; 贺文聪; 刘文静
Original assignee: Beijing Shijitan Hospital
Current assignee: Beijing Shijitan Hospital
Priority date: 2023-02-17
Filing date: 2023-02-17
Publication date: 2023-06-23

Abstract

The application relates to an identification method, a primer pair and a kit of cryptococcus, wherein the method comprises the following steps: obtaining genome DNA of a sample to be tested; amplifying the URA5 gene of the genomic DNA by polymerase chain reaction PCR to obtain an amplified product; performing sanger sequencing on the amplification product; determining the type of the cryptococcus based on the 562-locus sequencing result of the URA5 gene. The cryptococcus identification method can determine the secondary type of the cryptococcus based on the primary type of the cryptococcus, and accurately judge the subtype of the cryptococcus, thereby helping to promote early intervention and treatment of diseases caused by the cryptococcus.

Description

Identification method, primer pair and kit for cryptococcus

Technical Field

The invention belongs to the technical field of fungal etiology detection, and particularly relates to an identification method, a primer pair and a kit of cryptococcus.

Background

Cryptococcus is a fungus that can cause cryptococcosis and belongs to the family Cryptococcus of the phylum Deuteromycotina, class of Bacillus in the mycotaxonomy. Cryptococcosis is a pulmonary or disseminated infectious disease caused by cryptococcus, mainly causing pneumonia, meningitis, skin or visceral infections. Cryptococcus is of a wide variety of genus, with the main species responsible for human infection being Cryptococcus neoformans and Cryptococcus glaucocalycis. There are significant differences in epidemiological and clinical pathogenic processes among different types of cryptococcus, for example, cryptococcus neoformans primarily infect immunosuppressed populations, while cryptococcus gartertiaryana primarily infects immunocompetent populations and predominates in pulmonary infections.

Since the pathogenicity and lethality of different types of cryptococcus are different, the judgment of which cryptococcus causes diseases is important for diagnosis and treatment of cryptococcosis. Therefore, how to identify the type of cryptococcus is a problem to be solved.

Disclosure of Invention

The invention provides an identification method, a primer pair and a kit for cryptococcus, which can accurately identify VGIa type cryptococcus, thereby helping to promote early intervention and treatment of diseases caused by cryptococcus.

In a first aspect, the present application provides a method of identifying cryptococcus, the method comprising: obtaining genome DNA of a sample to be tested; amplifying the URA5 gene of the genomic DNA by polymerase chain reaction PCR to obtain an amplified product; performing sanger sequencing on the amplification product; determining the type of the cryptococcus based on the 562-locus sequencing result of the URA5 gene.

Molecular typing of cryptococcus is generally limited to one-stage typing, i.e., classification of cryptococcus into VGI, VGII, VGIV type cryptococcus, and the like. The inventors found that cryptococcus VGI can be further classified into cryptococcus VGI type VGIa, VGIb, VGIc and cryptococcus VGId type, i.e., two-stage type, based on the previous next generation sequencing (Next Generation Sequencing, NGS) and the analysis results. There is also a clear difference in pathogenicity of cryptococcus of different subtypes. The identification method of the cryptococcus provided by the application can accurately identify the subtype of the cryptococcus, the sequencing result of the 562 locus of the URA5 gene is obtained through the amplification of the URA5 gene by the DNA of the sample to be tested and the sanger sequencing, in other words, whether the cryptococcus is the VGIa type cryptococcus or not can be accurately detected through the sequencing result, thereby helping to judge the type of the cryptococcus causing infection in clinical diagnosis. In addition, the detection method of the cryptococcus can be realized without using complex and expensive instruments and equipment, so that the detection cost of the cryptococcus can be saved, and the use scene of clinical detection can be expanded.

In some embodiments, the determining the type of cryptococcus based on sequencing of position 562 of the URA5 gene comprises: determining the cryptococcus as a VGIa type cryptococcus in the case that the 562 site of the URA5 gene is guanine G; in the case where the 562 locus of the URA5 gene is adenine a, cytosine C or thymine T, the cryptococcus is determined to be a wild-type cryptococcus.

It is understood that wild-type cryptococcus refers to cryptococcus other than cryptococcus of VGIa type. In the embodiment of the application, whether the cryptococcus in the sample to be detected is the VGIa type cryptococcus can be accurately judged by detecting whether 562 locus of the URA5 gene is G, so that diagnosis of the cryptococcus subtype causing infection is facilitated.

In some embodiments, the reactants of the PCR include URA5 forward primers and URA5 reverse primers; wherein the nucleotide sequence of the URA5 forward primer is shown as a Seq ID No.1, and the nucleotide sequence of the URA5 reverse primer is shown as a Seq ID No. 2.

In some embodiments, after obtaining the amplification product, the method further comprises: confirming that the URA5 gene amplification was successful.

In some embodiments, the success of the URA5 gene amplification is confirmed by gel electrophoresis.

In the embodiment of the application, after the amplification product is obtained and before sanger sequencing is carried out, whether amplification is successful or not is confirmed by using a gel electrophoresis method, so that the waste of time and cost caused by unsuccessful amplification, namely sanger sequencing, can be avoided, and the efficiency of cryptococcus typing is improved.

In some embodiments, the obtaining genomic DNA of the test sample comprises: grinding the sample to be tested by a liquid nitrogen grinding method; the genomic DNA was extracted by standard phenol chloroform method.

In some embodiments, the sample to be tested comprises blood and/or body fluid.

In a second aspect, there is provided a primer pair for identifying cryptococcus of VGIa type, comprising a forward primer and a reverse primer, wherein the nucleotide sequence of the forward primer is shown as Seq ID No.1 and the nucleotide sequence of the reverse primer is shown as Seq ID No. 2.

In some embodiments, the primer pair is used to identify position 562 of the URA5 gene sequence of the cryptococcus.

In a third aspect, there is provided a kit for identifying Cryptococcus VGIa, wherein the kit comprises a primer pair according to any of the embodiments of the second aspect.

In some embodiments, the kit further comprises: buffer solution, template DNA, deoxynucleoside triphosphate dNTPs and DNA polymerase.

In a fourth aspect, there is provided the use of a primer pair as in any one of the embodiments of the second aspect for identifying cryptococcus VGIa.

The cryptococcus identification method can accurately judge the type of the cryptococcus by amplifying the URA5 gene of the sample to be detected and detecting the sequence of the specific site by means of sanger sequencing so as to identify the type of the cryptococcus, more specifically, can judge whether the cryptococcus is the VGIa type cryptococcus, thereby realizing the secondary type detection of the cryptococcus, defining the subtype of the cryptococcus, helping to carry out rapid and accurate clinical diagnosis and reducing drug abuse.

Drawings

FIG. 1 is a schematic flow chart of an identification method of Cryptococcus in an embodiment of the present application.

FIG. 2 is another schematic flow chart of a method for determining cryptococcus in accordance with an embodiment of the present application.

FIG. 3 is a gel electrophoresis pattern of an amplification product according to the embodiment of the present application.

FIG. 4 is a graph showing the peak sequence of the wild-type cryptococcus and the VGIa cryptococcus of the present application.

Detailed Description

The technical scheme of the application is further described below in connection with specific embodiments.

The "range" disclosed herein is defined in terms of lower and upper limits, with a given range being defined by the selection of a lower and an upper limit, the selected lower and upper limits defining the boundaries of the particular range. Ranges that are defined in this way can be inclusive or exclusive of the endpoints, and any combination can be made, i.e., any lower limit can be combined with any upper limit to form a range. For example, if ranges of 60-120 and 80-110 are listed for a particular parameter, it is understood that ranges of 60-110 and 80-120 are also contemplated. Furthermore, if the minimum range values 1 and 2 are listed, and if the maximum range values 3,4 and 5 are listed, the following ranges are all contemplated: 1-3, 1-4, 1-5, 2-3, 2-4 and 2-5. In this application, unless otherwise indicated, the numerical range "a-b" represents a shorthand representation of any combination of real numbers between a and b, where a and b are both real numbers. For example, the numerical range "0-5" means that all real numbers between "0-5" have been listed throughout, and "0-5" is simply a shorthand representation of a combination of these values. When a certain parameter is expressed as an integer of 2 or more, it is disclosed that the parameter is, for example, an integer of 2, 3,4, 5, 6, 7, 8, 9, 10, 11, 12 or the like.

In the description of the present application, the terms "first," "second," "third," and the like are used for descriptive purposes only and are not to be construed as indicating or implying relative importance.

Reference herein to "comprising" and "including" means open ended, as well as closed ended, unless otherwise noted. For example, the terms "comprising" and "comprises" may mean that other components not listed may be included or included, or that only listed components may be included or included.

The term "or" is inclusive in this application, unless otherwise specified. For example, the phrase "a or B" means "a, B, or both a and B. More specifically, either of the following conditions satisfies the condition "a or B": a is true (or present) and B is false (or absent); a is false (or absent) and B is true (or present); or both A and B are true (or present).

All embodiments and alternative embodiments of the present application may be combined with each other to form new solutions, unless specifically stated otherwise.

First, some terms are briefly introduced:

next generation sequencing (Next Generation Sequencing, NGS) is a high throughput sequencing technology that can rapidly and comprehensively detect DNA mutations in the genome, commonly used for circulating tumor DNA (Circulating Tumor DNA, ctDNA), copy number variation (Copy Number Variations, CNVs) and gene fusion (using RNA sequencing panel). NGS may detect a variety of different types of samples, such as blood, tumor tissue, and bone marrow samples.

Sanger sequencing (Sanger Sequencing) is a method of obtaining a base sequence of a visible DNA, specifically, starting at a certain fixed point according to nucleotides, randomly terminating at a certain specific base, and fluorescence labeling after each base, producing four sets of nucleotides of different lengths ending with Adenine (A), thymine (T), cytosine (C), guanine (G), and then performing polyacrylamide gel electrophoresis (Polyacrylamide Gel Eectrophoresis, PAGE), thereby obtaining a base sequence of a visible DNA. The ability to analyze long and continuous nucleic acid sequences to detect DNA strands to identify mutations by sanger sequencing is one of the important means to achieve molecular typing.

The polymerase chain reaction (Polymerase Chain Reaction, PCR) is a molecular biological technique for amplifying specific DNA fragments, which can be regarded as specific DNA replication in vitro.

Multi-site sequence typing (MultilocusSequence Typing, MLST) is a bacterial typing method based on nucleic acid sequence determination. This method analyzes the variation of the strain by amplifying a plurality of housekeeping gene internal fragments by PCR and determining the sequence thereof. MLST has the advantages of simple operation, capability of rapidly obtaining results and the like.

The Real-time fluorescence quantitative nucleic acid amplification detection system (Real-time Quantitative PCR Detecting System, QPCR) is a method for adding a fluorescent group into a PCR reaction system, monitoring the whole PCR process in Real time by utilizing fluorescent signal accumulation, and finally quantitatively analyzing an unknown template through a standard curve.

URA5 gene: a phosphoribosyl transferase gene of cryptococcus, the nucleotide sequence of which is shown in Seq ID No. 3.

The embodiments of the present application are described below.

Cryptococcus is a fungus that mainly invades the central system of the human body, causing cryptococcosis. Cryptococcus comprises 17 and 8 variants of neutralization, of which novel Cryptococcus is the main pathogenic strain, hereinafter referred to as Cryptococcus. Different cryptococcus pathogenic rates, infected people have obvious differences, and therefore, it is critical for clinical diagnosis to identify which cryptococcus is responsible for the infection. With the improvement of gene detection means, cryptococcus has 8 molecular types: VNI, VNII, VNIII, VNIV, VGI, VGII, VGIII, VGIV. The inventors of the present application have found through NGS in combination with clinical epidemiological analysis that cryptococcus can be further classified into type VGIa, VGIb, VGIc and type VGId cryptococcus, i.e., type two, in addition to the above 8 types of primary classification; in addition, in the infection caused by cryptococcus, the pathogenicity rate, the lethality rate and the clinical manifestation of the cryptococcus of different subtypes are different, so that the detection of the cryptococcus subtype is extremely important in early clinical diagnosis of the infection caused by cryptococcus.

The currently used typing method can only conduct one-stage typing on cryptococcus, namely, can identify which of the molecular types in 8 belongs to cryptococcus, and cannot conduct two-stage typing. However, the means for realizing secondary typing such as QPCR is limited by expensive and complex instruments and equipment, and for hospitals in less developed areas, corresponding instruments and equipment and technicians cannot be equipped, so that accurate identification of secondary typing of cryptococcus is not possible.

In view of the above, the present application provides a method for identifying cryptococcus, which can be implemented without expensive instruments and complicated detection techniques, and can accurately identify cryptococcus subtypes, thereby helping to promote early diagnosis and treatment of cryptococcus.

Referring to FIG. 1, a schematic flow chart of a method 100 for identifying cryptococcus in accordance with an embodiment of the present application is shown. The method 100 comprises the following steps:

s101, obtaining genome DNA of a sample to be detected;

s102, amplifying URA5 genes of the genome DNA by PCR to obtain amplification products;

s103, performing sanger sequencing on the amplified product;

s104, determining the type of the cryptococcus according to 526-locus sequencing results of the URA5 gene.

Specifically, the present inventors found that secondary typing of cryptococcus can be judged by detecting whether mutation occurs in URA5 gene of cryptococcus by combining the previous results with computational biology method. The URA5 gene sequence of Cryptococcus VGIa is shown as Seq ID No.4, and the URA5 gene sequence of Cryptococcus wildtype is shown as Seq ID No. 3. Whether the cryptococcus is a type VGIa cryptococcus can be judged by whether mutation occurs at 562 locus of URA5 gene. Thus, the identification method 100 of the present application can achieve a two-level typing of cryptococcus by detecting mutation of URA5 gene. In addition, mutation of the URA5 gene can be detected only by combining sanger sequencing with MLST or other common molecular typing methods, and expensive testing instruments and complex testing technologies are not needed, so that medical staff in underdeveloped areas can accurately determine the secondary molecular typing of cryptococcus, and the detection cost of cryptococcus is effectively saved.

It is understood that wild-type cryptococcus in this application refers to other types of cryptococcus besides Cryptococcus of VGIa.

Optionally, in S104, determining the typing of cryptococcus based on the 562-locus sequencing result of URA5 gene comprises:

under the condition that 562 locus of URA5 gene is G, determining cryptococcus as VGIa type cryptococcus;

in the case where 562 locus of URA5 gene is A, C or T, cryptococcus is determined to be wild-type cryptococcus.

Specifically, the 562 locus of the URA5 gene of Cryptococcus VGIa is mutated to G. Therefore, by detecting 562 sites of the URA5 gene sequence of the sample to be detected, whether the cryptococcus in the sample to be detected is the VGIa type cryptococcus can be accurately judged, so that the subtype of the cryptococcus is effectively detected, and the judgment of the type of pathogenic cryptococcus is facilitated.

In some embodiments, the PCR reaction in S102 comprises: a URA5 forward primer and a URA5 reverse primer, wherein the nucleotide sequence of the URA5 forward primer is shown as Seq ID No.1, i.e., the nucleotide sequence of the ATGTCCTCCCAAGCCCTCGAC, URA reverse primer is shown as Seq ID No.2, i.e., TTAAGACCTCTGAACACCGTACTC.

FIG. 2 is another schematic flow chart of a method 100 for identifying cryptococcus in accordance with an embodiment of the present application.

Optionally, after obtaining the amplification product, the method 100 further comprises:

s105, confirming that URA5 gene amplification was successful.

Alternatively, in S105, success of URA5 gene amplification was confirmed by gel electrophoresis.

It is to be understood that the gel electrophoresis described herein includes, but is not limited to, agarose gel electrophoresis. In some other embodiments, the success of URA5 gene amplification can also be confirmed by polyacrylamide gel electrophoresis.

Specifically, the cryptococcus identification method 100 of the present application can perform gel electrophoresis on the amplified product after PCR amplification, thereby judging whether the amplification of the target gene URA5 is successful. If the amplification is successful, step S103 is executed, namely, the amplified product is subjected to sanger sequencing; if the amplification is unsuccessful, steps S101 and S102 are re-executed. By judging whether the target gene is amplified successfully, the reliability of the subsequent sanger sequencing can be improved, and the waste of sequencing time and sequencing cost caused by unsuccessful amplification of the target gene is avoided, so that the efficiency of identifying the cryptococcus molecular type is improved.

Optionally, in S101, obtaining genomic DNA of the sample to be tested includes:

grinding a sample to be detected by a liquid nitrogen grinding method; genomic DNA was extracted by standard phenol chloroform method.

The present application also uses a primer pair for identifying Cryptococcus VGIa type, which comprises a forward primer and a reverse primer, wherein the nucleotide sequence of the forward primer is shown as Seq ID No.1, and the nucleotide sequence of the reverse primer is shown as Seq ID No. 2.

Alternatively, the primer pair is used to identify position 562 of the URA5 gene sequence of cryptococcus. Specifically, the primer pair is capable of specifically recognizing the URA5 gene sequence of cryptococcus so that the 562 locus of the URA5 gene sequence is detected.

The application also provides a kit for identifying the Cryptococcus VGIa, which comprises the primer pair for identifying the Cryptococcus VGIa.

Optionally, the kit further comprises at least one of a buffer, a template DNA, deoxynucleoside triphosphate dntps, and a DNA polymerase.

In addition, the use of a primer pair as described above for identifying cryptococcus of the VGIa type in the identification of cryptococcus of the VGIa type.

Next, specific steps of the authentication method 100 provided in the present application are further described. It is to be understood that the following examples are merely illustrative of embodiments of the identification methods of the present application, wherein the specific reagent amounts or use of the apparatus may be adjusted as desired and are not to be construed as limiting the examples of the present application.

Example 1: extraction of genomic DNA

1. Test materials: sample to be measured

The sample to be tested described herein includes, but is not limited to, blood, body fluids, or lung tissue.

2. Main reagent and instrument

Reagents include, but are not limited to: liquid nitrogen, 100% alcohol, 75% alcohol, 50% alcohol, ultrapure water, DNA lysate, protease K, tris saturated phenol, chloroform, isoamyl alcohol.

Instruments include, but are not limited to: mortar, pipette, centrifuge, freeze dryer.

3. Experimental method

Get greater than 1 x 10 ⁷ After liquid nitrogen milling in a mortar, genomic DNA was extracted using standard phenol chloroform DNA extraction procedure for each test bacterial sample.

The standard phenol chloroform extraction step may include the steps of:

1) And (3) placing the ground sample to be tested into a centrifuge tube, and respectively carrying out gradient dealcoholization by using 75% alcohol, 50% alcohol and ultrapure water. The dehydration time for each gradient was 5-10min.

2) The sample to be tested after step 1) is placed in a mortar, and an appropriate amount of DNA lysate, for example 300. Mu.L, is added.

3) The ground sample to be tested is transferred into a first centrifuge tube by a pipette, and an appropriate amount of proteinase K, for example 10. Mu.L, is added into the first centrifuge tube, and the first centrifuge tube is sealed and placed into a shaker (56 ℃ C., 5 h).

4) An equal volume of Tris saturated phenol was added to the first centrifuge tube and shaken well (10 min).

5) Putting the first centrifugal tube into a centrifugal machine for centrifugation, wherein the centrifugation conditions are as follows: 12000R,7min,4 ℃. After centrifugation, the mixture is divided into an upper layer, a middle layer and a lower layer, wherein the upper layer is DNA, the middle layer is protein, and the lower layer is organic matter.

6) The supernatant was pipetted and transferred into a second centrifuge tube, to which was added 450. Mu.L of a mixture of Tris-saturated phenol, chloroform and isoamyl alcohol and shaken for 10min. Wherein, the volume ratio of each component in the mixed solution is Tris saturated phenol: chloroform: isoamyl alcohol=25: 24:1.

7) Putting the second centrifugal tube into a centrifugal machine for centrifugation, wherein the centrifugation conditions are as follows: 12000R,7min,4 ℃.

8) Sucking the supernatant into a third centrifuge tube by using a pipette, and adding 400 mu L of a mixed solution of chloroform and isoamyl alcohol in equal volume, wherein the volume ratio of each component in the mixed solution is chloroform: isoamyl alcohol=24: 1.

9) Putting the third centrifugal tube into a centrifugal machine for centrifugation, wherein the centrifugation conditions are as follows: 12000R,7min,4 ℃.

10 Pipette the supernatant into a fourth centrifuge tube, add 2.5 volumes of 100% alcohol frozen at-20 ℃. Overnight at-20 ℃.

11 Placing the fourth centrifugal tube into a centrifugal machine for centrifugation, wherein the centrifugation conditions are as follows: 12000R,7min,4 ℃.

12 A white precipitate (DNA) at the bottom of the fourth centrifuge tube was left, 400. Mu.L of 75% alcohol frozen at-20℃was added thereto, and the mixture was repeatedly blown and dissolved.

13 Repeating step 12) twice.

14 Extracting genome DNA of the sample to be detected.

Example 2: PCR amplification reaction

1. Test materials: 10 ng/. Mu.L of genomic DNA, 10. Mu.M URA5 forward primer 2. Mu.L, 0. Mu.M URA5 reverse primer 2. Mu.L.

2. Main reagent and instrument

Reagents include, but are not limited to: ultrapure water, dNTPs, a buffer solution and DNA polymerase.

3. Experimental method

The PCR amplification reaction was performed using a PCR amplification kit of Prime STAR 2X Mix from TAKARA company, and the PCR amplification process can be seen in the product instructions of the kit. In this example, the nucleotide sequence of the URA5 forward primer is shown as Seq ID No.1 and the nucleotide sequence of the URA5 reverse primer is shown as Seq ID No. 2. Wherein the concentration of URA5 forward primer is 10. Mu.M.

Example 3: agarose gel electrophoresis

The amplification products of example 2 were subjected to agarose gel electrophoresis test, and the measured electrophoresis pattern is shown in FIG. 3. The single band can be known by electrophoresis pattern, and when the single band is the electrophoresis band with 638bp size, the next step of sequencing is performed.

Example 4: sanger sequencing and site analysis

1. Test materials: amplification products.

2. Main reagent and instrument

Reagents include, but are not limited to: ultrapure water, ddNTP, DNA polymerase.

Instruments include, but are not limited to: sequencer, centrifuge.

3. Experimental method

1) Purifying the amplified product;

2) The purified amplified product is subjected to a program reaction: pre-denaturation at 96 ℃ for 2min, followed by 25 cycles of the following steps: 96 ℃ for 10s;55 ℃ for 5s; and at 60℃for 90s. Finally cooling to 4 ℃ or 15 ℃.

3) After denaturation, the sample was sent to a sequencer for sequencing.

4. Analysis and judgment of amplification result

After the sequencing result is obtained, the 562 locus of the URA5 gene is analyzed, and the cryptococcus is typed according to the sequencing result of the locus.

In other words, when the 562 site of the URA5 gene is mutated to G, cryptococcus is determined to be cryptococcus of VGIa type;

when there is no mutation at position 562 of the URA5 gene, cryptococcus is determined to be wild-type cryptococcus.

The peak patterns of gene sequencing of wild-type cryptococcus and VGIa cryptococcus at position 562 are shown in FIG. 4. As can be seen from FIG. 4, cryptococcus VGIa differs significantly from Cryptococcus wild-type at 562 site, and the 562 site is mutated to G. Again, the 562 locus of the URA5 gene proved to be effective in identifying the subtype of cryptococcus, for example, cryptococcus VGIa.

In conclusion, the cryptococcus identification method can identify subspecies of cryptococcus by analyzing specific sites of the sanger sequencing result of the URA5 gene, so that the subtype of cryptococcus can be accurately judged. More specifically, it can be determined whether or not cryptococcus belongs to the type VGIa cryptococcus, and detection of the cryptococcus subtype can be achieved. Clinical data show that pathogenicity and mortality of cryptococcus of different subtypes are obviously different, so that the method is beneficial to rapidly and accurately identifying and diagnosing the infection caused by the cryptococcus when being applied to clinic, thereby improving a treatment scheme and reducing drug abuse; the technical scheme of the application is convenient to operate and easy to popularize, and has wide application prospect.

In the description of the present specification, the descriptions of the terms "one embodiment," "one implementation," "some embodiments," "an exemplary embodiment," "an example," "a particular example," or "some examples," etc., mean that a particular feature, structure, material, or characteristic described in connection with the embodiment or example is included in at least one embodiment or example of the present application. In this specification, schematic representations of the above terms do not necessarily refer to the same embodiments or examples. Furthermore, the particular features, structures, materials, or characteristics described may be combined in any suitable manner in any one or more embodiments or examples.

Finally, it should be noted that: the above embodiments are only for illustrating the technical solution of the present application, and not for limiting the same; although the present application has been described in detail with reference to the foregoing embodiments, it should be understood by those of ordinary skill in the art that: the technical scheme described in the foregoing embodiments can be modified or some or all of the technical features thereof can be replaced by equivalents; such modifications and substitutions do not depart from the spirit of the corresponding technical solutions from the scope of the technical solutions of the embodiments of the present application.

Claims

1. A method of identifying cryptococcus, said method comprising:

obtaining genome DNA of a sample to be tested;

amplifying the URA5 gene of the genomic DNA by polymerase chain reaction PCR to obtain an amplified product;

performing sanger sequencing on the amplification product;

determining the type of the cryptococcus based on the 562-locus sequencing result of the URA5 gene.

2. The method of claim 1, wherein said determining the type of cryptococcus based on sequencing of position 562 of the URA5 gene comprises:

determining the cryptococcus as a VGIa type cryptococcus in the case that the 562 site of the URA5 gene is guanine G;

in the case where the 562 locus of the URA5 gene is adenine a, cytosine C or thymine T, the cryptococcus is determined to be a wild-type cryptococcus.

3. The method of claim 1 or 2, wherein the reactants of the PCR comprise URA5 forward primers and URA5 reverse primers; wherein the nucleotide sequence of the URA5 forward primer is shown as a Seq ID No.1, and the nucleotide sequence of the URA5 reverse primer is shown as a Seq ID No. 2.

4. The method of any one of claims 1-3, wherein after obtaining the amplification product, the method further comprises:

confirming that the URA5 gene amplification was successful.

5. The method of claim 4, wherein the success of the URA5 gene amplification is confirmed by gel electrophoresis.

6. The method of any one of claims 1-5, wherein the obtaining genomic DNA of the test sample comprises:

grinding the sample to be tested by a liquid nitrogen grinding method;

the genomic DNA was extracted by standard phenol chloroform method.

7. The method according to any one of claims 1-6, wherein the sample to be tested comprises blood and/or body fluid.

8. A primer pair for identifying cryptococcus of VGIa type, wherein the primer pair comprises a forward primer and a reverse primer, wherein the nucleotide sequence of the forward primer is shown as Seq ID No.1, and the nucleotide sequence of the reverse primer is shown as Seq ID No. 2.

9. The primer pair of claim 8, wherein the primer pair is used to recognize 562 locus of URA5 gene sequence of the cryptococcus.

10. A kit for identifying cryptococcus of VGIa type, characterized in that it comprises the primer pair of claim 8 or 9.

11. The kit of claim 10, further comprising: buffer solution, template DNA, deoxynucleoside triphosphate dNTPs and DNA polymerase.

12. Use of a primer pair according to claim 8 or 9 for the identification of cryptococcus VGIa.