CN113215303B - Molecular marker of collard epidermis waxy character and distinguishing method thereof - Google Patents

Abstract

The invention relates to a molecular marker for distinguishing the waxy character of collard epidermis, wherein the molecular marker is a restriction enzyme amplification polymorphic sequence (CAPS), and the nucleotide sequence of an upstream primer of an original sequence of the restriction enzyme amplification polymorphic sequence (CAPS) is SEQ ID NO: 1, the nucleotide sequence of the downstream primer is SEQ ID NO: 2, the application method of the molecular marker for distinguishing the waxy character of the collard epidermis comprises the following steps: (1) extracting kale genome DNA; (2) performing PCR amplification on the molecular marker; (3) the PCR product is cut by restriction enzyme Nco I; (4) and (5) detecting by agarose gel electrophoresis. The invention establishes a method for distinguishing the epidermal waxy character in any development period of the kale by applying CAPS molecular markers, and has important scientific guiding significance in identifying the epidermal waxy character of the kale and breeding new varieties.

Description

Molecular marker of collard epidermis waxy character and distinguishing method thereof

Technical Field

The invention belongs to the field of plant molecules, and particularly relates to a molecular marker of a waxy character of collard epidermis and a distinguishing method thereof, which can be used for molecular marker-assisted selective breeding of the waxy character of the collard epidermis.

Background

Kale (Brassica oleracea var. acephala) is a biennial flowering plant of the Brassica genus of the brassicaceae family. Has the advantages of bright color, various forms, strong cold resistance, long ornamental period and the like, and is an important ornamental plant in early spring, late autumn and early winter in the north. Waxes are lipophilic compounds and adhere to the surface of plants to form a hydrophobic layer. Plant leaf epidermal waxiness is a "physical barrier" against various biotic and abiotic stresses. The collard is a foliage plant, and the color of leaves is influenced by the waxy content of the epidermis of the leaves.

The molecular marker assisted breeding has the characteristics of rapid identification of target characters, time saving, low price and the like. The CAPS marker is a molecular marker technology for detecting SNP site polymorphism by combining PCR amplification and restriction enzyme digestion. The CAPS molecular marker has simple and convenient operation method and low price, and is mainly applied to aspects of plant genotyping, molecular marker-assisted selective breeding, variety identification and the like. At present, no method for distinguishing the waxy character of the kale by molecular markers exists.

Disclosure of Invention

In order to solve the problems, the invention provides a molecular marker for the waxy character of the collard epidermis and a distinguishing method thereof, which can distinguish the waxy character of the collard epidermis at any development stage and accelerate the breeding process of the collard. The invention is realized by the following technical scheme:

a molecular marker for distinguishing the waxy character of collard epidermis is characterized in that the molecular marker is a restriction enzyme amplification polymorphic sequence (CAPS), and the nucleotide sequence of an upstream primer of an original sequence of the restriction enzyme amplification polymorphic sequence (CAPS) is SEQ ID NO: 1, the nucleotide sequence of the downstream primer is SEQ ID NO: 2.

in another aspect, the present application also provides a method for distinguishing the waxy trait of the kale cuticle by using the molecular marker of claim 1, which comprises the following steps:

(1) extraction of kale genome DNA:

extracting the genomic DNA of the collard to be detected by adopting a CTAB method;

(2) PCR amplification of the original sequence:

and (3) PCR reaction system: comprises 5 mu L of 2 XTaq enzyme buffer solution, 1 mu L of DNA template, 1 mu L of upstream primer, 1 mu L of downstream primer and 2 mu L of deionized water;

and (3) PCR reaction conditions: pre-denaturation at 94 ℃ for 5 min; denaturation at 94 ℃ for 30 seconds, annealing at 54 ℃ for 30 seconds, extension at 72 ℃ for 30 seconds, 35 cycles; extension at 72 ℃ for 7 min; storing at 4 deg.C;

(3) the restriction enzyme Nco I cleaves the PCR product:

the recognition sequence of restriction enzyme Nco I is C ^ CATGG;

an enzyme digestion reaction system: 3 mul of PCR product, 0.5 mul of Nco I restriction enzyme, 2 mul of 10 Xenzyme digestion buffer solution and 14.5 mul of deionized water;

the enzyme digestion reaction conditions are as follows: carrying out enzyme digestion at 37 ℃ for 30 minutes;

(4) carrying out agarose gel electrophoresis detection on the PCR product after enzyme digestion:

after being imaged by a gel imager, the collard is the collard with less skin wax when two specific bands of 254bp and 137bp are displayed; when 391bp of a specific band is shown, the kale is more waxy in the epidermis.

Further, the method can identify the waxy character of the kale at any development stage of the kale.

In another aspect, the present application further provides a method for obtaining a molecular marker for distinguishing a waxy trait of an epidermis of kale, comprising the following steps:

(1) cultivation of kale: respectively culturing collard with more waxy cuticles and less waxy cuticles;

(2) extraction of kale genome DNA:

extracting collard genome DNA with more waxy cuticles and less waxy cuticles respectively by adopting a CTAB method;

(3) designing a full-length cloning primer of the collard waxy gene:

the full-length cloning primer comprises an upstream full-length cloning primer and a downstream full-length cloning primer, and corresponding nucleotide sequences are respectively SEQ ID NO: 3 and SEQ ID NO: 4;

(4) and (3) PCR amplification:

and (3) PCR reaction system: comprises 5 mu L of 2 XHi-Fi Taq enzyme buffer solution, 1 mu L of upstream full-length cloning primer, 1 mu L of downstream full-length cloning primer, 1 mu L of DNA template, 2 mu L of deionized water and 10 mu L of total;

and (3) PCR reaction conditions: pre-denaturation at 98 ℃ for 3 min; denaturation at 98 ℃ for 10 seconds, annealing at 54 ℃ for 50 seconds, extension at 72 ℃ for 2 minutes, 35 cycles; extension at 72 ℃ for 7 min; storing at 4 deg.C;

(5) agarose gel electrophoresis:

detecting the PCR product by using 1% agarose gel electrophoresis, and observing the position of a strip by using a gel imager;

(6) recovering an amplification product;

(7) recovering the product, connecting with a cloning vector, and transforming escherichia coli;

(8) sequencing:

the nucleotide sequence of the leaf epidermis waxy kale is determined to be SEQ ID NO: 5, the nucleotide sequence of the leaf epidermis waxy kale is SEQ ID NO: 6;

(9) synthesis of molecular markers for distinguishing epidermal waxy traits of kale leaves

According to the nucleotide sequence of SEQ ID NO: 5 and SEQ ID NO: 6, determining the restriction enzyme cutting site as C ^ CATGG; designing and synthesizing an upstream primer nucleotide sequence SEQ ID NO: 1 and the downstream primer nucleotide sequence SEQ ID NO: 2.

furthermore, the high-fidelity Taq enzyme buffer solution contains 0.2U, dNTPs1 mu M of high-fidelity Taq enzyme and magnesium ions.

Compared with the prior art, the invention has the following advantages:

the method is established by applying the CAPS molecular marker, under the condition of not being influenced by the development stage, the waxy character of the collard epidermis is distinguished in an early stage, and the breeding process is accelerated. Has important scientific guiding significance for identifying the content of the cuticular wax of the kale and breeding new varieties.

Drawings

In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the embodiments or the prior art will be briefly described below, and it is obvious that the drawings in the following description are some embodiments of the present invention, and those skilled in the art can also obtain other drawings according to the drawings without creative efforts.

FIG. 1 is a top view of a kale inbred line 'S0835';

FIG. 2 is a top view of a kale inbred line 'F0819';

FIG. 3 is the agarose gel electrophoresis assay of example 2;

FIG. 4 is a top view of a kale variety 'gull';

FIG. 5 is a photograph of agarose gel electrophoresis detection of example 4;

fig. 6 is a top view of the 'sunrise' of kale variety.

Detailed Description

In order to make the objects, technical solutions and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below with reference to the drawings in the embodiments of the present invention, and it is obvious that the described embodiments are some, but not all, embodiments of the present invention. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention.

The inventor constructs a genetic segregation population by using a high-generation inbred line 'S0835' of the kale with more waxy epidermis and a high-generation inbred line 'F0819' of the kale with less waxy epidermis in the earlier stage, identifies a waxy related gene through fine positioning, distinguishing, cloning and functional verification of chromosomes, and provides a theoretical basis for breeding waxy characters of the kale by mining the waxy related functional gene.

The method for cultivating the collard inbred lines 'S0835' and 'F0819' sowing seedlings is as follows;

the 'S0835' takes a kale variety 'Red Peacock' as an original resource, and adopts a continuous selfing method to perform continuous selfing for 7 generations to obtain a surface waxy multi-selfing line 'S0835';

the 'F0819' takes a kale variety 'Red cane' as an original resource, and a continuous selfing method is adopted to obtain an epidermis waxy little selfing line 'F0819' after continuous selfing for 7 generations.

Example 1:

1.1 obtaining molecular markers

(1) Cultivation of kale: cultivating collard epidermis waxy multi-inbred line 'S0835' and epidermis waxy few inbred line 'F0819' sowing seedlings by adopting a conventional method;

(2) extraction of kale genome DNA

The DNA of 'S0835' and 'F0819' is respectively extracted by a CTAB method, which comprises the following steps:

0.15g of leaves are fully ground under the protection of liquid nitrogen, then are quickly transferred to a 2mL centrifuge tube, and 700 mu L of 2% beta mercaptoethanol-CTAB extract preheated at 65 ℃ is added. The mixture was incubated in a water bath at 65 ℃ for 1 hour with gentle shaking every 10 minutes.

② cooling for 30 minutes at room temperature, adding 700 mu L of chloroform/isoamylol (24: 1) mixed solution, fully shaking and mixing uniformly, 12000r, centrifuging for 7 minutes.

③ 400 mu L of the supernatant is put into a new centrifugal tube with 1.5mL, added with 800 mu L of isopropanol (precooling at minus 20 ℃) and placed at minus 20 ℃ for standing for 1 hour.

Fourthly, centrifuging the mixture for 7 minutes at 12000r, and then removing the supernatant.

Fifthly, 700 mu L of 75% ethanol (precooled at minus 20 ℃) is added to wash the DNA, and the DNA is centrifuged for 2 minutes at 12000r, and the supernatant is discarded.

Sixthly, repeating the step five times. Air drying at room temperature, adding TE to constant volume to 50 μ L, and storing at-20 deg.C.

(3) Designing a full-length cloning primer of the collard waxy gene:

downloading a Bo9g184810 gene sequence in a cabbage database (http:// plants. ensemble. org/Brassica _ oleracea/Info/Index), and designing a full-length sequence amplification primer of the gene, wherein the primer sequence is as follows:

an upstream primer F: atgtctcctaacgattcaaaaaac

A downstream primer R: ttaaggagaggtatcttggaac

(4) PCR amplification

And (3) PCR reaction system: comprises 5 mu L of 2 Xhigh fidelity Taq enzyme buffer solution (containing 0.2U, dNTPs1 mu M of high fidelity Taq enzyme and magnesium ions), 1 mu L of DNA template, 1 mu L of upstream primer, 1 mu L of downstream primer and 2 mu L of deionized water;

and (3) PCR reaction conditions: pre-denaturation at 98 ℃ for 3 min; denaturation at 98 ℃ for 10 seconds, annealing at 54 ℃ for 30 seconds, extension at 72 ℃ for 2 minutes, 35 cycles; extension at 72 ℃ for 7 min; storing at 4 deg.C;

(5) agarose gel electrophoresis detection

The PCR product was detected by electrophoresis on a 1% agarose gel and the bands were visualized by a gel imager.

(6) Amplification product recovery

Recovering by using an agarose gel recovery kit;

(7) recovering the product, connecting with a cloning vector, transforming escherichia coli, and extracting plasmids;

(8) sequencing: sequencing the plasmid connected with the cloning vector, and determining the full-length sequence of the parents as follows:

>S0835

atgtctccta acgattcaaa aaacagagcc ggttttctta actctcttgc ttcttccatc accaacttcg ggtcggtcat gaataaatca gttaatgggt aataactaat aagcataagg attgtgtttt atggataaag cagtgctgtt tgatgagaaa tgtttgcttg tttcttttct cagtttgatg ggatatgaag ggatagaagt catcaatcca gatggaagta cagaagaagc agaggaggaa gcaggaagag gaagatggaa gcaagaggta tatacaactg tttattttat catcttctaa aaaaaaaaga ttttaccaga atggtaataa taattactaa ttttgaattg ttcaacgtgc ctctctgagt ttctatgttt ggatgatttc tctcaggagc gtgatggata ttggaagatg atgcaaaagt atataggatc tgatattaca tccatggtga ctcttcctgt gattattttt gaacccatga cgacgctaca gaaaatggca gaggttttgt acatgttctt atattacaca tttacatgaa gctctctttt gagctgaatt attatgtata tttattttac ccattttgtt gtaacctctc attagttgat ggaatactcg catctgctgg atatggctga caaaacccaa gacccttaca tgcgcatggt atatgcatgt aagcacattc acattccttc cttgtgtttt caaactctgt atacctcttg agtcttggct aactatttaa aaataataat aatatcgaac agcaacatgg gctatatctg tgtattatgc ctaccaacgt acatggaagc cgttcaatcc aatcctcggt gaaacttacg agatgactaa ccataatggg attaatttta tagctgaaca ggtgagtcgt ttctttacaa ctcttattgt actttgtctg agatgtaaat atcattagtt ttttgttgat atattgatgt ttaatttgtt cctcaggtca gccatcaccc gccaatgagt gctgctcacg cagagaacga gcatttctct tacgactgca cttcaaagct gaaatcgaaa ttactaggca attcaatcga cttctacccc gtaggaaggt agggtaactt ctcctactgt aatgtaactg accacaaatt cttagtgttt agattttata atgtatctat aggacaagag tgacacttaa aagagatggt gtggttcttg atcttgtgcc tcctccgacc aaggctcata accttatctt cggacgaaca tgggtcgatt cttcaggaga gatgatcatg accaacctca ccactggtga caaagcggtg ctttactttc aaccatgtgg ctggtttggg taatttaact tctttcctca tcacacttct tttgacctaa tactggagct gaattttttg acctaatgga cagatctggc cgttatgagg tggatggata cgtgtataat tcagctgaag agcccaagat actagtgacc ggtaaatgga acgagtcctt gagttatcag gcttgtgaca ctgaaggcga acctcttaca ggcaccgaac taaaagaggt tgtctcaata ttctattctt agcagaaaaa aaaaaaaaga ttttgttaca agtatttaga ctatgttaca ttcccacagg tatggaaggt cgctgaagct ccagagaagg ataaatacca atacacacat tttgctcaca agatcaatag ctttgacact gcccctagta agctattgtc atctgattca cgtctacgtc ctgatagata cgccctcgac actggcgata tgaccaaagc tggttatgaa aagagcaggt aaaccatata taggcttttt agtcatcatc cccaaagtaa ttttaaagac taaataaaat cctggttttt tttgtttctc agcctagagg agagacaaag agctgagaag agaacccgag aagagaaagg ccaacgattt gttccgaaat ggtttgatga aaccgaggaa gttactccca cgcaatgggg ggacctcgaa gtgtaccaat tcaatggtaa gtacttggtc caccgcgctg cagcggataa ctccgagatt aacaccgata tggagtcaac caaattcaac ccttggcagt tccaagatac ctctccttaa

>F0819

atgtctccta acgattcaaa aaacagagcc ggttttctta actctcttgc ttcttccatc accaacttcg ggtcggtcat gacgaaatca gttaatgggt aataactaat aagcataagg attgtgtttt atggataaag cagtgttgtg tgatgagaaa tgtttgcttg tttcttttct cagtttgatg ggatatgaag ggatagaagt catcaatcca gatggaagta cagaagatgc agaggaggaa gcaggaagag gaagatggaa gcaagaggta tatacaactg tttattttat catcttctaa aaaaaaaaga ttttaccaga atggtaataa taattactaa ttttgaattg ttcaacgtgc ctctctgagt ttctatgttt ggatgatttc tctcaggagc gtgatggata ttggaagatg atgcaaaagt atataggatc tgatattaca tccatggtga ctcttcctgt gatcattttt gaacccatga cgacgctaca gaaaatggca gaggttttgt acatgttctt atattacaca tttacatgaa agctctcttt tgagctgaat tattatgtat atttatttta cccattttgt tgtaacctct cgttagttga tggaatactc gcatctgctg gatatggctg acaaaaccca agacccttac atgcgcatgg tatatgcatg taagcacatt cacattcctt ccttgtgttt tcaaactctg tatacctctt gagtcttggc taactattta aaaataataa taatatcgaa cagcaacatg ggctatatct gtgtattatg cctaccaacg tacatggaag ccgttcaatc caatcctcgg tgaaacttac gagatgacta accacattgg gattaatttt atagctgaac aggtgagtcg tttctttaca actcttattg tactttgtct gaaatgtaaa gatcattagt tttttgttga tatattgacg tttaatttgt tcctcaggtc agccatcacc cgccaatgag tgctgctcac gcagagaacg agcatttctc ttacgactgc acttcaaagc tgaaatcgaa attactaggc aattcaatcg acttctaccc cgtaggaagg tagggtaact tctcctactg taatgtaact gaccacaaat tcttagtgtt tagattttat aatgtatcta taggacaaga gtgacactta aaagagatgg tgtggttctt gatcttgtgc ctcctccgac aaaggctcat aaccttatct tcggacgaac atgggtcgat tcttcaggag agatgatcat gaccaacctc accactggtg acaaagcggt gctttacttt caaccatgtg gctggtttgg gtaatttaac ttctttcctc atcacacttc ttttgaccta atactggagc tgaatttttt gacctaatgg acagatctgg ccgttatgag gtagatggat acgtgtataa ttcagctgaa gagcccaaga tactagtgac cggtaaatgg aacgagtcct tgagttatca ggcttgtgac actgaaggcg aacctcttac aggcaccgaa ctaaaagagg ttgtgtcaat attctattct tagcagaaaa aaaaaaagaa aaagattttg ttacaagtat ttagactatg ttacattccc acaggtatgg aaggtcgctg aagctccaga gaaggataaa taccaataca cacattttgc tcacaagatc aatagctttg acactgcccc tagtaagcta ttgtcatctg attcacgtct acgtcctgat agatatgccc tcgacactgg cgatatgacc aaagctggtt atgaaaagag caggtaaacc atatataggc tttttggtca tcatccccaa agtaatttta aagactaaat aaaatcctgg ttttttttgt ttctcagcct agaggagaga caaagagctg agaagagaac ccgagaagag aaaggccaac gatttgttcc gaaatggttt gatgaaaccg aggacgttac tcccacgcca tggggggacc tcgaagtgta ccaattcaat ggtaagtact tggtccaccg cgctgcagcg gataactccg agattaacac cgatatggag tcgaccaaat tcaacccttg gcagttccaa gatacctctc cttaa

(9) synthesis of molecular markers for distinguishing epidermal waxy traits of kale

Comparing the difference sites by Multalin online software (http:// Multalin. toulouse. inra. fr/Multalin /) according to the nucleotide sequence shown obtained in step (8); zero mismatch is introduced into a sequence containing a differential site at dCAPS Finder2.0(http:// helix.wustl.edu/dCAPS/dcaps.html), and the enzyme cutting site is determined to be C ^ CATGG; two oligonucleotide primers CAPS _ F and CAPS _ R were designed and synthesized, i.e. a molecular marker for distinguishing the cuticular wax of kale, CAPS _ F: acgtctacgtcctgatagatac (SEQ ID NO: 1), CAPS _ R: ttaaggagaggtatcttggaac (SEQ ID NO: 2).

1.2 applications of molecular markers

The waxy character of the collard epidermis can be distinguished in the early development stage. The use method of the molecular marker comprises the following steps:

(1) extraction of kale genome DNA

Extracting kale genome DNA by a CTAB method, which comprises the following steps:

0.15g of leaves are fully ground under the protection of liquid nitrogen, then are quickly transferred to a 2mL centrifuge tube, and 700 mu L of 2% beta mercaptoethanol-CTAB extract preheated at 65 ℃ is added. The mixture was incubated in a water bath at 65 ℃ for 1 hour with gentle shaking every 10 minutes.

② cooling for 30 minutes at room temperature, adding 700 mu L of chloroform/isoamylol (24: 1) mixed solution, fully shaking and mixing uniformly, 12000r, centrifuging for 7 minutes.

③ 400 mu L of the supernatant is put into a new centrifugal tube with 1.5mL, added with 800 mu L of isopropanol (precooling at minus 20 ℃) and placed at minus 20 ℃ for standing for 1 hour.

Fourthly, centrifuging the mixture for 7 minutes at 12000r, and then removing the supernatant.

Fifthly, 700 mu L of 75% ethanol (precooled at minus 20 ℃) is added to wash the DNA, and the DNA is centrifuged for 2 minutes at 12000r, and the supernatant is discarded.

Sixthly, repeating the step five times. Air drying at room temperature, adding TE to constant volume to 50 μ L, and storing at-20 deg.C.

(2) PCR amplification

And (3) PCR reaction system: comprises 5 mu L of 2 XTaq enzyme buffer solution (containing 0.2U, dNTPs1 mu M Taq enzyme and magnesium ions), 1 mu L of DNA template, 1 mu L of CAPS _ F primer, 1 mu L of CAPS _ R primer and 2 mu L deionized water;

and (3) PCR reaction conditions: pre-denaturation at 94 ℃ for 5 min; denaturation at 94 ℃ for 30 seconds, annealing at 54 ℃ for 30 seconds, extension at 72 ℃ for 30 seconds, 35 cycles; extension at 72 ℃ for 7 min; storing at 4 deg.C;

an enzyme digestion reaction system: 3 mul of PCR product, 0.5 mul of Nco I restriction enzyme, 2 mul of 10 Xenzyme digestion buffer solution and 14.5 mul of deionized water;

and (3) enzyme digestion reaction program: the digestion was carried out at 37 ℃ for 30 minutes.

(3) Agarose gel electrophoresis detection

And detecting the PCR product by using 2% agarose gel electrophoresis, observing the position of the strip by using a gel imager and storing the picture, wherein the two specific strips of 254bp and 137bp are the cuticular waxy little kale, and the specific strip of 391bp is the cuticular waxy multiple kale.

Example 2:

the molecular marker is verified to be a specific molecular marker of the kale epidermis waxy few variety 'Gull' (White Gull).

The specific method comprises the following steps:

(1) cultivation of kale: sowing the variety 'white gull' seeds with little waxy cuticle of kale.

Preparing a 120-hole plug, filling the plug with a substrate, lightly compacting, soaking the substrate with water, dibbling one seed in each hole, covering, placing in an environment at 25 ℃, and allowing seedling emergence for 3 days.

(2) Detection of CAPS molecular markers:

extracting kale genome DNA

Extracting kale genome DNA by a CTAB method, which comprises the following steps:

a.0.15g of leaves are fully ground under the protection of liquid nitrogen, then are quickly transferred to a 2mL centrifuge tube, and 700 mu L of 2% beta mercaptoethanol-CTAB extract preheated at 65 ℃ is added. The mixture was incubated in a water bath at 65 ℃ for 1 hour with gentle shaking every 10 minutes.

B. After cooling at room temperature for 30 minutes, 700. mu.L of a chloroform/isoamyl alcohol (24: 1) mixture was added thereto, and the mixture was sufficiently shaken and mixed, and centrifuged at 12000r for 7 minutes.

C. mu.L of the supernatant was transferred to a new 1.5mL centrifuge tube, 800. mu.L of isopropanol was added (-20 ℃ precooled), and the tube was left to stand at-20 ℃ for 1 hour.

D. The mixture was centrifuged at 12000r for 7 minutes and the supernatant was discarded.

E. Add 700. mu.L of 75% ethanol (-20 ℃ Pre-cooled) to wash the DNA, centrifuge at 12000r for 2 min, and discard the supernatant.

F. Repeating step E once. Air drying at room temperature, adding TE to constant volume to 50 μ L, and storing at-20 deg.C.

② PCR amplification

And (3) PCR reaction system: comprises 5 mu L of 2 XTaq enzyme buffer solution (containing 0.2U, dNTPs1 mu M Taq enzyme and magnesium ions), 1 mu L of DNA template, 1 mu L of CAPS _ F primer, 1 mu L of CAPS _ R primer and 2 mu L deionized water;

and (3) PCR reaction conditions: pre-denaturation at 94 ℃ for 5 min; denaturation at 94 ℃ for 30 seconds, annealing at 54 ℃ for 30 seconds, extension at 72 ℃ for 30 seconds, 35 cycles; extension at 72 ℃ for 7 min; storing at 4 deg.C;

an enzyme digestion reaction system: 3 mul of PCR product, 0.5 mul of Nco I restriction enzyme, 2 mul of 10 Xenzyme digestion buffer solution and 14.5 mul of deionized water;

and (3) enzyme digestion reaction program: the digestion was carried out at 37 ℃ for 30 minutes.

Thirdly, agarose gel electrophoresis detection: and (3) carrying out 2% agarose gel electrophoresis on the PCR product subjected to enzyme digestion, and taking an electrophoresis picture by using a gel imager. The collard cuticle waxy cultivar-poor 'gull' sequence can be recognized by restriction enzyme Nco I and cut into specific bands of 254bp and 137bp (see FIG. 3).

(3) Application of CAPS molecular marker: CAPS molecular marker successfully tested that the waxy content in the epidermis of the kale with less waxy cuticle of the variety 'Laribacter albuginea' (FIG. 4).

Example 3:

the molecular marker is verified to be a specific molecular marker of collard epidermal waxy multiple varieties 'Sunrise' (Sunrise).

The specific method comprises the following steps:

(1) cultivation of kale: and (3) sowing waxy multi-variety sunrise seeds on the surface of the kale.

Preparing a plug tray with 120 holes, filling the plug tray with a substrate, lightly compacting the plug tray, soaking the substrate with water, dibbling one seed in each hole, covering soil, and standing at 25 ℃ for 3 days to obtain seedlings.

(2) Detection of CAPS molecular markers:

extracting kale genome DNA

Extracting kale genome DNA by a CTAB method, which comprises the following steps:

a.0.15g of leaves are fully ground under the protection of liquid nitrogen, then are quickly transferred to a 2mL centrifuge tube, and 700 mu L of 2% beta mercaptoethanol-CTAB extract preheated at 65 ℃ is added. The mixture was incubated in a water bath at 65 ℃ for 1 hour with gentle shaking every 10 minutes.

B. After cooling at room temperature for 30 minutes, 700. mu.L of a chloroform/isoamyl alcohol (24: 1) mixture was added thereto, and the mixture was sufficiently shaken and mixed, and centrifuged at 12000r for 7 minutes.

C. mu.L of the supernatant was transferred to a new 1.5mL centrifuge tube, 800. mu.L of isopropanol was added (-20 ℃ precooled), and the tube was left to stand at-20 ℃ for 1 hour.

D. The mixture was centrifuged at 12000r for 7 minutes and the supernatant was discarded.

E. Add 700. mu.L of 75% ethanol (-20 ℃ Pre-cooled) to wash the DNA, centrifuge at 12000r for 2 min, and discard the supernatant.

F. Repeating step E once. Air drying at room temperature, adding TE to constant volume to 50 μ L, and storing at-20 deg.C.

② PCR amplification

And (3) PCR reaction system: comprises 5 mu L of 2 XTaq enzyme buffer solution (containing 0.2U, dNTPs1 mu M Taq enzyme and magnesium ions), 1 mu L of DNA template, 1 mu L of CAPS _ F primer, 1 mu L of CAPS _ R primer and 2 mu L deionized water;

and (3) PCR reaction conditions: pre-denaturation at 94 ℃ for 5 min; denaturation at 94 ℃ for 30 seconds, annealing at 54 ℃ for 30 seconds, extension at 72 ℃ for 30 seconds, 35 cycles; extension at 72 ℃ for 7 min; storing at 4 deg.C;

an enzyme digestion reaction system: 3 mul of PCR product, 0.5 mul of Nco I restriction enzyme, 2 mul of 10 Xenzyme digestion buffer solution and 14.5 mul of deionized water;

and (3) enzyme digestion reaction program: the digestion was carried out at 37 ℃ for 30 minutes.

Thirdly, agarose gel electrophoresis detection: and (3) carrying out 2% agarose gel electrophoresis on the PCR product subjected to enzyme digestion, and taking an electrophoresis picture by using a gel imager. The waxy varieties of the collard cuticle 'sunrise' can not be recognized and cut by the restriction enzyme Nco I, and a specific band of 391bp is generated (FIG. 5).

(3) Application of CAPS molecular marker: by using the CAPS molecular marker, the skin wax content of the collard skin wax varieties 'sunrise' was successfully tested (fig. 6).

Finally, it should be noted that: the above examples are only intended to illustrate the technical solution of the present invention, but not to limit it; although the present invention has been described in detail with reference to the foregoing embodiments, it will be understood by those of ordinary skill in the art that: the technical solutions described in the foregoing embodiments may still be modified, or some technical features may be equivalently replaced; and such modifications or substitutions do not depart from the spirit and scope of the corresponding technical solutions of the embodiments of the present invention.

Sequence listing

<110> Shenyang agriculture university

Molecular marker of <120> collard epidermal waxy character and distinguishing method thereof

<160> 6

<170> SIPOSequenceListing 1.0

<210> 1

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

acgtctacgt cctgatagat ac 22

<210> 2

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

ttaaggagag gtatcttgga ac 22

<210> 3

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

atgtctccta acgattcaaa aaac 24

<210> 4

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

ttaaggagag gtatcttgga ac 22

<210> 5

<211> 2180

<212> DNA

<213> kale (Brassica oleracea)

<400> 5

atgtctccta acgattcaaa aaacagagcc ggttttctta actctcttgc ttcttccatc 60

accaacttcg ggtcggtcat gaataaatca gttaatgggt aataactaat aagcataagg 120

attgtgtttt atggataaag cagtgctgtt tgatgagaaa tgtttgcttg tttcttttct 180

cagtttgatg ggatatgaag ggatagaagt catcaatcca gatggaagta cagaagaagc 240

agaggaggaa gcaggaagag gaagatggaa gcaagaggta tatacaactg tttattttat 300

catcttctaa aaaaaaaaga ttttaccaga atggtaataa taattactaa ttttgaattg 360

ttcaacgtgc ctctctgagt ttctatgttt ggatgatttc tctcaggagc gtgatggata 420

ttggaagatg atgcaaaagt atataggatc tgatattaca tccatggtga ctcttcctgt 480

gattattttt gaacccatga cgacgctaca gaaaatggca gaggttttgt acatgttctt 540

atattacaca tttacatgaa gctctctttt gagctgaatt attatgtata tttattttac 600

ccattttgtt gtaacctctc attagttgat ggaatactcg catctgctgg atatggctga 660

caaaacccaa gacccttaca tgcgcatggt atatgcatgt aagcacattc acattccttc 720

cttgtgtttt caaactctgt atacctcttg agtcttggct aactatttaa aaataataat 780

aatatcgaac agcaacatgg gctatatctg tgtattatgc ctaccaacgt acatggaagc 840

cgttcaatcc aatcctcggt gaaacttacg agatgactaa ccataatggg attaatttta 900

tagctgaaca ggtgagtcgt ttctttacaa ctcttattgt actttgtctg agatgtaaat 960

atcattagtt ttttgttgat atattgatgt ttaatttgtt cctcaggtca gccatcaccc 1020

gccaatgagt gctgctcacg cagagaacga gcatttctct tacgactgca cttcaaagct 1080

gaaatcgaaa ttactaggca attcaatcga cttctacccc gtaggaaggt agggtaactt 1140

ctcctactgt aatgtaactg accacaaatt cttagtgttt agattttata atgtatctat 1200

aggacaagag tgacacttaa aagagatggt gtggttcttg atcttgtgcc tcctccgacc 1260

aaggctcata accttatctt cggacgaaca tgggtcgatt cttcaggaga gatgatcatg 1320

accaacctca ccactggtga caaagcggtg ctttactttc aaccatgtgg ctggtttggg 1380

taatttaact tctttcctca tcacacttct tttgacctaa tactggagct gaattttttg 1440

acctaatgga cagatctggc cgttatgagg tggatggata cgtgtataat tcagctgaag 1500

agcccaagat actagtgacc ggtaaatgga acgagtcctt gagttatcag gcttgtgaca 1560

ctgaaggcga acctcttaca ggcaccgaac taaaagaggt tgtctcaata ttctattctt 1620

agcagaaaaa aaaaaaaaga ttttgttaca agtatttaga ctatgttaca ttcccacagg 1680

tatggaaggt cgctgaagct ccagagaagg ataaatacca atacacacat tttgctcaca 1740

agatcaatag ctttgacact gcccctagta agctattgtc atctgattca cgtctacgtc 1800

ctgatagata cgccctcgac actggcgata tgaccaaagc tggttatgaa aagagcaggt 1860

aaaccatata taggcttttt agtcatcatc cccaaagtaa ttttaaagac taaataaaat 1920

cctggttttt tttgtttctc agcctagagg agagacaaag agctgagaag agaacccgag 1980

aagagaaagg ccaacgattt gttccgaaat ggtttgatga aaccgaggaa gttactccca 2040

cgcaatgggg ggacctcgaa gtgtaccaat tcaatggtaa gtacttggtc caccgcgctg 2100

cagcggataa ctccgagatt aacaccgata tggagtcaac caaattcaac ccttggcagt 2160

tccaagatac ctctccttaa 2180

<210> 6

<211> 2185

<212> DNA

<213> kale (Brassica oleracea)

<400> 6

atgtctccta acgattcaaa aaacagagcc ggttttctta actctcttgc ttcttccatc 60

accaacttcg ggtcggtcat gacgaaatca gttaatgggt aataactaat aagcataagg 120

attgtgtttt atggataaag cagtgttgtg tgatgagaaa tgtttgcttg tttcttttct 180

cagtttgatg ggatatgaag ggatagaagt catcaatcca gatggaagta cagaagatgc 240

agaggaggaa gcaggaagag gaagatggaa gcaagaggta tatacaactg tttattttat 300

catcttctaa aaaaaaaaga ttttaccaga atggtaataa taattactaa ttttgaattg 360

ttcaacgtgc ctctctgagt ttctatgttt ggatgatttc tctcaggagc gtgatggata 420

ttggaagatg atgcaaaagt atataggatc tgatattaca tccatggtga ctcttcctgt 480

gatcattttt gaacccatga cgacgctaca gaaaatggca gaggttttgt acatgttctt 540

atattacaca tttacatgaa agctctcttt tgagctgaat tattatgtat atttatttta 600

cccattttgt tgtaacctct cgttagttga tggaatactc gcatctgctg gatatggctg 660

acaaaaccca agacccttac atgcgcatgg tatatgcatg taagcacatt cacattcctt 720

ccttgtgttt tcaaactctg tatacctctt gagtcttggc taactattta aaaataataa 780

taatatcgaa cagcaacatg ggctatatct gtgtattatg cctaccaacg tacatggaag 840

ccgttcaatc caatcctcgg tgaaacttac gagatgacta accacattgg gattaatttt 900

atagctgaac aggtgagtcg tttctttaca actcttattg tactttgtct gaaatgtaaa 960

gatcattagt tttttgttga tatattgacg tttaatttgt tcctcaggtc agccatcacc 1020

cgccaatgag tgctgctcac gcagagaacg agcatttctc ttacgactgc acttcaaagc 1080

tgaaatcgaa attactaggc aattcaatcg acttctaccc cgtaggaagg tagggtaact 1140

tctcctactg taatgtaact gaccacaaat tcttagtgtt tagattttat aatgtatcta 1200

taggacaaga gtgacactta aaagagatgg tgtggttctt gatcttgtgc ctcctccgac 1260

aaaggctcat aaccttatct tcggacgaac atgggtcgat tcttcaggag agatgatcat 1320

gaccaacctc accactggtg acaaagcggt gctttacttt caaccatgtg gctggtttgg 1380

gtaatttaac ttctttcctc atcacacttc ttttgaccta atactggagc tgaatttttt 1440

gacctaatgg acagatctgg ccgttatgag gtagatggat acgtgtataa ttcagctgaa 1500

gagcccaaga tactagtgac cggtaaatgg aacgagtcct tgagttatca ggcttgtgac 1560

actgaaggcg aacctcttac aggcaccgaa ctaaaagagg ttgtgtcaat attctattct 1620

tagcagaaaa aaaaaaagaa aaagattttg ttacaagtat ttagactatg ttacattccc 1680

acaggtatgg aaggtcgctg aagctccaga gaaggataaa taccaataca cacattttgc 1740

tcacaagatc aatagctttg acactgcccc tagtaagcta ttgtcatctg attcacgtct 1800

acgtcctgat agatatgccc tcgacactgg cgatatgacc aaagctggtt atgaaaagag 1860

caggtaaacc atatataggc tttttggtca tcatccccaa agtaatttta aagactaaat 1920

aaaatcctgg ttttttttgt ttctcagcct agaggagaga caaagagctg agaagagaac 1980

ccgagaagag aaaggccaac gatttgttcc gaaatggttt gatgaaaccg aggacgttac 2040

tcccacgcca tggggggacc tcgaagtgta ccaattcaat ggtaagtact tggtccaccg 2100

cgctgcagcg gataactccg agattaacac cgatatggag tcgaccaaat tcaacccttg 2160

gcagttccaa gatacctctc cttaa 2185

Claims (6)

1. The molecular marker for distinguishing the waxy character of the collard epidermis is characterized in that the molecular marker is a restriction amplification polymorphism sequence (CAPS), and the nucleotide sequence of an upstream primer of an original sequence of the restriction amplification polymorphism sequence (CAPS) is SEQ ID NO: 1, the nucleotide sequence of the downstream primer is SEQ ID NO: 2.

2. the method for distinguishing the waxy trait of the collard cuticle by using the molecular marker according to claim 1, which comprises the following steps:

(1) extraction of kale genome DNA:

extracting the genomic DNA of the collard to be detected by adopting a CTAB method;

(2) PCR amplification of the original sequence:

and (3) PCR reaction system: comprises 5 mu L of 2 XTaq enzyme buffer solution, 1 mu L of DNA template, 1 mu L of upstream primer, 1 mu L of downstream primer and 2 mu L of deionized water;

and (3) PCR reaction conditions: pre-denaturation at 94 ℃ for 5 min; denaturation at 94 ℃ for 30 seconds, annealing at 54 ℃ for 30 seconds, extension at 72 ℃ for 30 seconds, 35 cycles; extension at 72 ℃ for 7 min; storing at 4 deg.C;

(3) the restriction enzyme Nco I cleaves the PCR product:

the recognition sequence of restriction enzyme Nco I is C ^ CATGG;

an enzyme digestion reaction system: 3 mul of PCR product, 0.5 mul of Nco I restriction enzyme, 2 mul of 10 Xenzyme digestion buffer solution and 14.5 mul of deionized water;

the enzyme digestion reaction conditions are as follows: carrying out enzyme digestion at 37 ℃ for 30 minutes;

(4) carrying out agarose gel electrophoresis detection on the PCR product after enzyme digestion:

after being imaged by a gel imager, the collard is the collard with less skin wax when two specific bands of 254bp and 137bp are displayed; when 391bp of a specific band is shown, the kale is more waxy in the epidermis.

3. The method according to claim 2, wherein the Taq enzyme buffer comprises 0.2U, dNTPs1 μ M Taq enzyme and magnesium ions.

4. The method of claim 2 or 3, wherein the method identifies the waxy trait of kale at any stage of its development.

5. A method for obtaining a molecular marker for distinguishing the waxy character of the collard epidermis is characterized by comprising the following steps:

(1) cultivation of kale: respectively culturing collard with more waxy cuticles and less waxy cuticles;

(2) extraction of kale genome DNA:

extracting collard genome DNA with more waxy cuticles and less waxy cuticles respectively by adopting a CTAB method;

(3) designing a full-length cloning primer of the collard waxy gene:

the full-length cloning primer comprises an upstream full-length cloning primer and a downstream full-length cloning primer, and corresponding nucleotide sequences are respectively SEQ ID NO: 3 and SEQ ID NO: 4;

(4) and (3) PCR amplification:

and (3) PCR reaction system: comprises 5 mu L of 2 XHi-Fi Taq enzyme buffer solution, 1 mu L of upstream full-length cloning primer, 1 mu L of downstream full-length cloning primer, 1 mu L of DNA template, 2 mu L of deionized water and 10 mu L of total;

and (3) PCR reaction conditions: pre-denaturation at 98 ℃ for 3 min; denaturation at 98 ℃ for 10 seconds, annealing at 54 ℃ for 50 seconds, extension at 72 ℃ for 2 minutes, 35 cycles; extension at 72 ℃ for 7 min; storing at 4 deg.C;

(5) agarose gel electrophoresis:

detecting the PCR product by using 1% agarose gel electrophoresis, and observing the position of a strip by using a gel imager;

(6) recovering an amplification product;

(7) recovering the product, connecting with a cloning vector, and transforming escherichia coli;

(8) sequencing:

the nucleotide sequence of the leaf epidermis waxy kale is determined to be SEQ ID NO: 5, the nucleotide sequence of the leaf epidermis waxy kale is SEQ ID NO: 6;

(9) synthesis of molecular markers for distinguishing epidermal waxy traits of kale leaves

According to the nucleotide sequence of SEQ ID NO: 5 and SEQ ID NO: 6, determining the restriction enzyme cutting site as C ^ CATGG; designing and synthesizing an upstream primer nucleotide sequence SEQ ID NO: 1 and the downstream primer nucleotide sequence SEQ ID NO: 2.

6. the method for obtaining the molecular marker for distinguishing the waxy trait of the kale epidermis of claim 5, wherein the high fidelity Taq enzyme buffer solution contains 0.2U, dNTPs1 μ M high fidelity Taq enzyme and magnesium ions.

Images