CN111321237B - SSR marker-based efficient breeding kit for 'Hui' self-fruitful progeny - Google Patents
SSR marker-based efficient breeding kit for 'Hui' self-fruitful progeny Download PDFInfo
- Publication number
- CN111321237B CN111321237B CN201911200051.8A CN201911200051A CN111321237B CN 111321237 B CN111321237 B CN 111321237B CN 201911200051 A CN201911200051 A CN 201911200051A CN 111321237 B CN111321237 B CN 111321237B
- Authority
- CN
- China
- Prior art keywords
- self
- molecular marker
- fruitfulness
- ssr
- progeny
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/13—Plant traits
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Molecular Biology (AREA)
- Physics & Mathematics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Genetics & Genomics (AREA)
- Immunology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Botany (AREA)
- Mycology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to an efficient breeding kit of 'preferential' self-fruitfulness offspring based on SSR markers, and discloses an SSR molecular marker Ch04d02 related to 'preferential' self-fruitfulness. The expression of 114bp in ` boon ` selfing progeny: 126bp genotyping. The invention also provides a primer for identifying the SSR molecular marker, and an efficient molecular marker-assisted selective breeding system is established by the molecular marker and the primer, so that the apple germplasm with self-fruitfulness can be efficiently screened out in 'boon' offspring, and the apple variety with self-fruitfulness is created.
Description
Technical Field
The invention relates to the technical field of biological breeding, in particular to development and application of SSR molecular markers which are positioned on an apple No. 12 chromosome and are related to a 'boon' apple self-fruitful character.
Background
The apple is the first fruit in China, has high nutritive value, is popular with consumers, but due to the self-incompatibility of the apple, a variety different from the S gene of a main cultivated variety needs to be configured as a pollinated variety in the actual production process, and the yield can be ensured only by pollination through flower visiting insects or artificial pollination in the flowering phase, so that the production cost is increased, and the management difficulty is increased. The cultivation of apple varieties with self-fruitfulness is one of effective means for realizing light and simplified cultivation of fruit trees, and the common self-fruitfulness apple varieties in the prior production are few and only have 'Hanfu', 'Hui', 'CAU-1', and the like. The development of suitable molecular markers related to self-fruitfulness on the basis of the varieties is an effective means for improving the breeding efficiency of the self-fruitfulness.
The SSR marker is a second-generation molecular marker, has the advantages of high polymorphism, rich information content, codominant inheritance and the like, and is widely applied to the aspects of germplasm identification, genetic structure analysis, genetic linkage map construction, QTL positioning and the like of plants. Research work related to apple SSR has been carried out, but at present, research for carrying out correlation analysis on apple self-fruitful traits by using SSR markers is not seen.
The SSR fluorescence labeling capillary electrophoresis detection method based on the DNA sequencer can quickly obtain quantitative DNA fragment analysis data, thereby developing SSR labels related to 'benefit' self-fruitfulness and applying the SSR labels in breeding.
Disclosure of Invention
In order to efficiently breed the self-fruitfulness apple germplasm, the invention aims to provide the SSR molecular marker primer for 'preferential' progeny self-fruitfulness.
It is another object of the present invention to provide a kit.
Still another object of the present invention is to provide a method for rapidly screening a self-fruitful apple variety.
In order to achieve the above purposes, the technical scheme adopted by the invention is as follows:
an SSR molecular marker primer of 'boon' progeny self-fruitfulness, wherein the SSR molecular marker is CH04d02, and the primer of the corresponding SSR molecular marker is as follows:
ch04d02F: CGTACGCTGCTTCTTTTGCT, shown as SEQ ID NO: 1;
ch04d02R: CTATCCACCACCCGTCAACT, shown as SEQ ID NO: 2.
The SSR molecular marker primer of the 'boon' progeny self-fruitfulness is applied to screening of self-fruitfulness apple varieties.
The invention also provides a kit which comprises the SSR molecular marker primer of the 'preferential' progeny self-fruitfulness.
The invention also provides a method for rapidly screening self-fruitful apple varieties by using the SSR molecular marker primers, which comprises the following steps:
1) extracting DNA of the apple leaves to be detected,
2) using DNA as a template, using SSR molecular marker primers for identifying 'boon' offspring self-fruitfulness to carry out PCR amplification,
3) the fluorescence labeling of the capillary tube is used for electrophoresis detection,
4) data analysis
Using PROSize 2.0 software to generate a map file of the loci, measuring the length of a PCR amplification product and the peak value of fluorescence intensity, and obtaining the genotype of each SSR locus; the relationship between genotyping and selfing was analyzed.
On the basis of the scheme, if the genotype of the SSR locus is expressed as 114 bp: the 126bp genotype has high self-fruition rate of 'boon' offspring.
Drawings
The invention has the following drawings:
FIG. 1 shows the genotyping results of the selfing progeny CH04d 02.
Detailed Description
The present invention is described in further detail below with reference to fig. 1.
The present invention uses conventional techniques and methods used IN the fields of genetic engineering and MOLECULAR BIOLOGY, such as the method described IN MOLECULAR CLONING, A LABORATORY MANUAL, 3nd Ed. (Sambrook,2001) CURRENT PROTOCOLS IN MOLECULA R BIOLOGY (Ausubel, 2003). These general references provide definitions and methods known to those skilled in the art. The present invention is not limited to any particular methodology, protocols, and reagents described.
The present invention will be described in detail with reference to examples.
Example 1: SSR locus analysis of selfing progeny self-fruitfulness
1. Extraction of 'Hui' selfing progeny genome DNA
1) About 0.1g of apple leaves were pulverized with liquid nitrogen, and then 700. mu.l of DNA extraction buffer was added thereto, followed by water bath at 65 ℃ for 30 min. Or shearing a proper amount of tissue sample by using scissors and putting the tissue sample into a 2ml centrifuge tube, adding a steel ball into the centrifuge tube, and then adding preheated 700 mu l of DNA extraction buffer solution. After vigorous shaking (25Hz, 1min) with a tissue disruptor, the leaves were finally made to powder. Then putting the sample into a water bath kettle at 65 ℃ for 30min, taking out the sample during the water bath, and shaking the sample for two to three times to ensure that the sample is fully contacted with the extraction buffer solution.
2) Add 700. mu.l of chloroform: isoamyl alcohol (24:1), mixed well, extracted some of the impurities thoroughly, then left to stand at room temperature for 5 min.
3) Centrifuge at 12000rpm for 5min and transfer the DNA-containing supernatant to a new conical centrifuge tube. Adding 1 volume of pre-cooled isopropanol or 2 volumes of pre-cooled absolute ethanol, slightly inverting, mixing, and standing at-20 deg.C for 20-30 min. At this point white floc appeared in the centrifuge tube.
4) Centrifugation was carried out at 12000rpm for 8min to precipitate the DNA, and the supernatant was discarded while the DNA precipitate was washed twice with 75% ethanol.
5) The DNA was air-dried or vacuum-dried and dissolved in 100. mu.l of ddH2O, shaken and stored at 4 ℃ until use.
PCR reaction System and reaction procedure
The PCR reaction adopts 10 mul reaction system, which contains about 40ng template DNA,
1 XPCR buffer, 0.2. mu.M primer set
(Ch04d02F:CGTACGCTGCTTCTTTTGCT；
Ch04d02R: CTATCCACCACCCGTCAACT), 0.1mM dNTP and 0.1U/. mu.l DNA polymerase. Wherein different enzymes have different reaction systems, and particularly see the use instruction of the enzymes.
The PCR basic amplification program is generally pre-denatured at 94 deg.C for about 5min, then entering into the circulation process, respectively denaturing at 94 deg.C, annealing at 55 deg.C, extending at 72 deg.C for 30s, circulating for 30-35, and finally extending for 10 min. Wherein the annealing temperature is related to the primer, and the extension time is related to the length of the amplified product, and is generally 1 kb/min. Different enzymes also have different PCR amplification procedures, please refer to their instructions.
3. Fluorescence detection by fluorescence-labeled capillary electrophoresis
Pipette 32ul of 1 XTE Buffer, add 1. mu.l of PCR product, mix immediately, and perform capillary electrophoresis on ABI3730XL DNA analyzer.
4. Data analysis
Using PROSize 2.0 software to generate map files of the loci, measuring the length of PCR amplification products and the peak value of fluorescence intensity, obtaining the genotype of each locus, and analyzing the relationship between the genotype and the self-fruitfulness. SSR locus Ch04d02 appears to be 114bp in 82% of the affluent progeny: 126bp genotype, indicating that the marker can be used as a marker for preferentially selecting self-fruitful germplasm in selfing offspring. Compared with conventional crossbreeding, the breeding can be improved by 1-2 times.
Example 2: SSR locus analysis of self-fruitfulness of filial generations of Hui 'x' long and rich 2
1. Extraction of ' Huixax ' long-rich 2 ' filial generation genome DNA
1) About 0.1g of apple leaves were pulverized with liquid nitrogen, and then 700. mu.l of DNA extraction buffer was added thereto, followed by water bath at 65 ℃ for 30 min. Or shearing a proper amount of tissue sample by using scissors and putting the tissue sample into a 2ml centrifuge tube, adding a steel ball into the centrifuge tube, and then adding preheated 700 mu l of DNA extraction buffer solution. After vigorous shaking (25Hz, 1min) with a tissue disruptor, the leaves were finally made to powder. Then putting the sample into a water bath kettle at 65 ℃ for 30min, taking out the sample during the water bath, and shaking the sample for two to three times to ensure that the sample is fully contacted with the extraction buffer solution.
2) Add 700. mu.l of chloroform: isoamyl alcohol (24:1), mixed well, extracted some of the impurities thoroughly, then left to stand at room temperature for 5 min.
3) Centrifuge at 12000rpm for 5min and transfer the DNA-containing supernatant to a new conical centrifuge tube. Adding 1 volume of pre-cooled isopropanol or 2 volumes of pre-cooled absolute ethanol, slightly inverting, mixing, and standing at-20 deg.C for 20-30 min. At this point white floc appeared in the centrifuge tube.
4) Centrifugation was carried out at 12000rpm for 8min to precipitate the DNA, and the supernatant was discarded while the DNA precipitate was washed twice with 75% ethanol.
5) The DNA was air-dried or vacuum-dried and dissolved in 100. mu.l of ddH2O, shaken and stored at 4 ℃ until use.
PCR reaction System and reaction procedure
The PCR reaction adopts 10 mul reaction system, which contains about 40ng template DNA,
1 XPCR buffer, 0.2. mu.M primer set
(Ch04d02F:CGTACGCTGCTTCTTTTGCT；
Ch04d02R: CTATCCACCACCCGTCAACT), 0.1mM dNTP and 0.1U/. mu.l DNA polymerase. Wherein different enzymes have different reaction systems, and particularly see the use instruction of the enzymes.
The PCR basic amplification program is generally pre-denatured at 94 ℃ for about 5min, then entering a cycle process, respectively denaturing at 94 ℃, annealing at 55 ℃, extending at 72 ℃ for 30s, cycle number 30-35, and finally extending for 10 min. Wherein the annealing temperature is related to the primer, and the extension time is related to the length of the amplified product, and is generally 1 kb/min. Different enzymes also have different PCR amplification procedures, please refer to their instructions.
3. Capillary electrophoresis fluorescence detection
Pipette 32ul of 1 XTE Buffer, add 1. mu.l of PCR product, mix immediately, and perform capillary electrophoresis on ABI3730XL DNA analyzer.
4. Data analysis
Using PROSize 2.0 software to generate map files of the loci, measuring the length of PCR amplification products and the peak value of fluorescence intensity, obtaining the genotype of each locus, and analyzing the relationship between the genotype and the self-fruitfulness. SSR locus Ch04d02 appears to be 114bp in 77% of the affluent progeny: 126bp genotype, indicating that the marker can be used as a marker for preferentially selecting self-fruitful germplasm in filial generations which take the advantage of female parents. Compared with conventional crossbreeding, the breeding can be improved by 1-2 times.
Those not described in detail in this specification are within the skill of the art.
<110> university of agriculture in China
<120> SSR marker-based 'preferential' self-fruitful progeny efficient breeding kit
<160> 2
<170> PatentIn version 3.3
<210> 1
<211> 20
<212> DNA
<213> Artificial sequence
<400> 1
cgtacgctgc ttcttttgct 20
<210> 2
<211> 20
<212> DNA
<213> Artificial sequence
<400> 2
ctatccacca cccgtcaact 20
Claims (3)
1. The application of the SSR molecular marker primer of 'preferential' progeny self-fruitfulness in screening self-fruitfulness apple varieties of 'preferential' selfing progeny and 'preferential' x 'long-rich 2' filial progeny, wherein the SSR molecular marker is CH04d02, and the corresponding SSR molecular marker primer is as follows:
Ch04d02F:CGTACGCTGCTTCTTTTGCT；
Ch04d02R:CTATCCACCACCCGTCAACT。
2. a method for rapidly screening self-fertile apple varieties of 'Hui' self-bred progenies and 'Hui' x 'long and rich 2' hybrid progenies by applying SSR molecular marker primers is characterized by comprising the following steps:
1) extracting DNA of the apple leaves to be detected,
2) using DNA as a template, using SSR molecular marker primers for identifying 'boon' offspring self-fruitfulness to carry out PCR amplification,
3) the fluorescence labeling of the capillary tube is used for electrophoresis detection,
4) the analysis of the data is carried out,
using PROSize 2.0 software to generate a map file of the loci, measuring the length of a PCR amplification product and the peak value of fluorescence intensity, and obtaining the genotype of each SSR locus; analyzing the relationship between genotyping and self-fruitfulness;
wherein, the SSR molecular marker is CH04d02, and the corresponding SSR molecular marker primers are as follows:
Ch04d02F:CGTACGCTGCTTCTTTTGCT；
Ch04d02R:CTATCCACCACCCGTCAACT。
3. the method of claim 2, wherein if the SSR locus is characterized by a genotype of 114 bp: 126bp, the self-flower setting rate of the 'boon' offspring is high.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201911200051.8A CN111321237B (en) | 2019-11-29 | 2019-11-29 | SSR marker-based efficient breeding kit for 'Hui' self-fruitful progeny |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201911200051.8A CN111321237B (en) | 2019-11-29 | 2019-11-29 | SSR marker-based efficient breeding kit for 'Hui' self-fruitful progeny |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN111321237A CN111321237A (en) | 2020-06-23 |
| CN111321237B true CN111321237B (en) | 2020-11-24 |
Family
ID=71163248
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201911200051.8A Active CN111321237B (en) | 2019-11-29 | 2019-11-29 | SSR marker-based efficient breeding kit for 'Hui' self-fruitful progeny |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN111321237B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112126699B (en) * | 2020-09-15 | 2022-03-01 | 中国农业大学 | Malus plant complete genome InDel marker genotype database and application thereof in germplasm resource specificity identification |
Family Cites Families (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101565748A (en) * | 2009-06-05 | 2009-10-28 | 南京农业大学 | Molecular labeling method for quickly identifying pear plants with self-fertility |
| CN110150305B (en) * | 2019-05-17 | 2020-03-17 | 中国农业大学 | Preparation for improving fruit setting rate and appearance quality of self-fruited apples and use method thereof |
-
2019
- 2019-11-29 CN CN201911200051.8A patent/CN111321237B/en active Active
Also Published As
| Publication number | Publication date |
|---|---|
| CN111321237A (en) | 2020-06-23 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Chapman et al. | A genomic scan for selection reveals candidates for genes involved in the evolution of cultivated sunflower (Helianthus annuus) | |
| CN107488659B (en) | Sequence related to red and yellow color characters of citrus peels and application thereof | |
| CN108165653B (en) | InDel molecular marker for identifying pepper maturity and application thereof | |
| CN108754017A (en) | A kind of auxiliary detects CAPS labels and its application of soybean grease content height | |
| CN109207574B (en) | Cucumber female SNP molecular marker and application thereof | |
| CN106957897B (en) | Molecular marking method of cucumber young leaf yellowing gene | |
| CN114717355A (en) | Watermelon whole genome SNP-Panel | |
| CN111321237B (en) | SSR marker-based efficient breeding kit for 'Hui' self-fruitful progeny | |
| CN108456743B (en) | SNP (Single nucleotide polymorphism) marker related to flowering period and mature period of soybean as well as detection primer, method and application thereof | |
| CN112695125B (en) | Katelia SSR molecular marker primer composition and application thereof | |
| KR101151239B1 (en) | Marker for ms, a genic multiple-allele male sterile gene in chinese cabbage and uses thereof | |
| CN106755465B (en) | Molecular marker closely linked with wheat flag leaf length QTL QFLL | |
| Zhao et al. | Genetic diversity estimation and core collection construction of Sinojackia huangmeiensis based on novel microsatellite markers | |
| CN105695454B (en) | A kind of molecular labeling and its identification method for identifying sesame genie male sterile line | |
| CN108239675B (en) | Molecular marker TJcM02 for identifying melon unisexual flower and application thereof | |
| CN108531636B (en) | Molecular marker TJcM01 for identifying melon unisexual flower and application thereof | |
| CN110628930A (en) | dCAPS molecular marker for identifying panicle length character of rice and application thereof | |
| CN107619875B (en) | Insertion deletion marker locus for identifying watermelon fruit shape, primer and application | |
| CN104789650B (en) | Molecular detection method for brassica cultivar cytoplasm | |
| CN116694799A (en) | Site of InDel related to rice essential amino acid accumulation in rice OsAUX5 gene and application | |
| CN112695124B (en) | Phalaenopsis SSR molecular marker primer composition and application thereof | |
| CN111172317B (en) | Molecular marker HSRC3911 closely linked with major QTL site in flowering phase of sesame and application thereof | |
| Ya-Ping et al. | Screening and application of EST-based PCR markers specific to individual chromosomes of Haynaldia villosa | |
| CN109913579A (en) | A kind of barley phosphorus element efficiently utilizes molecular labeling and the application of QTL site | |
| CN112680542B (en) | Universal SSR molecular marker primer composition for orchidaceae plants and application of universal SSR molecular marker primer composition |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| EE01 | Entry into force of recordation of patent licensing contract | ||
| EE01 | Entry into force of recordation of patent licensing contract |
Application publication date: 20200623 Assignee: BEIJING CAU FUTONG GARDENING Co.,Ltd. Assignor: CHINA AGRICULTURAL University Contract record no.: X2023980034500 Denomination of invention: Efficient Selection Kit for 'Hui' Self Flowering and Seed Setting Progenies Based on SSR Markers Granted publication date: 20201124 License type: Exclusive License Record date: 20230407 |