CN109609678B - Molecular marker for predicting color of collard inner leaves and application - Google Patents

Abstract

The invention relates to a molecular marker for predicting the color of collard inner leaves and application thereof, wherein the molecular marker has the following sequence shown in SEQ ID NO: 5 and SEQ ID NO: 6, and the application method of the molecular marker for predicting the color of the collard inner leaves comprises the following steps: (1) extracting leaf genome DNA; (2) performing PCR amplification, wherein an amplification primer is the molecular marker; (3) detecting by agarose gel electrophoresis; the invention establishes a method for early predicting the color of the collard inner leaves by applying molecular markers under the condition of not being influenced by temperature, and has important scientific guiding significance for identifying the color of the collard inner leaves and breeding new varieties.

Description

Molecular marker for predicting color of collard inner leaves and application

Technical Field

The invention belongs to the field of plant molecular breeding, and particularly relates to a molecular marker for predicting the color of collard inner leaves and application thereof.

Background

Kale (a)Brassica oleracea var.acephala) Is a brassica plant of cruciferae and has strong ornamental value.

The DNA molecular marker is a marking method capable of detecting and analyzing a specific DNA segment in a plant genome. The method has the advantages of no influence of environmental condition difference, no influence of gene ability or expression, no influence of a certain growth stage of the plant, no limitation of tissue parts during sampling, less quantity of required DNA templates and the like, and is an important scientific basis for the auxiliary selection breeding of plant molecular markers.

The InDel marker is an InDel marker, which is a molecular marker developed based on a genomic sequence, and is a length polymorphism variation at an allelic site due to nucleotide insertion or deletion. The InDel marker polymorphism can achieve the purpose of genotyping through simple steps such as Polymerase Chain Reaction (PCR), agarose gel electrophoresis and the like, and has the advantages of high specificity, good stability, simple detection method and the like.

The color of the inner leaves of the kale is an important economic trait, however, the color of the inner leaves of the kale needs to be grown to a certain amount and can be shown only by being induced in a low-temperature environment, so that the breeding process of a new variety of the color of the inner leaves of the kale is greatly influenced, and a method for predicting the color of the inner leaves of the kale through a molecular marker is not seen at present.

Disclosure of Invention

In order to make up for the defects of the prior art, the invention provides a molecular marker for predicting the color of the inner leaves of kale and application thereof, wherein the molecular marker links a genome sequence with the color of the inner leaves of the kale, so that the color of the inner leaves of the kale can be predicted at an early stage under any temperature condition, and a kale molecular marker assisted breeding system is established and perfected.

The invention provides a molecular marker for predicting the color of collard inner leaves, which has the following sequence of SEQ ID NO: 5 and SEQ ID NO: 6.

The invention also provides an obtaining method of the molecular marker for predicting the color of the collard inner leaves, which comprises the following steps: the method comprises the following specific steps:

(1) cultivating collard: taking a collard red inner leaf variety 'red pigeon' as an original resource, and obtaining a red inner leaf inbred line '42 red' by adopting a continuous inbred method; taking a white inner leaf variety 'white gull' of collard as an original resource, and adopting a continuous selfing method to obtain a white inner leaf selfing line '1631'; sowing the red inner leaf inbred line '42 red' and the white inner leaf inbred line '1631' to the lotus throne;

(2) extracting inner leaf color kale variety genome DNA

The method comprises the following steps of respectively extracting genome DNA of a collard red inner leaf inbred line '42 red' and a white inner leaf inbred line '1631' by adopting an improved CTAB method, and specifically comprises the following steps:

a. weighing young and tender leaves in a mortar, fully grinding the young and tender leaves into powder under the condition of liquid nitrogen freezing protection, and quickly transferring the ground powder into a centrifugal tube;

b. preparing a CTAB extraction buffer solution: weighing 10g of hexadecyl trimethyl ammonium bromide (CTAB), 16.38 g of sodium chloride and 10g of polyvinylpyrrolidone (PVP), measuring 20ml of 1mol/L Tris-HCl (pH =8) and 8ml of 1mol/L disodium ethylene diamine tetraacetate (EDTA, pH =8), fixing the volume of deionized water to 200ml, and carrying out autoclaving at 121 ℃ for 20 min for later use;

c. adding a CTAB extraction buffer solution at 65 ℃ into a centrifugal tube, fully and uniformly mixing, putting the centrifugal tube into a water bath kettle at 65 ℃ for 1 h, and turning upside down and uniformly mixing once every 10 min;

d. adding chloroform-isoamyl alcohol solution (chloroform: isoamyl alcohol volume ratio =24: 1) into the centrifuge tube, slightly reversing the mixture up and down, mixing the mixture evenly, centrifuging the mixture at 12,000 r/min at room temperature for 7 min;

e. centrifuging, collecting supernatant, adding isopropanol pre-cooled at-20 deg.C, mixing, and precipitating in refrigerator at-20 deg.C for 1 hr;

f. centrifuging the tube at 12,000 r/min at room temperature for 7 min, and removing the supernatant; adding 75% ethanol, centrifuging at 12,000 r/min for 7 min, removing supernatant, and rinsing twice;

g. opening the centrifuge tube, air drying at room temperature, adding TE buffer solution, dissolving in refrigerator at 4 deg.C for 12 hr, and storing at-20 deg.C;

(3) synthesis ofDFRGene full-length cloning primer:

according TO the cabbage TO1000 genome reference sequence in NCBI (https:// www.ncbi.nlm.nih.gov /), according TO plant anthocyanin accumulation pathway genesDFR(accession number XM _ 013753582.1) sequence, synthesizing a full-length sequence amplification upstream primer F and a full-length sequence amplification downstream primer R of the plant anthocyanin accumulation pathway gene DFR;

the upstream primer F has the sequence shown in SEQ ID NO: 3; the downstream primer R has the sequence shown in SEQ ID NO: 4;

(4) PCR polymerase chain reaction amplification:

a. PCR polymerase chain reaction system:

5 x Prime STAR GXL Buffer 4.0 μ l, dNTP mix 1.6 μ l, primer F1.0 μ l, primer R1.0 μ l, DNA 2.0 μ l, Prime STAR GXL DNA Polymerase 0.4 μ l, deionized water 10 μ l;

b. PCR polymerase chain reaction conditions: pre-denaturation at 95 ℃ for 5 min; denaturation at 98 ℃ for 10 s, annealing at 60 ℃ for 15 s, extension at 68 ℃ for 90 s, 30 cycles; extension at 68 ℃ for 5 min; storing at 4 ℃ for later use;

(5) agarose gel electrophoresis:

detecting the PCR product by using 1% agarose gel electrophoresis, and taking an electrophoresis picture by using a gel imaging system;

(6) and (3) recovering amplification products: recovering by referring to a recovery kit of SanPrep column type DNA gel provided by Shanghai bioengineering company;

(7) sequencing: and (3) obtaining a PCR product with the sequence shown in SEQ ID NO: 1 and SEQ ID NO: 2, having the nucleotide sequence shown in SEQ ID NO: 1 and SEQ ID NO: 2 are respectively named as 42 red and 1631;

(8) synthesis of molecular markers for predicting the color of the inner leaves of kale

Synthesizing two oligonucleotide primers dfr1801F and dfr1801R based on the nucleotide sequence obtained in step (7); the molecular marker for predicting the color of the collard inner leaves is adopted;

the dfr1801F has the amino acid sequence of SEQ ID NO: 5; the dfr1801R has the amino acid sequence of SEQ ID NO: 6.

The invention also provides an application method of the molecular marker for predicting the color of the collard inner leaves, which comprises the following steps: the method comprises the following specific steps:

(1) extraction of genomic DNA of collard varieties with different inner leaf colors

a. Weighing young leaves of collard, placing the young leaves in a mortar, fully grinding the young leaves into powder under the condition of liquid nitrogen freezing protection, and quickly transferring the ground powder into a centrifugal tube;

b. preparing a CTAB extraction buffer solution: weighing 10g of hexadecyl trimethyl ammonium bromide (CTAB), 16.38 g of sodium chloride and 10g of polyvinylpyrrolidone (PVP), measuring 20ml of 1mol/L Tris-HCl (pH =8) and 8ml of 1mol/L disodium ethylene diamine tetraacetate (EDTA, pH =8), fixing the volume of deionized water to 200ml, and carrying out autoclaving at 121 ℃ for 20 min for later use;

c. adding a CTAB extraction buffer solution at 65 ℃ into a centrifugal tube, fully and uniformly mixing, putting the centrifugal tube into a water bath kettle at 65 ℃ for 1 h, and turning upside down and uniformly mixing once every 10 min;

d. adding chloroform-isoamyl alcohol solution (chloroform: isoamyl alcohol volume ratio =24: 1) into the centrifuge tube, slightly reversing the mixture up and down, mixing the mixture evenly, centrifuging the mixture at 12,000 r/min at room temperature for 7 min;

e. centrifuging, collecting supernatant, adding isopropanol pre-cooled at-20 deg.C, mixing, and precipitating in refrigerator at-20 deg.C for 1 hr;

f. centrifuging the tube at 12,000 r/min at room temperature for 7 min, and removing the supernatant; adding 75% ethanol, centrifuging at 12,000 r/min for 7 min, removing supernatant, and rinsing twice;

g. opening the centrifuge tube, air drying at room temperature, adding TE buffer solution, dissolving in refrigerator at 4 deg.C for 12 hr, and storing at-20 deg.C;

(2) PCR amplification primers are dfr1801F and dfr 1801R; the dfr1801F has the amino acid sequence of SEQ ID NO: 5; dfr1801R has the sequence of SEQ ID NO: 6;

(3) PCR amplification and electrophoresis detection:

a. and (3) PCR reaction system: 2 × EasyTaq PCR Supermix 5 μ l, DNA 1 μ l, dfr1801F 0.5 μ l, dfr1801R 0.5 μ l, deionized water 3 μ l;

b. and (3) PCR reaction conditions: pre-denaturation at 95 ℃ for 5 min; denaturation at 95 ℃ for 30s, annealing at 60 ℃ for 30s, extension at 72 ℃ for 30s, 30 cycles; extension at 72 ℃ for 5 min; storing at 4 ℃;

c. and (3) agarose gel electrophoresis detection: detecting the PCR product by using 1% agarose gel electrophoresis, taking an electrophoresis picture by using a gel imaging system, wherein the genome DNA of the collard variety with pink, red or purple red can amplify a 443bp specific band, and the collard variety without red or white inner leaves has no specific band.

The invention has the beneficial effects that:

the method for early predicting the color of the collard inner leaves by applying the molecular marker under the condition of not being influenced by temperature is established, and has important scientific guiding significance for identifying the color of the collard inner leaves and breeding new varieties.

Drawings

FIG. 1 is a photograph of agarose gel electrophoresis in example 2;

FIG. 2 is a photograph of agarose gel electrophoresis in example 3;

FIG. 3 is a diagram of agarose gel electrophoresis in example 4.

Detailed Description

The reagents used in the examples are all commercially available.

Example 1 method for obtaining molecular marker for predicting color of collard inner leaf

The method comprises the following specific steps:

(1) cultivating collard: taking a collard red inner leaf variety 'red pigeon' as an original resource, and carrying out continuous selfing for 6 generations by adopting a continuous selfing method to obtain a red inner leaf selfing line '42 red'; taking a white inner leaf variety 'white gull' of collard as an original resource, and continuously selfing for 6 generations by adopting a continuous selfing method to obtain a white inner leaf selfing line '1631'; sowing the red inner leaf inbred line '42 red' and the white inner leaf inbred line '1631' to the lotus throne;

(2) extracting inner leaf color kale variety genome DNA

The method comprises the following steps of respectively extracting genome DNA of a collard red inner leaf inbred line '42 red' and a white inner leaf inbred line '1631' by adopting an improved CTAB method, and specifically comprises the following steps:

a. weighing young and tender leaves in a mortar, fully grinding the young and tender leaves into powder under the condition of liquid nitrogen freezing protection, and quickly transferring the ground powder into a centrifugal tube;

b. preparing a CTAB extraction buffer solution: weighing 10g of hexadecyl trimethyl ammonium bromide (CTAB), 16.38 g of sodium chloride and 10g of polyvinylpyrrolidone (PVP), measuring 20ml of 1mol/L Tris-HCl (pH =8) and 8ml of 1mol/L disodium ethylene diamine tetraacetate (EDTA, pH =8), fixing the volume of deionized water to 200ml, and carrying out autoclaving at 121 ℃ for 20 min for later use;

c. adding a CTAB extraction buffer solution at 65 ℃ into a centrifugal tube, fully and uniformly mixing, putting the centrifugal tube into a water bath kettle at 65 ℃ for 1 h, and turning upside down and uniformly mixing once every 10 min;

d. adding chloroform-isoamyl alcohol solution (chloroform: isoamyl alcohol volume ratio =24: 1) into the centrifuge tube, slightly reversing the mixture up and down, mixing the mixture evenly, centrifuging the mixture at 12,000 r/min at room temperature for 7 min;

e. centrifuging, collecting supernatant, adding isopropanol pre-cooled at-20 deg.C, mixing, and precipitating in refrigerator at-20 deg.C for 1 hr;

f. centrifuging the tube at 12,000 r/min at room temperature for 7 min, and removing the supernatant; adding 75% ethanol, centrifuging at 12,000 r/min for 7 min, removing supernatant, and rinsing twice;

g. opening the centrifuge tube, air drying at room temperature, adding TE buffer solution, dissolving in refrigerator at 4 deg.C for 12 hr, and storing at-20 deg.C;

(3) synthesis ofDFRGene full-length cloning primer:

according TO the cabbage TO1000 genome reference sequence in NCBI (https:// www.ncbi.nlm.nih.gov /), according TO plant anthocyanin accumulation pathway genesDFR(accession XM-013753582.1) sequence, synthesizing a full-length sequence amplification upstream primer F (SEQ ID NO: 3) and a downstream primer R (SEQ ID NO: 4) of the plant anthocyanin accumulation pathway gene DFR;

an upstream primer F: ATGGTAGCTCACAAAGAGACT

A downstream primer R: CTAAGCACAGATCTGCTGTG

(4) PCR polymerase chain reaction amplification:

a. PCR polymerase chain reaction system:

5 x Prime STAR GXL Buffer 4.0 μ l, dNTP mix 1.6 μ l, primer F1.0 μ l, primer R1.0 μ l, DNA 2.0 μ l, Prime STAR GXL DNA Polymerase 0.4 μ l, deionized water 10 μ l;

b. PCR polymerase chain reaction conditions: pre-denaturation at 95 ℃ for 5 min; denaturation at 98 ℃ for 10 s, annealing at 60 ℃ for 15 s, extension at 68 ℃ for 90 s, 30 cycles; extension at 68 ℃ for 5 min; storing at 4 ℃ for later use;

(5) agarose gel electrophoresis:

detecting the PCR product by using 1% agarose gel electrophoresis, and taking an electrophoresis picture by using a gel imaging system;

(6) and (3) recovering amplification products: recovering by referring to a recovery kit of SanPrep column type DNA gel provided by Shanghai bioengineering company;

(7) sequencing:

obtaining a sequence (SEQ ID NO: 1) for a red inner leaf kale inbred line '42 red' and a sequence (SEQ ID NO: 2) for a white inner leaf kale inbred line '1631' respectively from the recovered PCR products;

(8) synthesis of molecular markers for predicting the color of the inner leaves of kale

Designing and synthesizing two oligonucleotide primers dfr1801F (SEQ ID NO: 5) and dfr1801R (SEQ ID NO: 6) based on the nucleotide sequence obtained in step (7);

dfr1801F：CACTGTTCGCGATCCTGGTA

dfr1801R：TCTTCGTACGGTCTTTGCCT

example 2: predicting the color of the inner leaf of the collard red inner leaf variety 'red peacock'.

The molecular markers for predicting the color of the collard inner leaves (the dfr1801F and dfr 1801R) obtained in example 1 are used for prediction, and the specific implementation method is as follows:

A. cultivation of kale: sowing seeds of collard variety 'red peacock'.

Preparing a plug tray with 120 holes, slightly compacting after filling the plug tray with a substrate, soaking the substrate with water, dibbling one seed in each hole, covering soil for 2cm, and placing at 25 ℃ for 3 days after sowing to obtain seedlings;

b, detection of molecular markers:

1. the method comprises the following steps of extracting the genome DNA of a collard red inner leaf variety 'red peacock' by adopting an improved CTAB method:

(1) weighing 0.15 g of blades in a mortar, fully grinding the blades to be powder under the condition of liquid nitrogen freezing protection, and quickly transferring the ground powder into a 2 mL centrifuge tube;

(2) adding 700 mu L of 65 ℃ CTAB extracting solution into a centrifuge tube, fully and uniformly mixing, putting the centrifuge tube into a 65 ℃ water bath kettle for 1 h, and uniformly mixing by turning upside down every 10 min;

(3) adding 700 μ L chloroform-isoamyl alcohol solution (volume ratio of chloroform to isoamyl alcohol =24: 1) into the centrifuge tube, mixing by gently turning upside down, centrifuging at 12,000 r/min, and centrifuging at room temperature for 7 min;

(4) centrifuging, sucking 400 μ L of supernatant into 1.5mL centrifuge tube, adding 800 μ L of pre-cooled isopropanol at-20 deg.C, mixing, and precipitating in refrigerator at-20 deg.C for 1 h;

(5) centrifuging the tube at 12,000 r/min at room temperature for 7 min, and removing the supernatant; adding 800 μ L of 75% ethanol, centrifuging at 12,000 r/min for 7 min, removing supernatant, and rinsing twice;

(6) opening the centrifuge tube, air drying at room temperature, adding 50 μ L TE buffer solution, dissolving in refrigerator at 4 deg.C for 12 hr, and storing at-20 deg.C;

2. PCR amplification primers are dfr1801F and dfr 1801R; the dfr1801F has the amino acid sequence of SEQ ID NO: 5; dfr1801R has the sequence of SEQ ID NO: 6; (ii) a

dfr1801F：CACTGTTCGCGATCCTGGTA

dfr1801R：TCTTCGTACGGTCTTTGCCT

3. PCR polymerase chain reaction amplification;

(1) and (3) PCR reaction system: 2 × EasyTaq PCR Supermix 5 μ l, DNA 1 μ l, dfr1801F 0.5 μ l, dfr1801R 0.5 μ l, deionized water 3 μ l;

(2) and (3) PCR reaction conditions: pre-denaturation at 95 ℃ for 5 min; denaturation at 95 ℃ for 30s, annealing at 60 ℃ for 30s, extension at 72 ℃ for 30s, 30 cycles; extension at 72 ℃ for 5 min; storing at 4 ℃;

(3) and (3) agarose gel electrophoresis detection: detecting the PCR product by using 1% agarose gel electrophoresis, and taking an electrophoresis picture by using a gel imaging system, wherein the result shows that the collard red inner leaf variety 'red peacock' shows a specific band of 443bp (see figure 1);

C. application of molecular marker: by using the molecular marker, the color of the inner leaf of the kale variety 'red peacock' is predicted to be red and is consistent with the color of the inner leaf obtained by later plant culture.

Example 3: predicting inner leaf color of white inner leaf variety 'white pigeon' of kale

The molecular markers for predicting the color of the collard inner leaves (the dfr1801F and dfr 1801R) obtained in example 1 are used for prediction, and the specific implementation method is as follows:

A. cultivation of kale: sowing seeds of collard variety 'white pigeon'.

Preparing a plug tray with 120 holes, slightly compacting after filling the plug tray with the matrix, soaking the matrix with water, dibbling one seed in each hole, covering soil for 2cm, sowing, and standing at 25 ℃ for 3 days to obtain seedlings.

B, detection of molecular markers:

1. the method comprises the following steps of extracting genome DNA of a collard red inner leaf variety 'white pigeon' by adopting an improved CTAB method:

(1) weighing 0.15 g of blades in a mortar, fully grinding the blades to be powder under the condition of liquid nitrogen freezing protection, and quickly transferring the ground powder into a 2 mL centrifuge tube;

(2) adding 700 mu L of 65 ℃ CTAB extracting solution into a centrifuge tube, fully and uniformly mixing, putting the centrifuge tube into a 65 ℃ water bath kettle for 1 h, and uniformly mixing by turning upside down every 10 min;

(3) adding 700 μ L chloroform-isoamyl alcohol solution (volume ratio =24: 1) into the centrifuge tube, gently inverting and mixing, and then centrifuging at 12,000 r/min at room temperature for 7 min;

(4) centrifuging, sucking 400 μ L of supernatant into 1.5mL centrifuge tube, adding 800 μ L of pre-cooled isopropanol at-20 deg.C, mixing, and precipitating in refrigerator at-20 deg.C for 1 h;

(5) centrifuging the tube at 12,000 r/min at room temperature for 7 min, and removing the supernatant; adding 800 μ L of 75% ethanol, centrifuging at 12,000 r/min for 7 min, removing supernatant, and rinsing twice;

(6) opening the centrifuge tube, air drying at room temperature, adding 50 μ L TE buffer solution, dissolving in refrigerator at 4 deg.C for 12 hr, and storing at-20 deg.C;

2. PCR amplification primers are dfr1801F and dfr 1801R; the dfr1801F has the amino acid sequence of SEQ ID NO: 5; dfr1801R has the sequence of SEQ ID NO: 6;

dfr1801F：CACTGTTCGCGATCCTGGTA

dfr1801R：TCTTCGTACGGTCTTTGCCT

3. PCR polymerase chain reaction amplification;

(1) and (3) PCR reaction system: 2 × EasyTaq PCR Supermix 5 μ l, DNA 1 μ l, dfr1801F 0.5 μ l, dfr1801R 0.5 μ l, deionized water 3 μ l;

(2) and (3) PCR reaction conditions: pre-denaturation at 95 ℃ for 5 min; denaturation at 95 ℃ for 30s, annealing at 60 ℃ for 30s, extension at 72 ℃ for 30s, 30 cycles; extension at 72 ℃ for 5 min; storing at 4 ℃;

(3) and (3) agarose gel electrophoresis detection: the PCR product was detected by electrophoresis on a 1% agarose gel, and the gel imaging system took an electrophoretogram using water as a template as a blank (CK), resulting in a 1631' non-amplified 443pb band (see FIG. 2);

C. the application of the molecular marker comprises the following steps: by using the molecular marker, the color of the inner leaf of the collard inner leaf variety 'white pigeon' is predicted not to be red and is consistent with the color of the inner leaf obtained by later plant culture.

Example 4: predicting inner leaf color of red inner leaf variety red crane of kale

The molecular markers for predicting the color of the collard inner leaves (the dfr1801F and dfr 1801R) obtained in example 1 are used for prediction, and the specific implementation method is as follows:

A. cultivation of kale: sowing seeds of a kale variety 'red crane'.

Preparing a plug tray with 120 holes, slightly compacting after filling the plug tray with a substrate, soaking the substrate with water, dibbling one seed in each hole, covering soil for 2cm, and placing at 25 ℃ for 3 days after sowing to obtain seedlings;

b, detection of molecular markers:

1. the method adopts an improved CTAB method to extract the genome DNA of the collard red inner leaf variety 'red crane', and comprises the following specific steps:

(1) weighing 0.15 g of blades in a mortar, fully grinding the blades to be powder under the condition of liquid nitrogen freezing protection, and quickly transferring the ground powder into a 2 mL centrifuge tube;

(2) adding 700 mu L of 65 ℃ CTAB extracting solution into a centrifuge tube, fully and uniformly mixing, putting the centrifuge tube into a 65 ℃ water bath kettle for 1 h, and uniformly mixing by turning upside down every 10 min;

(3) adding 700 μ L chloroform-isoamyl alcohol solution (volume ratio of chloroform to isoamyl alcohol =24: 1) into the centrifuge tube, mixing by gently turning upside down, centrifuging at 12,000 r/min, and centrifuging at room temperature for 7 min;

(4) centrifuging, sucking 400 μ L of supernatant into 1.5mL centrifuge tube, adding 800 μ L of pre-cooled isopropanol at-20 deg.C, mixing, and precipitating in refrigerator at-20 deg.C for 1 h;

(5) centrifuging the tube at 12,000 r/min at room temperature for 7 min, and removing the supernatant; adding 800 μ L of 75% ethanol, centrifuging at 12,000 r/min for 7 min, removing supernatant, and rinsing twice;

(6) opening the centrifuge tube, air drying at room temperature, adding 50 μ L TE buffer solution, dissolving in refrigerator at 4 deg.C for 12 hr, and storing at-20 deg.C;

2. PCR amplification primers are dfr1801F and dfr 1801R; the dfr1801F has the amino acid sequence of SEQ ID NO: 5; dfr1801R has the sequence of SEQ ID NO: 6;

dfr1801F：CACTGTTCGCGATCCTGGTA

dfr1801R：TCTTCGTACGGTCTTTGCCT

3. PCR polymerase chain reaction amplification;

(1) and (3) PCR reaction system: 2 × EasyTaq PCR Supermix 5 μ l, DNA 1 μ l, dfr1801F 0.5 μ l, dfr1801R 0.5 μ l, deionized water 3 μ l;

(2) and (3) PCR reaction conditions: pre-denaturation at 95 ℃ for 5 min; denaturation at 95 ℃ for 30s, annealing at 60 ℃ for 30s, extension at 72 ℃ for 30s, 30 cycles; extension at 72 ℃ for 5 min; storing at 4 ℃;

(3) and (3) agarose gel electrophoresis detection: detecting the PCR product by 1% agarose gel electrophoresis, and taking electrophoresis picture by gel imaging system, the result shows that the collard red inner leaf variety 'red crane' shows a specific band of 443bp (see figure 3);

C. application of molecular marker: by using the molecular marker, the color of the inner leaf of the kale variety 'red crane' is predicted to be red and is consistent with the color of the inner leaf obtained by later plant culture.

Sequence listing

<110> Shenyang agriculture university

<120> molecular marker for predicting color of collard inner leaves and application

<160> 6

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1579

<212> DNA

<213> kale (organic kale in bree line Red 42)

<400> 1

atggtagctc acaaagagac cgtgtgcgta accggcgcat caggattcat tggttcatgg 60

ctcgtgatgc ggctactgga acgtggttac tttgtccgtg ccactgttcg cgatcctggt 120

acgtatctta caaactcgtt aatttctcct aagagtatat gttaatacgt atcactttgt 180

gtgttttaag taacttacga gttttcttgg cctgtaaagg aaatttgaag aaagtgcaac 240

atcttcttga tttgccaaac gcgaagacgc aactcacttt atggaaagcc gatttatctg 300

acgaaggaag ctacgatgac gccataaacg gatgcgacgg cgtttttcac atagctactc 360

ccatggattt tgaatccaag gatcccgagg tgagttatac tatgaacctt tttcttatta 420

catatcaatc ctacaagatt ttgttaaatg agtttgtttg aatcagaacg aagtgataaa 480

accaacagtg aatggagtgt tggggataat gaaagcatgt gataaggcaa agaccgtacg 540

aagaattgtg tttacttcgt ctgctggaac ggttaatgtt gaggaacacc agaaaaatgt 600

ctatgatgaa aacgattgga gtgatcttga ctttatcatg tccaagaaga tgacaggatg 660

ggtatatata ttaaggatca tatataaaaa attaacccga ggttgatctt cttcaaagta 720

atttatgttt ttgataaatt gttggcagat gtatttcatg tcgaaaacgt tagccgagaa 780

agcagcttgg gattacgcta aggaaaaagg aatagatttc attagtatta tcccgacatt 840

ggtgatcggt ccatttataa caacatctat gccgcctagc cttattaccg cgctctctcc 900

tatcactcgt gagtgagcct actttctaat ccctcttttt taactaagag gttaatttaa 960

aacggtaaaa atgttttagg taacgaggca cattactcca tcataagaca aggacagtat 1020

gtccacttgg acgacttatg caatgctcat atattcttgt acgaacaagc tgctgccaag 1080

ggacgttatg tttgttcctc tcacgatgca acgattcata ctatctccga gtttctcagg 1140

caaaaatatc cagaatataa cgtgccttca acgtaagatt tttatcatta ccggtttaag 1200

ctttttttgc atattcagtt taattttttt tttctgaata tgaactcttt ggaacaggtt 1260

tgaaggagtg gatgagaatc taaagagcat tatgttcagt tccaagaagc tgattgatat 1320

gggatttaac ttcaagtata gtctcgagga tatgttggtg gaatcgattg agacatgtcg 1380

tcaaaagggt tttctccctg tcactttacc ggaacatttg aaatctgagg acaaagttcc 1440

gggcagtgat gacaataagg agattaaaaa cggatctgca ggtttaactg atggtatggt 1500

agcttgtaag aagaccgaac cagggatggc cggcgagaaa gccgatagtc acatgtcggc 1560

acagcagatc tgtgcttag 1579

<210> 2

<211> 3857

<212> DNA

<213> kale (organic kale in bree line Red 42)

<400> 2

atggtagctc acaaagagac cgtgtgcgta accggcgcat caggattcat tggttcatgg 60

ctcgtgatcc actttgtcat aagctgttct aagtatttgc agcttcaatc tcggatctaa 120

aacagccccc atagctagaa caagactgta ttcatcccaa tacttagaaa acttaactct 180

cattttctta gccatctctt tcattactgg atcatcacaa ctagcatact tcatcagtaa 240

gcattcaatt ttccacactt gtagaaaata tgcattagcc gttggatatc taacgcctga 300

gaagaacgtt gtaatagtgc tgaaaggctt cagaaactca caaattttct gccctcgatc 360

ccactcatcc tctgaaggca atgatttgta actcctgtca cactctttca aactagtgaa 420

tgcgtcacga aacttcagag ctctagcaag catatcataa gttgaattcc atctggttgg 480

tacatctaga gacagtccag ctccactcct aatccctaca ctctgaacac atgctgcaaa 540

tgcttctatc cttgatccag atgctttgac aaacttaaca ctctctcgga tattttccag 600

aagaccaaca gcaagttcta aaccttcttt cactatgaga ttcaaaatgt gtgcacagca 660

tctaacgtgg aagaacttcc catcacacaa caacccgttg ccgctagcca tttgaagtcg 720

atgcttgagt atcttctgca tactatcgtt ataagtagca ttatccaagg tcatagagaa 780

gacctttttc tctaatcccc actccttcaa acagctaata agtttgttag ccacttcttc 840

accggtatgt ggaggtttca actcactgaa gactagtatc ttgttgttca acttgaagct 900

ctcatcaaca tagtgagctg tcagacagat atatcccgtc atagtagtag aagctgtcca 960

tatatctgag gtaaaagata cccgaccctt gaattctgct aactctttct tcagcttctc 1020

tctttcttcc tcatatctct tatagacatc agctccagca gtttgtctag atatatgctg 1080

gcatttggga ttcaggtact tgtccctagc tctaaccttc tcatactcaa cgtatttgaa 1140

aggctgatca tggaaaataa tgatctcact gatcatatca cgatctactt tcggatcata 1200

ctcacgatca accacttgac ggaggctttt tgggacagat ttctaaatgc cgtttcatag 1260

aagatgttcc tgaggcagat tctgatacta acttcttatt acaatgaatg caacgactcc 1320

ttctttttcc atctgcctct actcctacta ctacgaaatg gttccaaaca agagactttg 1380

cgcgtttaga atgactcaca gtttcagttg cttgaacagg ttgagtttca ctttgtgctt 1440

gtccttgagt ttctgcttca tcatcatcat caacctccat ttgctcattt gcagcctcaa 1500

gagctgctag tgtgtcaagt gtttgtgaat ccatcctgga aaaaacatta aacaatcaga 1560

aaatttaagc tattattgaa tagcgtaacg gcacacatac gcacacataa aacaatatta 1620

ttgtttcagc acaagaccaa accaccactg ataatcaacc tgttaagcac aacaacaaga 1680

aagcccacaa tatgcaaacg taacggcaca catgcgcaca catagaacaa tgttgttgtt 1740

agcacaaaat caatcaaacc ctgagttcac gacctaaatt ttctctataa atggttgatt 1800

aaacttttat tttctttttc tctaacaaaa caaagtactt gatcgaacaa agtgattttt 1860

tacaatcatt gttgtccggg acaacttgac caaccaacca atgatctata gcacaaagac 1920

aaaacccact caagttcttc cagagagttt taagaacaaa caaaagcata gttcttacat 1980

tttatagaga gaacgaagag gaaggtaatc acgtacggac ttcttctggt aacactttga 2040

ctcctttcgt tggggcctaa accaattagg atagaatcga tggttagtca accagattct 2100

aaagcatgag aatcaaaaca caaaaacaca tttcgaaatc ttaccaatga acccaatcta 2160

gaatgaatcg tcgcaagaaa gcatgtctaa tttctagatc tgtgttttgt ggctgtggtt 2220

acgggagaaa caaaaatttg gggtaaaata taatgtaaaa cgacgtcgtt tcggttaatt 2280

ttttttttaa aaaaaaaacc atcgggtacc cgaagcccga tagtgtaaac ccgatagggt 2340

aataaacaaa acaagacccg cccaacaaaa acccgcgagt tttaaaatct aaaagtacgg 2400

gtttcgggtt tcaaatttca accgggcttc gggtacccta tgggtaaaaa cccattatta 2460

acatccctac ttacgagttt tcttggcctg taaaggaaat ttgaagaaag tgcaacatct 2520

tcttgatttg ccaaacgcga agacgcaact cactttatgg aaagccgatt tatctgacga 2580

aggaagctac gatgacgcca taaacggatg cgacggcgtt tttcacatag ctactcccat 2640

ggattttgaa tccaaggatc ccgaggtgag ttatactatg aacctttttc ttattacaca 2700

tcaatcctac aagattttgt taaatgagtt tgtttgaatc agaacgaagt gataaaacca 2760

acagtgaatg gagtgttggg gataatgaaa gcatgtgata aggcaaagac cgtacgaaga 2820

attgtgttta cttcgtctgc tggaacggtt aatgttgagg aacaccagaa aaatgtctat 2880

gatgaaaacg attggagtga tctcgacttt atcatgtcca agaagatgac aggatgggta 2940

tatatattaa ggatcatata taaaaaatta acccgaggtt gatcttcttc aaagtaattt 3000

atgtttttga taaattgttg gcagatgtat ttcatgtcga aaacgttagc cgagaaagca 3060

gcttgggatt acgctaagga aaaaggaata gatttcatta gtattatccc gacattggtg 3120

atcggtccat ttataacaac atctatgccg cctagcctta ttaccgcgct ctctcctatc 3180

actcgtgagt gagcctactt tctaatccct cttttttaac taagaggtta atttaaaacg 3240

gtaaaaatgt tttaggtaac gaggcacatt actccatcat aagacaagga cagtatgtcc 3300

acttggacga cttatgcaat gctcatatat tcttgtacga acaagctgct gccaagggac 3360

gttatgtttg ttcctctcac gatgcaacga ttcttactat ctccgagttt ctcaggcaaa 3420

aatatccaga atataacgtg ccttcaacgt aagattttta tcattaccgg tttaagcttt 3480

ttttccatat tcagtttaat tttttttttt ctgaatatga actctttgga aacaggtttg 3540

aaggagtgga tgagaatcta aagagcatta tgttcagttc caaaaagctg attgatatgg 3600

gatttaactt caagtatagt ctcgaggata tgttggtgga atcgattgag acatgtcgtc 3660

aaaagggttt tctccctgtc actttaccgg aacatttgaa atctgaggac aaagttccgg 3720

gcagtgatga caataaggag attaaaaacg gatctgcagg tttaactgat ggtatggtag 3780

cttgtaagaa gaccgaacca gggatggccg gcgagaaagc cgatagtcac atgtcggcac 3840

agcagatctg tgcttag 3857

<210> 3

<211> 21

<212> DNA

<213> Artificial Synthesis (artificial Synthesis)

<400> 3

atggtagctc acaaagagac t 21

<210> 4

<211> 20

<212> DNA

<213> Artificial Synthesis (artificial Synthesis)

<400> 4

ctaagcacag atctgctgtg 20

<210> 5

<211> 20

<212> DNA

<213> Artificial Synthesis (artificial Synthesis)

<400> 5

cactgttcgc gatcctggta 20

<210> 6

<211> 20

<212> DNA

<213> Artificial Synthesis (artificial Synthesis)

<400> 6

tcttcgtacg gtctttgcct 20

Claims (3)

1. A molecular marker for predicting the color of the inner leaves of kale is characterized in that: the molecular marker is: as set forth in SEQ ID NO: 5 and SEQ ID NO: 6 as a primer, and the nucleotide sequence SEQ ID NO: fragment 443bp in size in 1.

2. The molecular marker for predicting the color of kale inner leaves according to claim 1, which is characterized by: the method for obtaining the molecular marker for predicting the color of the collard inner leaves comprises the following steps: the method comprises the following specific steps:

(1) cultivating collard: taking a collard red inner leaf variety 'red pigeon' as an original resource, and carrying out continuous selfing for 6 generations by adopting a continuous selfing method to obtain a red inner leaf selfing line '42 red'; taking a white inner leaf variety 'white gull' of collard as an original resource, and continuously selfing for 6 generations by adopting a continuous selfing method to obtain a white inner leaf selfing line '1631'; sowing the red inner leaf inbred line '42 red' and the white inner leaf inbred line '1631' and cultivating to a rosette stage;

(2) extraction of genomic DNA of kale variety

The method comprises the following steps of respectively extracting genome DNA of a collard red inner leaf inbred line '42 red' and a white inner leaf inbred line '1631' by adopting an improved CTAB method, and specifically comprises the following steps:

a. weighing young and tender leaves in a mortar, fully grinding the young and tender leaves into powder under the condition of liquid nitrogen freezing protection, and quickly transferring the ground powder into a centrifugal tube;

b. preparing a CTAB extraction buffer solution: weighing 10g of Cetyl Trimethyl Ammonium Bromide (CTAB), 16.38 g of sodium chloride and 10g of polyvinylpyrrolidone (PVP), measuring 20ml of 1mol/L Tris-HCl solution and 8ml of 1mol/L disodium ethylene diamine tetraacetate solution (EDTA), wherein the pH values of the Tris-HCl solution and the disodium ethylene diamine tetraacetate solution are 8, fixing the volume of deionized water to 200ml, and sterilizing at 121 ℃ for 20 min under high pressure for later use;

c. adding a CTAB extraction buffer solution at 65 ℃ into a centrifugal tube, fully and uniformly mixing, putting the centrifugal tube into a water bath kettle at 65 ℃ for 1 h, and turning upside down and uniformly mixing once every 10 min;

d. adding chloroform and isoamylol solution into a centrifuge tube, wherein the volume ratio of chloroform to isoamylol in the chloroform-isoamylol solution is 24:1, slightly reversing the mixture up and down, uniformly mixing the mixture, centrifuging the mixture at the room temperature for 7 min at 12,000 r/min;

e. centrifuging, collecting supernatant, adding isopropanol pre-cooled at-20 deg.C, mixing, and precipitating in refrigerator at-20 deg.C for 1 hr;

f. centrifuging the tube at 12,000 r/min at room temperature for 7 min, and removing the supernatant; adding 75% ethanol, centrifuging at 12,000 r/min for 7 min, removing supernatant, and rinsing twice;

g. opening the centrifuge tube, air drying at room temperature, adding TE buffer solution, dissolving in refrigerator at 4 deg.C for 12 hr, and storing at-20 deg.C;

(3) synthesis ofDFRGene full-length cloning primer:

according TO the cabbage TO1000 genome reference sequence in NCBI (https:// www.ncbi.nlm.nih.gov /), according TO plant anthocyanin accumulation pathway genesDFRSynthesizing a full-length sequence amplification upstream primer F and a full-length sequence amplification downstream primer R of a plant anthocyanin accumulation pathway gene DFR;

the upstream primer F has the sequence shown in SEQ ID NO: 3; the downstream primer R has an amino acid sequence shown in SEQ ID NO: 4;

(4) PCR polymerase chain reaction amplification:

a. PCR polymerase chain reaction system:

5 x Prime STAR GXL Buffer 4.0 μ l, dNTP mix 1.6 μ l, primer F1.0 μ l, primer R1.0 μ l, DNA 2.0 μ l, Prime STAR GXL DNA Polymerase 0.4 μ l, deionized water 10 μ l;

b. PCR polymerase chain reaction conditions: pre-denaturation at 95 ℃ for 5 min; denaturation at 98 ℃ for 10 s, annealing at 60 ℃ for 15 s, extension at 68 ℃ for 90 s, 30 cycles; extension at 68 ℃ for 5 min; storing at 4 ℃ for later use;

(5) agarose gel electrophoresis:

detecting the PCR product by using 1% agarose gel electrophoresis, and taking an electrophoresis picture by using a gel imaging system;

(6) and (3) recovering amplification products: recovering by referring to a recovery kit of SanPrep column type DNA gel provided by Shanghai bioengineering company;

(7) sequencing: and (3) obtaining a PCR product with the sequence shown in SEQ ID NO: 1 and SEQ ID NO: 2;

(8) amplification primer for synthesizing molecular marker for predicting color of collard inner leaves

The polypeptide having the amino acid sequence of SEQ ID NO: 1 and SEQ ID NO: 2, synthesizing a nucleotide sequence with a nucleotide sequence SEQ ID NO: 5 and SEQ ID NO: 6.

3. The molecular marker for predicting the color of kale inner leaves according to claim 1, which is characterized by: the application method of the molecular marker for predicting the color of the collard inner leaves comprises the following steps: the method comprises the following specific steps:

(1) extraction of genomic DNA of collard varieties with different inner leaf colors

a. Weighing young and tender leaves in a mortar, fully grinding the young and tender leaves into powder under the condition of liquid nitrogen freezing protection, and quickly transferring the ground powder into a centrifugal tube;

b. preparing a CTAB extraction buffer solution: weighing 10g of Cetyl Trimethyl Ammonium Bromide (CTAB), 16.38 g of sodium chloride and 10g of polyvinylpyrrolidone (PVP), measuring 20ml of 1mol/L Tris-HCl solution and 8ml of 1mol/L disodium ethylene diamine tetraacetate solution (EDTA), wherein the pH values of the Tris-HCl solution and the disodium ethylene diamine tetraacetate solution are 8, fixing the volume of deionized water to 200ml, and sterilizing at 121 ℃ for 20 min under high pressure for later use;

c. adding a CTAB extraction buffer solution at 65 ℃ into a centrifugal tube, fully and uniformly mixing, putting the centrifugal tube into a water bath kettle at 65 ℃ for 1 h, and turning upside down and uniformly mixing once every 10 min;

d. adding chloroform-isoamylol solution into a centrifuge tube, slightly turning upside down and mixing uniformly, and centrifuging at room temperature for 7 min after 12,000 r/min, wherein the volume ratio of chloroform to isoamylol is 24: 1;

e. centrifuging, collecting supernatant, adding isopropanol pre-cooled at-20 deg.C, mixing, and precipitating in refrigerator at-20 deg.C for 1 hr;

f. centrifuging the tube at 12,000 r/min at room temperature for 7 min, and removing the supernatant; adding 75% ethanol, centrifuging at 12,000 r/min for 7 min, removing supernatant, and rinsing twice;

g. opening the centrifuge tube, air drying at room temperature, adding TE buffer solution, dissolving in refrigerator at 4 deg.C for 12 hr, and storing at-20 deg.C;

(2) the PCR amplification primer is a primer with the sequence shown in SEQ ID NO: 5 and SEQ ID NO: 6;

(3) PCR amplification and electrophoresis detection:

a. and (3) PCR reaction system: 2 × EasyTaq PCR Supermix 5 μ l, DNA 1 μ l, dfr1801F 0.5 μ l, dfr1801R 0.5 μ l, deionized water 3 μ l;

b. and (3) PCR reaction conditions: pre-denaturation at 95 ℃ for 5 min; denaturation at 95 ℃ for 30s, annealing at 60 ℃ for 30s, extension at 72 ℃ for 30s, 30 cycles; extension at 72 ℃ for 5 min; storing at 4 ℃;

c. and (3) agarose gel electrophoresis detection: detecting the PCR product by using 1% agarose gel electrophoresis, taking an electrophoresis picture by using a gel imaging system, wherein the genome DNA of the collard variety with pink, red or purple red can amplify a 443bp specific band, and the collard variety with white inner leaves has no specific band.

Images