CN111321240B - Molecular marker for predicting collard leaf margin character and application thereof - Google Patents

Abstract

The invention relates to a use method of a molecular marker for predicting collard leaf margin traits, wherein the molecular marker is CAPS _ F and CAPS _ R, and the CAPS _ F nucleotide sequence is shown in SEQ ID NO:1, the CAPS _ R nucleotide sequence is shown in SEQ ID NO:2, the molecular marker is applied to early prediction of the leaf margin incised character of the kale cultivated at any development stage. The invention establishes a method for early predicting the collard leaf margin notching character by applying CAPS molecular markers without being influenced by the development stage, and has important scientific guiding significance for collard leaf shape identification and new variety breeding.

Description

Molecular marker for predicting collard leaf margin character and application thereof

Technical Field

The invention belongs to the field of plant molecules, and particularly relates to a molecular marker for predicting collard leaf margin traits and application thereof, which can be used for collard leaf-shaped molecular marker-assisted selective breeding.

Background

Kale (a)Brassica oleracea var. acephala) Is a leaf-watching plant of the second year of brassica in the family of cruciferae, and the leaf shape and the color are rich and gorgeous, and beautiful and elegant. The leaf shape is one of the important ornamental characters of the kale, and has various types such as cracked leaves, round leaves, wrinkled leaves and the like. The leaves of the kale enter the rosette stage and develop to be mature, and the leaf margin develops completely.

When the traditional phenotype identification method is used for identifying the leaf shape character of the kale, accurate identification can be performed only after the kale is sowed, the time from sowing of the kale to the rosette stage is 3 months, and the judgment of the phenotype is influenced because the leaves of the kale in different development stages are influenced by environmental factors. In addition, kale is a biennial plant, a nutrient vernalization type, is difficult to add, and once phenotype identification is delayed, the whole year of a breeding cycle is wasted. The DNA molecular marker can detect and analyze a specific DNA segment in a plant genome, has the advantages of no influence of plant environmental conditions and development stage difference, no influence of plant tissue type difference or whether the gene starts expression, small quantity of required DNA templates, simple and quick operation and the like, and is an important scientific basis for auxiliary selection breeding of the plant molecular marker. The CAPS marker is a DNA marker for detecting SNP sites generated by combining specific primer PCR with restriction enzyme cleavage, and has the characteristics of codominance, site specificity, simple and rapid operation, low cost and the like. At present, a method for predicting the leaf margin incised character of the kale by molecular markers is not available.

The technical problem to be solved by the invention is as follows: the leaf margin cleavage character can be identified in the cotyledon period within one week after sowing by developing a CAPS molecular marker method, the breeding process is accelerated, and the method has important significance for collard leaf shape breeding.

Disclosure of Invention

In order to make up for the defects of the prior art, the invention aims to provide a molecular marker for predicting the collard leaf margin character and application thereof, which can identify the leaf margin cracking character at any development stage of the collard, predict the leaf margin character of the collard in advance and accelerate the breeding process.

The invention provides a molecular marker (the sequence is shown in SEQ ID NO:1 and SEQ ID NO: 2) for predicting the collard leaf margin character,

the molecular marker is:

CAPS_F: cgatcatcgtcaaccacatag（SEQ ID NO：1）

CAPS_R: tagaactccacacaagactg（SEQ ID NO：2）

the invention also provides application of the molecular marker, and the genetic marker can be used for early predicting the leaf margin incised character of the kale cultivated at any development stage.

The invention also provides a using method of the molecular marker, which comprises the following steps: the technical points are as follows:

(1) Extraction of genomic DNA of kale

The method for extracting the kale genome DNA by adopting an improved CTAB method comprises the following steps:

(1) weighing 0.15 g of leaves in a mortar, fully grinding under the protection of liquid nitrogen, and quickly transferring powder into a 2 mL centrifuge tube;

(2) preparing a CTAB extraction buffer solution: weighing 25g of Cetyl Trimethyl Ammonium Bromide (CTAB), 40.95 g of sodium chloride and 25g of polyvinylpyrrolidone (PVP), measuring 50mL of 1mol/L Tris-HCl (pH = 8) and 20mL of 1mol/L disodium ethylene diamine tetraacetate (EDTA, pH = 8), fixing the volume of deionized water to 500mL, and carrying out autoclaving at 121 ℃ for 20 min for later use;

(3) adding 700 μ L of 65 deg.C CTAB extraction buffer solution (containing 2% beta-mercaptoethanol) into the centrifuge tube, mixing, placing in 65 deg.C water bath for 1 hr, and mixing once every 10 min;

(4) adding 700 μ L of chloroform-isoamyl alcohol solution (volume ratio =24 1) to the centrifuge tube, inverting and mixing, then centrifuging at room temperature for 7 min at 12,000 r/min;

(5) carefully sucking 400 mu L of clear liquid into another 1.5mL centrifuge tube, adding 800 mu L of pre-cooled isopropanol at-20 ℃, uniformly mixing, and placing in a refrigerator at-20 ℃ for precipitation for 1 h;

(6) centrifuging the tube at 12,000 r/min at room temperature for 7 min, and removing the supernatant; adding 800 μ L of 75% ethanol, centrifuging at 12,000 r/min for 2 min, discarding supernatant, and rinsing twice;

(7) opening the centrifuge tube, air drying at room temperature, adding 50 μ L TE buffer solution, and storing at-20 deg.C;

(2) PCR amplification

PCR amplification primers are CAPS _ F and CAPS _ R (the sequences are shown in SEQ ID NO:1 and SEQ ID NO: 2);

the CAPS _ F: cgatcatcgtcaaccacacatag (SEQ ID NO: 1);

the CAPS _ R: tagaactacaagactg (SEQ ID NO: 2);

and (3) PCR reaction system: comprises 2 XEasyTaq PCR Supermix 5 muL, DNA 1 muL, CAPS _ F0.5 muL, CAPS _ R0.5 muL and deionized water 3 muL;

and (3) PCR reaction conditions: pre-denaturation at 95 ℃ for 5min; denaturation at 95 ℃ for 30s, annealing at 60 ℃ for 30s, extension at 72 ℃ for 30s,30 cycles; extension at 72 ℃ for 5min; storing at 4 ℃;

an enzyme digestion reaction system: comprises 5 mu L of PCR products, and the PCR products,Hin1 mu L of fiI restriction enzyme (the restriction site is G ^ ANTC), 14 mu L of deionized water, and 20 mu L of deionized water in total;

and (3) enzyme digestion reaction program: 37 ℃ and 3h.

(3) Agarose gel electrophoresis detection

And detecting the PCR product by using 2% agarose gel electrophoresis, taking an electrophoresis picture by using a gel imager, wherein two specific bands of 261bp and 119bp are leaf-edge deep-cracked collard, and a band of 380bp is leaf-edge full-edge collard.

The invention also provides a method for obtaining the molecular marker, which comprises the following steps: the technical points are as follows:

1. cultivation of kale: adopting a conventional method to cultivate seedlings of a collard cracked leaf inbred line 'L9' and a round leaf inbred line 'Y1';

the 'L9' takes a collard leaf margin deep-cracked variety 'Red Peacock' as an original resource, and a continuous selfing method is adopted to perform continuous selfing for 6 generations to obtain a leaf margin deep-cracked selfing line 'L9';

the 'Y1' takes a collard leaf margin whole-edge variety 'Red cane' as an original resource, and a continuous selfing method is adopted to perform continuous selfing for 6 generations to obtain a leaf margin whole-edge selfing line 'Y1';

2. separation and sequencing of full-length sequence of collard dehiscent gene

The method comprises the following steps of respectively extracting genome DNA of a collard dehisced leaf inbred line 'L9' and a round leaf inbred line 'Y1' by adopting an improved CTAB method, and specifically comprises the following steps:

(1) Weighing 0.15 g of leaves in a mortar, fully grinding under the protection of liquid nitrogen, and quickly transferring powder into a 2 mL centrifuge tube;

(2) Preparing a CTAB extraction buffer solution: weighing 25g of hexadecyl trimethyl ammonium bromide (CTAB), 40.95 g of sodium chloride and 25g of polyvinylpyrrolidone (PVP), measuring 50mL of 1mol/L Tris-HCl (pH = 8) and 20mL of 1mol/L disodium ethylene diamine tetraacetate (EDTA, pH = 8), fixing the volume of deionized water to 500mL, and carrying out autoclaving at 121 ℃ for 20 min for later use;

(3) Adding 700 μ L of 65 deg.C CTAB extraction buffer solution (containing 2% beta-mercaptoethanol) into the centrifuge tube, mixing, placing in 65 deg.C water bath for 1 hr, and mixing once every 10 min;

(4) Adding 700 μ L of chloroform-isoamylalcohol solution (volume ratio =24 1) to a centrifuge tube, inverting and mixing uniformly, centrifuging at room temperature for 7 min at 12,000 r/min;

(5) Carefully sucking 400 mu L of clear liquid into another 1.5mL centrifuge tube, adding 800 mu L of pre-cooled isopropanol at-20 ℃, uniformly mixing, and placing in a refrigerator at-20 ℃ for precipitation for 1 h;

(6) Centrifuging the tube at 12,000 r/min at room temperature for 7 min, and removing the supernatant; adding 800 μ L75% ethanol, centrifuging at 12,000 r/min for 2 min, removing supernatant, and rinsing twice;

(7) Opening the centrifugal tube, drying at room temperature, adding 50 μ L TE buffer solution, and dissolving in refrigerator at 4 deg.C, and storing at-20 deg.C;

3. designing a full-length cloning primer of a collard dehiscent gene:

according TO the sequence of a cabbage TO1000 reference genome XM _013753823.1 gene in NCBI (https: w.ncbi.nlm.nih.gov /), full-length sequence amplification primers (the sequences are shown in SEQ ID NO:3 and SEQ ID NO: 4) of the gene are designed, wherein the primers are as follows:

an upstream primer F: atggggagactagcgcttgcag (SEQ ID NO: 3)

A downstream primer R: ctaccaaataaccttggaca (SEQ ID NO: 4)

4. And (3) PCR amplification:

(1) And (3) PCR reaction system: including 5 XPrime STAR GXL Buffer 4. Mu.L, dNTPs mix 1.6. Mu.L, upstream primer F1. Mu.L, downstream primer R1. Mu.L, DNA 2. Mu.L, prime STAR GXL DNA Polymerase 0.4. Mu.L, deionized water 10. Mu.L, total 20. Mu.L;

(2) And (3) PCR reaction conditions: pre-denaturation at 95 ℃ for 5min; denaturation at 98 ℃ for 10 s, annealing at 60 ℃ for 15 s, extension at 68 ℃ for 90 s,35 cycles; extension at 68 ℃ for 5min; storing at 4 ℃ for later use.

5. Agarose gel electrophoresis:

detecting the PCR product by using 1% agarose gel electrophoresis, and taking an electrophoresis picture by using a gel imager;

6. and (3) recovering amplification products: recovering by referring to a recovery kit of SanPrep column type DNA gel provided by Shanghai bioengineering company;

7. the product was recovered and ligated with the cloning Vector pEASY-Blunt Zero Vector, and transformed into E.coli TransT1,

extracting plasmids;

8. sequencing: the plasmid connected with the cloning vector is entrusted to Beijing Optimalaceae biology company for sequencing, and the determined parental full-length sequence is as follows:

>L9（SEQ ID NO：5）

>Y1（SEQ ID NO：6）

9. synthesis of molecular marker for predicting collard leaf margin character

The polypeptide having the amino acid sequence of SEQ ID NO:5 and SEQ ID NO:6, comparing the differential sites by Multalin online software (http:// Multalin. Toulouse. Inra. Fr/Multalin /); zero mismatch is introduced into a sequence containing a differential site at dCAPS Finder2.0 (http:// helix.wustl.edu/dCAPS/dcaps.html), and the enzyme cutting site is determined to be G ^ ANTC; two oligonucleotide primers CAPS _ F and CAPS _ R were designed to be synthesized.

The invention has the positive effects that: a method for early predicting the leaf margin trait of the kale by applying CAPS molecular markers under the condition of not being influenced by the development stage is established, the leaf margin trait of the kale is predicted in advance, and the breeding process is accelerated. Has important scientific guiding significance for identifying the leaf shape of the kale and breeding new varieties.

Drawings

FIG. 1 is a top view of a kale inbred line ` L9 `;

FIG. 2 is a top view of a kale inbred line 'Y1';

FIG. 3 is a photograph of agarose gel electrophoresis detection of example 2;

FIG. 4 is a top view of a kale variety of "Red Starfish";

FIG. 5 is a photograph of an agarose gel electrophoresis test of example 3;

fig. 6 is a top view of the inbred line round leaf pan-dried of kale.

Detailed Description

Example 1

1.1 obtaining molecular markers

(1) Cultivation of kale: adopting a conventional method to cultivate the sowing seedlings of the collard dehiscent leaf inbred line 'L9' and the round leaf inbred line 'Y1';

the 'L9' takes a collard leaf margin deep-cracked variety 'Red Peacock' as an original resource, and a continuous selfing method is adopted to perform continuous selfing for 6 generations to obtain a leaf margin deep-cracked selfing line 'L9';

the 'Y1' takes a collard leaf margin whole-edge variety 'Red cane' as an original resource, and a continuous selfing method is adopted to perform continuous selfing for 6 generations to obtain a leaf margin whole-edge selfing line 'Y1';

(2) Separation and sequencing of full-length sequence of collard dehiscent gene

The improved CTAB method is adopted to respectively extract the genome DNA of a collard dehiscent leaf inbred line 'L9' and a round leaf inbred line 'Y1', and the specific method comprises the following steps:

a. weighing 0.15 g of leaves in a mortar, fully grinding under the protection of liquid nitrogen, and quickly transferring powder into a 2 mL centrifuge tube;

preparing CTAB extraction buffer solution: weighing 25g of Cetyl Trimethyl Ammonium Bromide (CTAB), 40.95 g of sodium chloride and 25g of polyvinylpyrrolidone (PVP), measuring 50mL of 1mol/L Tris-HCl (pH = 8) and 20mL of 1mol/L disodium ethylene diamine tetraacetate (EDTA, pH = 8), fixing the volume of deionized water to 500mL, and carrying out autoclaving at 121 ℃ for 20 min for later use;

c. adding 700 μ L of 65 deg.C CTAB extraction buffer solution (containing 2% beta-mercaptoethanol) into the centrifuge tube, mixing, placing in 65 deg.C water bath for 1 hr, and mixing once every 10 min;

d. adding 700 μ L of chloroform-isoamyl alcohol solution (volume ratio =24 1) to the centrifuge tube, inverting and mixing, then centrifuging at room temperature for 7 min at 12,000 r/min;

e. carefully sucking 400 mu L of clear liquid into another 1.5mL centrifuge tube, adding 800 mu L of pre-cooled isopropanol at-20 ℃, uniformly mixing, and placing in a refrigerator at-20 ℃ for precipitation for 1 h;

f. centrifuging the tube at 12,000 r/min at room temperature for 7 min, and removing the supernatant; adding 800 μ L75% ethanol, centrifuging at 12,000 r/min for 2 min, removing supernatant, and rinsing twice;

g. opening the centrifuge tube, air drying at room temperature, adding 50 μ L TE buffer solution, and storing at-20 deg.C;

(3) Designing a full-length cloning primer of a collard dehiscent gene:

according TO the sequence of a cabbage TO1000 reference genome XM _013753823.1 gene in NCBI (https:// www.ncbi.nlm.nih.gov /), a full-length sequence amplification primer of the gene is designed, wherein the primer is as follows:

an upstream primer F: atggggagactagcgcttgcag

A downstream primer R: ctaccaaataaccttggaca;

(4) And (3) PCR amplification:

a, PCR reaction system: including 5 XPrime STAR GXL Buffer 4. Mu.L, dNTPs mix 1.6. Mu.L, upstream primer F1. Mu.L, downstream primer R1. Mu.L, DNA 2. Mu.L, prime STAR GXL DNA Polymerase 0.4. Mu.L, deionized water 10. Mu.L, total 20. Mu.L;

PCR reaction conditions: pre-denaturation at 95 ℃ for 5min; denaturation at 98 ℃ for 10 s, annealing at 60 ℃ for 15 s, extension at 68 ℃ for 90 s,35 cycles; extension at 68 ℃ for 5min; storing at 4 ℃ for later use.

(5) Agarose gel electrophoresis:

detecting the PCR product by using 1% agarose gel electrophoresis, and taking an electrophoresis picture by using a gel imager;

(6) And (3) recovering amplification products: recovering by referring to a recovery kit of SanPrep column type DNA gel provided by Shanghai bioengineering company;

(7) Recovering a product connected cloning Vector pEASY-Blunt Zero Vector, transforming Escherichia coli TransT1, and extracting a plasmid;

(8) Sequencing: the plasmid connected with the cloning vector is entrusted to Beijing Optimalaceae biology company for sequencing, and the determined parental full-length sequence is as follows:

>L9 ：

atggggagac tagcgcttgc agctataacg agcttgtggg tgattcccat gtcgatcatc

gtcaaccaca tagttcccga tccctacatg gacgagatat tccatgtgcc tcaggctcag

caatactgca atggcaattt cagtagctgg gatccaatga tcactacccc acctggattg

taatgctctc ttccttctta atttaatttg gtcttgttag tgcaaaagtt aagaagagat

tgattgaaag tttgaatatt ttgtaactag tagctgaaaa tgttgacttt ttgttgttgt

tgcaggtact gtctatcact agcacatgtt gattctctgt ttccaggaat gttgttgatg

agaactactt ctcagttctt ttcagaagct tgttctgcgt ctgtcctgcg gtctactaat

gctgtttttg cagtcttgtg tggagttcta gtgtatgaga ttatcaggtt cttggggccg

agtctcagtg atagaaaagc aactttaatg gctttggtca tgtctcttta ccctctccac

tggttcttca ctttcctcta ctatacggat gttgcgtctc tcaccacttt tcttgccatg

tacctcgctt gtttgaggag aagatatatc ctcagtgctg tggtaagtca ttttgaagct

gtttgttgtt ttcctgtcag aattacaaat ttatttatgc ttattgtcct tgcagtttgg

tactttagcg attttgatca ggcaaacaaa tgtagtctgg atgcttttcg ttgcttgctc

aggtgtttta gacttcactc ttgactctcc gcggaaaatg gataaacaaa aagtaaataa

agatttgcat cagtccattg ataggaaaga agcaactctg agatcgaatc ttagaaatag

aaaacctgat aacaacttgg atactagaga cagttttgac cgtggaaaat ctgtttcttc

agcagaggat acttcaggta tgttgctaat agtttgacat atatactgtt aaacataagt

gttccttact cttacaatat ctaagggtct ttttgtacat atcttttaat gaaaacaata

tacaggctta gtctatgatg tttatgatgt aatctccaca tcttggaata tgaagtggaa

gattttgttc aaattcagcc ctttcatcgt ggttgtggta gcctttggta tttttatact

ctggaacggc ggtatagtcc tcggtatgat tcatccatat gcgttttctg taaatggaaa

gttatgtttc tgttgtcttt tttactaatc catcaatttc aaaatccgca ggtgcaaaag

aggctcatgt ggtttcacca cattttgcgc agataatgta ttttagcctc gtctctgcac

tttttactgc tcccctacac ttctcagtag agcaagtgag aaatctactc caagagctcc

gaagaaattg gcccttaagc cttctactaa ctcttgtggc tctagtagct ggttttgcct

ctgtacactt tttcaggttc agtttcttga cacctctcaa aacacctctt aaggtcttcc

actacaaact ctcattctga aaaataattg cagcttggct catccttatc ttctcgctga

taatcgccac tatccattct atctatggag gaaaattatc aacgctcatt ggttgatgaa

atacatgcta gtcccggttt acgtctattc ctggttctca atcctaactt tattaggtat

gttcaaatca tttttgtgtg agacggtttt tttatcttcc ttttttggca ttgtgaattt

gactttggtt ctgtctcaat ccgacagcaa aaactcgaag caagatctgg gtgttggtct

atttcttagc tacatgtgct gttcttgttc ctacgccatt gatcgagttc agatattaca

ccattccgtt ttatatcttc atgcttcact cctgtgtcag aagcagcggt tacacaactt

ggcttcttac tggaacgatt tttgtgtgta tcaatgtgtt tacaatggct atgttcttgt

ttagaccatt caagtggagc catgaggatg gtgtccaaag gtttatttgg tag

>Y1

atggggagac tagcgcttgc agctataacg agcttgtggg tgattcccat gtcgatcatc

gtcaaccaca tagttcccga tccctacatg gacgagatat tccatgtgcc tcaggctcag

caatactgca atggcaattt cagtagctgg gatccaatga tcactacccc acctggattg

taatgctctc ttccttctta atttaatttt gtcttgttag tgcaaaactt aagaagagag

tgattgaaag tttgaatctt tttttttttt tgctgttgtt gttgcaggta ctgtctatca

ctagcacatg ttgcttctct gtttccagga atgttgttga tgagaactac ttctcaactc

ttttcagaag cttgttctgc gtctgtcctg cggtctacta atgctgtttt tgcagtcttg

tgtggagttc tagtgtatga gattatcagg ttcttggggc cgagtctcag tgatagaaaa

gcaactttaa tggctttggt catgtctctt taccctctcc actggttctt cactttcctc

tactatacgg atgttgcgtc tctcaccact tttcttgcca tgtacctcgc ttgtttgagg

agaagatata tcctcagtgc tgtggtaagt cattttgaag ctgtttgttg ttttcctgtc

agaattacaa atttatttat gcttattgtc cttgcagttt ggtactttag cgattttgat

caggcaaaca aatgtagtct ggatgctttt cgttgcttgc tcaggtgttt tagacttcac

tcttgactct ccgcggaaaa tggataaaca aaaagtaaat aaagatttgc atcagtccat

tgataggaaa gaagcaactc tgagatcgaa tcttagaaat agaaaacctg ataacaactt

ggatactaga gacagttttg accgtggaaa atctgtttct tcagcagagg atacttcagg

tatgttgcta atagtttgac atatatactg ctaaacataa gtgttcctta ctcttacaat

atctaagggt ctttttgtac atatctttta atgaaaacaa tatacaggct tagtctatga

tgtttatgat gtaatctcca catcttggaa tatgaagtgg aagattttgt tcaaattcag

ccctttcatc gtggttgtgg tagcctttgg tatttttata ctctggaacg gcggtatagt

cctcggtatg attcatccat atgcgttttc tgtaaatgga aagttatgtt tctgttgtct

tttttactaa tccatcaatt tcaaaatccg caggtgcaaa agaggctcat gtggtttcac

cacattttgc gcagataatg tattttagcc tcgtctctgc actttttact gctcccctac

acttctcagt agagcaagtg agaaatctac tccaagagct ccgaagaaat tggcccttaa

gccttctact aactcttgtg gctctagtag ctggttttgc ctctgtacac tttttcaggt

tcagtttctt gacacctctc aaaacacctc ttaaggtctt ccactacaaa ctctcattct

gaaaaataat tgcagcttgg ctcatcctta tcttctcgct gataatcgcc actatccatt

ctatctatgg aggaaaatta tcaacgctca ttggttgatg aaatacatgc tagtcccggt

ttacgtctat tcctggttct caatcctaac tttattaggt atgttcaaat catttttgtg

tgagacggtt tttttatctt ccttttttgg cattgtgaat ttgactttgg ttctgtctca

atccgacagc aaaaactcga agcaagatct gggtgttggt ctatttctta gctacatgtg

ctgttcttgt tcctacgcca ttgatcgagt tcagatatta caccattccg ttttatatct

tcatgcttca ctcctgtgtc agaagcagcg gttacacaac ttggcttctt actggaacga

tttttgtgtg tatcaatgtg tttacaatgg ctatgttctt gtttagacca ttcaagtgga

gccatgagga tggtgtccaa aggtttattt ggtag

(9) Synthesis of molecular marker for predicting collard leaf margin character

Comparing the difference sites by Multalin online software (http:// mullin. Toulouse. Inra. Fr/Multalin /) according to the nucleotide sequence shown in step (8); introducing zero mismatch into the sequence containing the difference site at dCAPS Finder2.0 (http:// helix.wustl.edu/dCAPS/dcaps.html), and determining the enzyme cutting site as G ^ ANTC; two oligonucleotide primers CAPS _ F and CAPS _ R were designed and synthesized, a molecular marker for predicting the collard leaf margin trait, which was: CAPS _ F cgatcatcgtcaaccacacatacag and CAPS _ R tagaacacccacgg.

1.2 applications of molecular markers

The leaf margin incised character of the kale cultivated at any development stage can be predicted early.

The use method of the molecular marker comprises the following steps:

(1) Extraction of kale genome DNA

The method for extracting the kale genome DNA by adopting an improved CTAB method comprises the following steps:

(1) weighing 0.15 g of leaves in a mortar, fully grinding under the protection of liquid nitrogen, and quickly transferring powder into a 2 mL centrifuge tube;

(2) preparing a CTAB extraction buffer solution: weighing 25g of Cetyl Trimethyl Ammonium Bromide (CTAB), 40.95 g of sodium chloride and 25g of polyvinylpyrrolidone (PVP), measuring 50mL of 1mol/L Tris-HCl (pH = 8) and 20mL of 1mol/L disodium ethylene diamine tetraacetate (EDTA, pH = 8), fixing the volume of deionized water to 500mL, and carrying out autoclaving at 121 ℃ for 20 min for later use;

(3) adding 700 μ L of 65 deg.C CTAB extraction buffer solution (containing 2% beta-mercaptoethanol) into the centrifuge tube, mixing, placing in 65 deg.C water bath for 1 hr, and mixing once every 10 min;

(4) adding 700 μ L of chloroform-isoamylalcohol solution (volume ratio =24 1) to a centrifuge tube, inverting and mixing uniformly, centrifuging at room temperature for 7 min at 12,000 r/min;

(5) carefully sucking 400 mu L of clear liquid into another 1.5mL centrifuge tube, adding 800 mu L of pre-cooled isopropanol at-20 ℃, uniformly mixing, and placing in a refrigerator at-20 ℃ for precipitation for 1 h;

(6) centrifuging the tube at 12,000 r/min at room temperature for 7 min, and discarding the supernatant; adding 800 μ L75% ethanol, centrifuging at 12,000 r/min for 2 min, removing supernatant, and rinsing twice;

(7) opening the centrifuge tube, air drying at room temperature, adding 50 μ L TE buffer solution, and storing at-20 deg.C;

(2) PCR amplification

PCR amplification primers are CAPS _ F and CAPS _ R; the CAPS _ F: cgatcatcgtcaaccacacatag, the CAPS _ R: tagaaccacaagactg;

and (3) PCR reaction system: comprises 2 XEasyTaq PCR Supermix 5 muL, DNA 1 muL, CAPS _ F0.5 muL, CAPS _ R0.5 muL and deionized water 3 muL;

and (3) PCR reaction conditions: pre-denaturing at 95 ℃ for 5min; denaturation at 95 ℃ for 30s, annealing at 60 ℃ for 30s, extension at 72 ℃ for 30s,30 cycles; extension at 72 ℃ for 5min; storing at 4 ℃;

an enzyme digestion reaction system: including PCR product 5 muL，HinF I, 1 mu L of restriction enzyme (the restriction enzyme cutting site is G ^ ANTC), 14 mu L of deionized water and 20 mu L of total;

and (3) enzyme digestion reaction program: 37 ℃ and 3h.

(3) Agarose gel electrophoresis detection

And detecting the PCR product by using 2% agarose gel electrophoresis, taking an electrophoresis picture by using a gel imager, wherein two specific bands of 261bp and 119bp are leaf-edge deep-cracked collard, and a band of 380bp is leaf-edge full-edge collard.

Example 2: successfully verifies the specific molecular marker of the deep-cracked collard leaf margin variety 'red starfish'.

The red starfish is F prepared by hybridizing a collard leaf edge deep-split inbred line 'split leaf-6' serving as a female parent and a collard round leaf inbred line '42 white' serving as a male parent ₁ And (4) variety.

The specific method comprises the following steps:

A. cultivation of kale: sowing seeds of the deep-cracked collard leaf edge variety 'red starfish'.

Preparing a plug tray with 120 holes, slightly compacting after filling the plug tray with the matrix, soaking the matrix with water, dibbling one seed in each hole, covering soil for 2cm, sowing, and standing at 25 ℃ for 3 days to obtain seedlings.

Detection of CAPS molecular markers:

1. the method comprises the following steps of extracting the genome DNA of a kale dehiscent leaf variety 'red starfish' by adopting an improved CTAB method:

(1) Weighing 0.15 g of leaves in a mortar, fully grinding the leaves to powder under the condition of liquid nitrogen freezing protection, and quickly transferring the ground powder into a 2 mL centrifuge tube.

(2) Adding 700 μ L of 65 deg.C CTAB extract into the centrifuge tube, mixing, placing the centrifuge tube in 65 deg.C water bath for 1 h, and mixing once every 10 min.

(3) To the tube was added 700 μ L of chloroform-isoamyl alcohol (volume ratio =24 1), mixed by gently inverting the mixture upside down, and centrifuged at 12,000 r/min at room temperature for 7 min.

(4) After centrifugation, 400 mu L of supernatant is absorbed into a 1.5mL centrifuge tube, 800 mu L of pre-cooled isopropanol at the temperature of 20 ℃ below zero is added, and after uniform mixing, the mixture is placed in a refrigerator at the temperature of 20 ℃ below zero for precipitation for 1 h.

(5) Centrifuging the tube at 12,000 r/min at room temperature for 7 min, and removing the supernatant; then, 800. Mu.L of 75% ethanol was added thereto, and the mixture was centrifuged at 12,000 r/min for 7 min, and the supernatant was discarded and the rinsing was repeated twice.

(6) And opening the centrifuge tube, placing at room temperature for air drying, adding 50 mu L of TE buffer solution, placing in a refrigerator at 4 ℃ for redissolving for 12 h, and storing at-20 ℃ for later use.

2. PCR amplification;

(1) And (3) PCR reaction system: 2 × EasyTaq PCR Supermix 5 μ L, DNA 1 μ L, CAPS _ F0.5 μ L, CAPS _ R0.5 μ L, deionized water 3 μ L, total 10 μ L;

(2) And (3) PCR reaction conditions: pre-denaturing at 95 ℃ for 5min; denaturation at 95 ℃ for 30s, annealing at 60 ℃ for 30s, extension at 72 ℃ for 30s,30 cycles; extension at 72 ℃ for 5min; storing at 4 ℃.

(3) An enzyme digestion reaction system: the PCR product was added in an amount of 5. Mu.L,Hin1 mu L of fiI restriction enzyme (the restriction enzyme cutting site is G ^ ANTC), 14 mu L of deionized water, and the total amount is 20 mu L;

(4) And (3) enzyme digestion reaction program: 37 ℃ for 3h.

(5) And (3) agarose gel electrophoresis detection: the PCR product was detected by 2% agarose gel electrophoresis and the gel imager photographed the electrophoresis. Specific bands of 261bp and 119bp were excised from the deep-cracked collard leaf edge variety ` Red Starfish ` (see FIG. 3).

C. Application of CAPS molecular marker: by using this CAPS molecular marker, the leaf margin of the kale leaf margin deep-cracked variety 'red starfish' was successfully verified to be deep-cracked (fig. 4).

Example 3: successfully verifies the specificity of the marker as the collard leaf margin whole-margin inbred line' round leaf pan-powdering

And (4) marking sex molecules.

The round leaf pan-powdering is a selfing line obtained by continuous selfing by taking a collard leaf edge complete variety 'Sun Rice' as a female parent.

The specific method comprises the following steps:

A. cultivation of kale: sowing the collard leaf margin all-edge inbred line round leaf pan-powdering seeds.

Preparing a plug tray with 120 holes, slightly compacting after filling the plug tray with the matrix, soaking the matrix with water, dibbling one seed in each hole, covering soil for 2cm, sowing, and standing at 25 ℃ for 3 days to obtain seedlings.

Detection of CAPS molecular markers:

1. the method comprises the following steps of extracting genome DNA of a collard leaf margin whole-edge inbred line round leaf pan-powdering by adopting an improved CTAB method, wherein the specific method comprises the following steps:

(1) Weighing 0.15 g of leaves in a mortar, fully grinding the leaves to powder under the condition of liquid nitrogen freezing protection, and quickly transferring the ground powder to a 2 mL centrifuge tube.

(2) Adding 700 μ L of 65 deg.C CTAB extract into the centrifuge tube, mixing, placing the centrifuge tube in 65 deg.C water bath for 1 h, and mixing once every 10 min.

(3) To the tube was added 700 μ L of chloroform-isoamyl alcohol (volume ratio =24 1), mixed by gently inverting the mixture upside down, and centrifuged at 12,000 r/min at room temperature for 7 min.

(4) After centrifugation, 400 mu L of supernatant is absorbed into a 1.5mL centrifuge tube, 800 mu L of pre-cooled isopropanol at the temperature of 20 ℃ is added, and after uniform mixing, the mixture is placed in a refrigerator at the temperature of 20 ℃ below zero for precipitation for 1 h.

(5) Centrifuging the tube at 12,000 r/min at room temperature for 7 min, and removing the supernatant; then, 800. Mu.L of 75% ethanol was added thereto, and the mixture was centrifuged at 12,000 r/min for 7 min, and the supernatant was discarded and the rinsing was repeated twice.

(6) And opening the centrifuge tube, airing at room temperature, adding 50 mu L of TE buffer solution, putting the centrifuge tube in a refrigerator at 4 ℃ for redissolving for 12 h, and storing at-20 ℃ for later use.

2. PCR amplification;

(1) And (3) PCR reaction system: 2 × EasyTaq PCR Supermix 5 μ L, DNA 1 μ L, CAPS _ F0.5 μ L, CAPS _ R0.5 μ L, deionized water 3 μ L, total 10 μ L;

(2) And (3) PCR reaction conditions: pre-denaturation at 95 ℃ for 5min; denaturation at 95 ℃ for 30s, annealing at 60 ℃ for 30s, extension at 72 ℃ for 30s,30 cycles; extending at 72 ℃ for 5min; storing at 4 ℃.

(3) An enzyme digestion reaction system: the PCR product was added in an amount of 5. Mu.L,Hin1 mu L of fiI restriction enzyme (the restriction site is G ^ ANTC), 14 mu L of deionized water and 20 mu L of total

(4) And (3) enzyme digestion reaction program: 37 ℃ for 3h.

(5) And (3) agarose gel electrophoresis detection: the PCR product was detected by 2% agarose gel electrophoresis and the gel imager photographed the electrophoresis. The collard leaf margin complete inbred line 'round leaf powder-flooding' can not be recognized and cut by endonuclease, and a specific band of 380bp is generated (figure 5).

C. Application of CAPS molecular marker: by using this CAPS molecular marker, the limbus of the collard limbus whole inbred line 'round leaf pan-dust' was successfully verified to be whole limbus (see fig. 6).

Sequence listing

<110> Shenyang agriculture university

<120> molecular marker for predicting collard leaf margin traits and application thereof

<160> 6

<170> SIPOSequenceListing 1.0

<210> 1

<211> 21

<212> DNA

<213> Artificial Synthesis (artificial Synthesis)

<400> 1

cgatcatcgt caaccacata g 21

<210> 2

<211> 20

<212> DNA

<213> Artificial Synthesis (artificial Synthesis)

<400> 2

tagaactcca cacaagactg 20

<210> 3

<211> 22

<212> DNA

<213> Artificial Synthesis (artificial Synthesis)

<400> 3

atggggagac tagcgcttgc ag 22

<210> 4

<211> 22

<212> DNA

<213> Artificial Synthesis (artificial Synthesis)

<400> 4

ctaccaaata aacctttgga ca 22

<210> 5

<211> 2093

<212> DNA

<213> collard (organic kale extended line)

<400> 5

atggggagac tagcgcttgc agctataacg agcttgtggg tgattcccat gtcgatcatc 60

gtcaaccaca tagttcccga tccctacatg gacgagatat tccatgtgcc tcaggctcag 120

caatactgca atggcaattt cagtagctgg gatccaatga tcactacccc acctggattg 180

taatgctctc ttccttctta atttaatttg gtcttgttag tgcaaaagtt aagaagagat 240

tgattgaaag tttgaatatt ttgtaactag tagctgaaaa tgttgacttt ttgttgttgt 300

tgcaggtact gtctatcact agcacatgtt gattctctgt ttccaggaat gttgttgatg 360

agaactactt ctcagttctt ttcagaagct tgttctgcgt ctgtcctgcg gtctactaat 420

gctgtttttg cagtcttgtg tggagttcta gtgtatgaga ttatcaggtt cttggggccg 480

agtctcagtg atagaaaagc aactttaatg gctttggtca tgtctcttta ccctctccac 540

tggttcttca ctttcctcta ctatacggat gttgcgtctc tcaccacttt tcttgccatg 600

tacctcgctt gtttgaggag aagatatatc ctcagtgctg tggtaagtca ttttgaagct 660

gtttgttgtt ttcctgtcag aattacaaat ttatttatgc ttattgtcct tgcagtttgg 720

tactttagcg attttgatca ggcaaacaaa tgtagtctgg atgcttttcg ttgcttgctc 780

aggtgtttta gacttcactc ttgactctcc gcggaaaatg gataaacaaa aagtaaataa 840

agatttgcat cagtccattg ataggaaaga agcaactctg agatcgaatc ttagaaatag 900

aaaacctgat aacaacttgg atactagaga cagttttgac cgtggaaaat ctgtttcttc 960

agcagaggat acttcaggta tgttgctaat agtttgacat atatactgtt aaacataagt 1020

gttccttact cttacaatat ctaagggtct ttttgtacat atcttttaat gaaaacaata 1080

tacaggctta gtctatgatg tttatgatgt aatctccaca tcttggaata tgaagtggaa 1140

gattttgttc aaattcagcc ctttcatcgt ggttgtggta gcctttggta tttttatact 1200

ctggaacggc ggtatagtcc tcggtatgat tcatccatat gcgttttctg taaatggaaa 1260

gttatgtttc tgttgtcttt tttactaatc catcaatttc aaaatccgca ggtgcaaaag 1320

aggctcatgt ggtttcacca cattttgcgc agataatgta ttttagcctc gtctctgcac 1380

tttttactgc tcccctacac ttctcagtag agcaagtgag aaatctactc caagagctcc 1440

gaagaaattg gcccttaagc cttctactaa ctcttgtggc tctagtagct ggttttgcct 1500

ctgtacactt tttcaggttc agtttcttga cacctctcaa aacacctctt aaggtcttcc 1560

actacaaact ctcattctga aaaataattg cagcttggct catccttatc ttctcgctga 1620

taatcgccac tatccattct atctatggag gaaaattatc aacgctcatt ggttgatgaa 1680

atacatgcta gtcccggttt acgtctattc ctggttctca atcctaactt tattaggtat 1740

gttcaaatca tttttgtgtg agacggtttt tttatcttcc ttttttggca ttgtgaattt 1800

gactttggtt ctgtctcaat ccgacagcaa aaactcgaag caagatctgg gtgttggtct 1860

atttcttagc tacatgtgct gttcttgttc ctacgccatt gatcgagttc agatattaca 1920

ccattccgtt ttatatcttc atgcttcact cctgtgtcag aagcagcggt tacacaactt 1980

ggcttcttac tggaacgatt tttgtgtgta tcaatgtgtt tacaatggct atgttcttgt 2040

ttagaccatt caagtggagc catgaggatg gtgtccaaag gtttatttgg tag 2093

<210> 6

<211> 2075

<212> DNA

<213> kale (organic kale-extended line)

<400> 6

atggggagac tagcgcttgc agctataacg agcttgtggg tgattcccat gtcgatcatc 60

gtcaaccaca tagttcccga tccctacatg gacgagatat tccatgtgcc tcaggctcag 120

caatactgca atggcaattt cagtagctgg gatccaatga tcactacccc acctggattg 180

taatgctctc ttccttctta atttaatttt gtcttgttag tgcaaaactt aagaagagag 240

tgattgaaag tttgaatctt tttttttttt tgctgttgtt gttgcaggta ctgtctatca 300

ctagcacatg ttgcttctct gtttccagga atgttgttga tgagaactac ttctcaactc 360

ttttcagaag cttgttctgc gtctgtcctg cggtctacta atgctgtttt tgcagtcttg 420

tgtggagttc tagtgtatga gattatcagg ttcttggggc cgagtctcag tgatagaaaa 480

gcaactttaa tggctttggt catgtctctt taccctctcc actggttctt cactttcctc 540

tactatacgg atgttgcgtc tctcaccact tttcttgcca tgtacctcgc ttgtttgagg 600

agaagatata tcctcagtgc tgtggtaagt cattttgaag ctgtttgttg ttttcctgtc 660

agaattacaa atttatttat gcttattgtc cttgcagttt ggtactttag cgattttgat 720

caggcaaaca aatgtagtct ggatgctttt cgttgcttgc tcaggtgttt tagacttcac 780

tcttgactct ccgcggaaaa tggataaaca aaaagtaaat aaagatttgc atcagtccat 840

tgataggaaa gaagcaactc tgagatcgaa tcttagaaat agaaaacctg ataacaactt 900

ggatactaga gacagttttg accgtggaaa atctgtttct tcagcagagg atacttcagg 960

tatgttgcta atagtttgac atatatactg ctaaacataa gtgttcctta ctcttacaat 1020

atctaagggt ctttttgtac atatctttta atgaaaacaa tatacaggct tagtctatga 1080

tgtttatgat gtaatctcca catcttggaa tatgaagtgg aagattttgt tcaaattcag 1140

ccctttcatc gtggttgtgg tagcctttgg tatttttata ctctggaacg gcggtatagt 1200

cctcggtatg attcatccat atgcgttttc tgtaaatgga aagttatgtt tctgttgtct 1260

tttttactaa tccatcaatt tcaaaatccg caggtgcaaa agaggctcat gtggtttcac 1320

cacattttgc gcagataatg tattttagcc tcgtctctgc actttttact gctcccctac 1380

acttctcagt agagcaagtg agaaatctac tccaagagct ccgaagaaat tggcccttaa 1440

gccttctact aactcttgtg gctctagtag ctggttttgc ctctgtacac tttttcaggt 1500

tcagtttctt gacacctctc aaaacacctc ttaaggtctt ccactacaaa ctctcattct 1560

gaaaaataat tgcagcttgg ctcatcctta tcttctcgct gataatcgcc actatccatt 1620

ctatctatgg aggaaaatta tcaacgctca ttggttgatg aaatacatgc tagtcccggt 1680

ttacgtctat tcctggttct caatcctaac tttattaggt atgttcaaat catttttgtg 1740

tgagacggtt tttttatctt ccttttttgg cattgtgaat ttgactttgg ttctgtctca 1800

atccgacagc aaaaactcga agcaagatct gggtgttggt ctatttctta gctacatgtg 1860

ctgttcttgt tcctacgcca ttgatcgagt tcagatatta caccattccg ttttatatct 1920

tcatgcttca ctcctgtgtc agaagcagcg gttacacaac ttggcttctt actggaacga 1980

tttttgtgtg tatcaatgtg tttacaatgg ctatgttctt gtttagacca ttcaagtgga 2040

gccatgagga tggtgtccaa aggtttattt ggtag 2075

Claims (1)

1. A molecular marker for predicting collard leaf margin traits is characterized in that: the molecular markers are CAPS _ F and CAPS _ R, and the CAPS _ F nucleotide sequence is shown in SEQ ID NO:1, the CAPS _ R nucleotide sequence is shown in SEQ ID NO:2, the molecular marker is applied to early prediction of the leaf margin incised character of the kale cultivated at any developmental stage.

Images