CN108251554B

CN108251554B - Molecular marker closely linked with peach drooping branch gene and application thereof

Info

Publication number: CN108251554B
Application number: CN201810315313.4A
Authority: CN
Inventors: 鲁振华; 王志强; 张南南; 牛良; 崔国朝; 潘磊; 曾文芳
Original assignee: Zhengzhou Fruit Research Institute CAAS
Current assignee: Zhengzhou Fruit Research Institute CAAS
Priority date: 2018-04-10
Filing date: 2018-04-10
Publication date: 2021-06-01
Anticipated expiration: 2038-04-10
Also published as: CN108251554A

Abstract

The invention discloses a molecular marker closely linked with peach drooping branch genes and application thereof, which are expected to be applied to peach drooping branch molecular marker-assisted selection and excellent peach germplasm resource breeding. The SNP molecular markers which are closely linked with the peach drooping genes are selected and obtained, namely WESNP-20.83 and WESNP-20.99, wherein WESNP-20.83 is positioned at 20.839Mb of peach genome Pp03, and the nucleotide is G or C; WESNP-20.99 is located at 20.998Mb of peach genome Pp03, and the nucleotide is C or T. And an InDel marker WEInDel-21.61 closely linked with the gene of the pendulous branch is obtained. The invention provides a method for assisting in screening excellent peach germplasm resources based on developed molecular marker primers, can realize molecular identification and screening of peach pendulous branch traits at an early stage, and has the advantages of high efficiency, less limitation and accuracy.

Description

Molecular marker closely linked with peach drooping branch gene and application thereof

Technical Field

The invention relates to the technical field of molecular marker-assisted selection of peach pendants, in particular to a molecular marker closely linked with peach pendants genes and application thereof.

Background

Peach [ 2 ]Prunus persica (L.) Batsch]Is an important deciduous fruit tree in China,there has been a history of over 3000 years of cultivation; in China, peaches are the third largest deciduous fruit trees, are widely cultivated all over the country and are an important component of agricultural production.

The peach tree has multiple growth types and can be stably inherited, such as dwarf type (DW, dwdwdwdw), semi-dwarf type (SD, semi-dwarf), columnar type (PI, brr), compact type (CT, Ct) and vertical branch type (WE, plpl), and the development and application of new tree types are important components of breeding work in China. The dwarf, cylindrical and compact tree forms have great significance for improving the cultivation and production mode of peach trees, and the drooping branches have good ornamental value due to drooping branches and are the main breeding direction of ornamental peaches.

Peach with weeping branches (Prunus. persica var. Pendula) as a variety of peaches, with branch drop like willow, has a very high ornamental value. Yamazaki K. (1987), Bassi D (2000) and Dennis J (2005) find that the character of the pendulous branch is controlled by a single recessive gene (pl) through hybridization of a peach tree with a pillar, a pendulous branch, a normal tree and the like. Dirlewanger E (1994) found RAPD markers for the weeping trait (pl) at genetic distances of 11.4 cM (Centimorgan) and 17.2 cM, but too large a genetic distance was insufficient to indicate an accurate marker, and it was difficult to identify the molecular trait of peach at an early stage.

Therefore, development and acquisition of markers closely linked with the peach drooping branch traits are urgently needed to realize molecular identification of the peach drooping branch traits at an early stage and lay a foundation for improving breeding efficiency.

Disclosure of Invention

The invention aims to provide a molecular marker closely linked with peach drooping branch genes and application thereof. The characteristic of the weeping peach is separated and then is replaced by a test material, and the molecular identification of the target characteristic in the early stage can be realized by determining the molecular marker which is closely linked with the weeping gene of the peach.

In order to solve the technical problems, the invention adopts the following technical scheme:

screening SNP molecular markers which are closely linked with peach weeping genes and are named as WESNP-20.83 and/or WESNP-20.99;

the WESNP-20.83 is positioned at 20.839Mb of peach genome Pp03, and the nucleotide sequence of the site and the flanking nucleotide sequence are as follows:

GTCTCTGCTCGGTAATTATTCCTCTTTGCTTGTTTGTGTTCATTGGAAAGTTGGGAAAGTTGGSAAAGTTGGCAAAGTTTTGCATAGATGGAATTGGTAGGGCACAAAAGTTTTAGATAATTGT；

the WESNP-20.99 is positioned at 20.998Mb of peach genome Pp03, and the nucleotide sequence of the site and the flanking nucleotide sequence are as follows:

ACAGAAAACTCATCAAGTTTCTGGAATTTATTGAACAAAATAAACCAAAATAACAAACTAAAATAACGCTGTCAAAAAGAAAAACCAACCGYACTGCTATTAATCTTCCTTTGAAACATGACATAGAGAACGTCACTTAATTGTTCTTATTTTTATACAAACGATATTTAAAATAAAATAAAAA，

in the sequence, S is G or C, and Y is C or T.

Preferably, the drooping genotype S is C and Y is T.

Designing a primer pair for detecting SNP molecular markers closely linked with peach drooping genes, wherein the nucleotide sequence of the primer pair is as follows:

CCACATCCCTCTCAGCCTCA and GATCCTGAGCAATGCCACCC, and/or

TCTATAATCCCCTCAACCGCCA, and GTTTAAGGGATCAAGGGCCGT.

An InDel marker which is closely linked with a gene of a vertical branch is found and is named as WEInDel-21.61, and the sequence of the InDel marker is as follows:

GGGGCCCAAGGAAAGGATTT, and/or

GTAACCCAATGCTTGCAAAGTCA。

The SNP molecular marker closely linked with the peach drooping branch gene is applied to auxiliary selection of the peach drooping branch molecular marker.

Preferably, the primer pair for detecting the filial generation single strain is as follows:

CTCTCCAACTTCGCGATTGTGA, and TGGGCTGGGAAAACTGATCAAA.

The SNP molecular marker closely linked with the peach drooping branch gene is applied to the selection and breeding of excellent peach germplasm resources.

Compared with the prior art, the invention has the beneficial technical effects that:

1. the invention adopts the third generation molecular marker technology based on SNP, combines with the constructed separation self-bred population, adopts the map-based cloning method to finely position the genes of the peach pendants, develops stable, codominant and polymorphic SNP markers in a fine positioning region, and obtains SNP molecular markers which are tightly linked with the genes of the peach pendants and are respectively named as WESNP-20.83 and WESNP-20.99. Because the object of research has the germplasm with the characteristic of the weeping branch, the gene with the target characteristic can be cloned according to the obtained closely linked marker, and the method is applied to molecular-assisted breeding of excellent ornamental peach varieties.

2. The invention not only lays a foundation for the fine positioning and molecular cloning of the peach drooping branch gene, but also provides an efficient way for the molecular marker-assisted breeding of new peach tree varieties with the peach drooping branch gene.

3. The invention provides a method for auxiliary screening of a new peach tree variety with specific peach drooping branches based on developed molecular marker primers.

4. The molecular marker provided by the invention can realize the early molecular identification and screening of peach weeping character, and has the advantages of high efficiency, less limitation and accuracy.

5. The method is simple, convenient and quick, and has good application and popularization prospects.

Drawings

FIG. 1 is a graph of the pendulous watch type;

FIG. 2 is a graph comparing the phenotype of the pendants with the common phenotype;

FIG. 3 is a polyacrylamide gel electrophoresis diagram of an InDel marker WEIndel-21.61 linked with a gene of a pendulous branch;

FIG. 4 is a diagram showing a sequencing peak and a SNP site of a SNP marker WESNP-20.99 which is completely linked to a gene of a pendulous branch;

FIG. 5 is a sequencing peak diagram and a SNP site schematic diagram of an SNP marker WEYZ-SNP closely linked to a gene of a pendulous branch;

FIG. 6 is a schematic diagram of the detection of the SNP marker WEYZ-SNP of the individual plant of the filial generation at the re-sequencing mutation site of the parent 'Xinxiang 144'.

Detailed Description

The following examples are intended to illustrate the present invention in detail and should not be construed as limiting the scope of the present invention in any way.

The instruments and devices referred to in the following examples are conventional instruments and devices unless otherwise specified; the related reagents are all conventional reagents in the market, if not specifically indicated; the test methods involved are conventional methods unless otherwise specified.

The first embodiment is as follows: identification of the pendulous phenotype of a segregating population of hybrids

Performing phenotype evaluation according to the vertical and vertical branch degree of the peach branches, wherein the branches are new slightly drooping like weeping willow and are of a vertical branch type, as shown in figure 1; the shoots grow up slightly negative to the normal form as shown in figure 2.

Selfing with Xinxiang 144 as parent to obtain selfed progeny 152 seedlings, and performing phenotypic evaluation in 2016 and 4 months after planting.

Through phenotype evaluation of individual progeny plants, the common 96 plants and the drooping 56 plants are found to be close to 3: 1, the P value is 0.700, the Mendelian inheritance rule is met, and the pendulous character is controlled by a recessive monogene.

Example two: extraction of genomic DNA

Extracting genomic DNA of peach leaf tablets by adopting a CTAB method, and specifically comprising the following steps:

(1) taking about 30 mg of young peach leaves, putting the young peach leaves into a 1.2 mL eight-row centrifugal tube, adding 1 steel ball with the diameter of 5 mm into each hole, putting the young peach leaves into a 96-hole base, and fully freezing by using liquid nitrogen;

(2) shaking manually for several times to ensure that the steel balls fully break the sample, and grinding with an automatic DNA grinder (Shanghai Kangji Biotech Co., Ltd.) at a frequency of 30 Hz for 90 s;

(3) adding 600 mu L of prepared CTAB liquid into a 300 mL range 8-channel pipette, and heating in an electrothermal constant-temperature air-blast drying oven at 60 ℃ for 30 min, wherein the prepared CTAB liquid is gently shaken up every 10 min;

(4) placing the mixture into a refrigerated centrifuge (Eppendorf 5810R) for instantaneous centrifugation at 4000 rpm at 4 ℃; adding a chloroform and isoamylol mixed solution, wherein the volume ratio is 24: 1, until the full load line of 1.2 mL eight-row centrifugal tubes is fully loaded, slowly reversing and uniformly mixing for 5 min, putting into a refrigerated centrifuge (Eppendorf 5810R) at 4 ℃, and centrifuging for 10min at 4000 rpm;

(5) respectively sucking 150 mu L of supernatant into two 96-well PCR plates, adding equal volume of absolute ethyl alcohol into one of the two 96-well PCR plates, centrifuging for 10min at 4000 rpm at-20 ℃ in a refrigerator at 4 ℃, and discarding the supernatant; putting the other plate into a refrigerator at 4 ℃ and storing for later use;

(6) adding 150 mu L of 70% ethanol into a 96-hole PCR plate with precipitates, carrying out instantaneous centrifugation at 4000 rpm, washing the precipitates for 2 times, adding absolute ethanol to wash the precipitates for one time, sucking the residual absolute ethanol at the bottom of a centrifugal tube by using a 100 mu L8-channel pipette (Eppendorf), and naturally airing;

(7) after the precipitate was air-dried at room temperature, 0.1 XTE in a volume of 150. mu.L was added to dissolve the precipitated DNA, and 0.5. mu.L of RNase was added thereto and left at 37 ℃ for 1 hour to remove RNA contamination for subsequent experiments.

Example three: primer design for SNP development

According to the Genome sequence (Genome Database for Rosaceae Peachversion 2.0), primers are designed by adopting Primer3 Input (version 4.0) (http:// Primer3.ut. ee /), the annealing temperature is 60-62 ℃, the length of the primers is 20-25 bp, an SNP marker based on Sanger sequencing is developed, 1 pair of primers is designed about every 1Mb, and the length of an amplified fragment is about 700-1600 bp.

Detailed primer information is shown in table 1:

TABLE 1 primer information Using closely-linked SNP markers

。

Example four: PCR reaction System and acquisition of SNP marker

The total volume of the PCR amplification system is 30 mu L, and the specific components are shown in Table 2:

TABLE 2 PCR reaction System

。

After mixing, the mixture was centrifuged in a centrifuge (5810R, Eppendorf), and amplified on a PCR instrument (Eppendorf). PCR amplification program is 95 ℃ for 3 min; 30s at 95 ℃, 30s at 56.5 ℃ and 90s at 72 ℃ for 35 cycles; 10min at 72 ℃.

And carrying out PCR amplification on4 individual strains of the parents and the offspring respectively, sending the product to Shanghai biological engineering Co., Ltd for Sanger sequencing after the PCR amplification is successful, opening the sequencing result in Contig software, and searching for the polymorphic SNP marker linked with the target character after the sequence is aligned.

Example five: sanger sequencing-based genotyping

After obtaining SNP with consistent parental genotype and phenotype, carrying out PCR amplification on the remaining selfing progeny, sending the amplified selfing progeny to Shanghai workers for Sanger sequencing, opening the sequencing result in Contig software, searching SNP markers linked with target characters, and carrying out sequencing on F₁And carrying out genotyping on individual plants of the population.

Example six: development and application of target character close linkage marker

Based on Sanger sequencing results, closely linked SNP markers are searched, and the genotype of the parent of Xinxiang 144 is Aa, the genotype of the common phenotype of filial generation is AA and Aa, and the genotype of the pendulous phenotype is Aa.

Firstly, obtaining closely linked SNP markers from 4 filial generations, then expanding the obtained SNP markers to 20 single plants of the filial generations for sequencing analysis, further expanding the obtained SNP markers to all single plant samples of the filial generations, continuously developing the SNP markers after determining the closely linked SNP markers, gradually reducing a positioning interval, and finally realizing fine positioning. And developing more SNP markers in the fine positioning interval according to the genotype and the phenotype of the parents, and the SNP markers are used for distinguishing different selfing progeny single plants and establishing the closely linked SNP markers.

The result of non-denaturing polyacrylamide gel electrophoresis with InDel marker is shown in FIG. 3, the length of the amplified fragment of the A gene is about 270 bp, the length of the amplified fragment of the a gene is about 250 bp, and the Aa genotype has two bands of 270 bp and 250 bp with different fragment sizes and obvious polymorphism. And determining the crossover individual plant based on the consistency of the genotype and the phenotype so as to finely position the target gene.

The sequencing peak diagram and the SNP site schematic diagram of the SNP marker WESNP-20.99 closely linked with the gene of the weeping branch are respectively shown in figure 4, the genotype of the WESNP-20.99 at the amplification site of a single weeping branch is T/T (aa), the amplification site in the common growth type is C/T (aa) and CC (AA), and the genotype is closely linked with the phenotype.

The diagram of a sequencing peak of an SNP marker WEYZ-SNP and the schematic diagram of an SNP locus for detecting a single plant of a filial generation are respectively shown in figure 5, the genotype of the WEYZ-SNP at the amplification locus of a single plant of a pendulous branch is C/C (aa), the amplification locus in a common growth type is C/T (aa), T/T (AA), and the genotype is closely linked with the phenotype.

IGV data of SNP marker WEYZ-SNP for detecting the filial generation single plant is shown in figure 6, wherein the amplification site in parent Xinxiang 144' is C/T, the amplification site in the filial generation drooping plant is C/C, and the amplification site in the common phenotype plant is C/T or T/T.

While the present invention has been described in detail with reference to the drawings and the embodiments, those skilled in the art will understand that various specific parameters in the above embodiments can be changed without departing from the spirit of the present invention, and a plurality of specific embodiments are formed, which are common variation ranges of the present invention, and will not be described in detail herein.

SEQUENCE LISTING

<110> Zhengzhou fruit tree institute of Chinese academy of agricultural sciences

<120> molecular marker closely linked with peach drooping branch gene and application thereof

<130> 2018

<160> 12

<170> PatentIn version 3.2

<210> 1

<211> 124

<212> DNA

<213> Prunus persica

<400> 1

gtctctgctc ggtaattatt cctctttgct tgtttgtgtt cattggaaag ttgggaaagt 60

tggsaaagtt ggcaaagttt tgcatagatg gaattggtag ggcacaaaag ttttagataa 120

ttgt 124

<210> 2

<211> 184

<212> DNA

<213> Prunus persica

<400> 2

acagaaaact catcaagttt ctggaattta ttgaacaaaa taaaccaaaa taacaaacta 60

aaataacgct gtcaaaaaga aaaaccaacc gyactgctat taatcttcct ttgaaacatg 120

acatagagaa cgtcacttaa ttgttcttat ttttatacaa acgatattta aaataaaata 180

aaaa 184

<210> 3

<211> 20

<212> DNA

<213> Artificial Synthesis

<400> 3

ccacatccct ctcagcctca 20

<210> 4

<211> 20

<212> DNA

<213> Artificial Synthesis

<400> 4

gatcctgagc aatgccaccc 20

<210> 5

<211> 22

<212> DNA

<213> Artificial Synthesis

<400> 5

tctataatcc cctcaaccgc ca 22

<210> 6

<211> 21

<212> DNA

<213> Artificial Synthesis

<400> 6

gtttaaggga tcaagggccg t 21

<210> 7

<211> 20

<212> DNA

<213> Artificial Synthesis

<400> 7

ggggcccaag gaaaggattt 20

<210> 8

<211> 23

<212> DNA

<213> Artificial Synthesis

<400> 8

gtaacccaat gcttgcaaag tca 23

<210> 9

<211> 22

<212> DNA

<213> Artificial Synthesis

<400> 9

ctctccaact tcgcgattgt ga 22

<210> 10

<211> 22

<212> DNA

<213> Artificial Synthesis

<400> 10

tgggctggga aaactgatca aa 22

Claims

1. An SNP molecular marker which is closely linked with the weeping gene of peach with the variety 'Xinxiang 144', is named as WESNP-20.99, and is characterized in that:

the WESNP-20.99 is positioned at 20.998Mb of peach genome Pp03, and the nucleotide sequence of the site and the flanking nucleotide sequence are shown as SEQ ID NO. 2;

and Y in the sequence is C or T.

2. The SNP molecular marker in close linkage with the gene of the weeping branch of peach of the variety "Xinxiang 144" as claimed in claim 1, wherein the gene type Y of the weeping branch is T.

3. Use of a primer pair for detecting the SNP molecular marker in close linkage with the gene of the drooping branch of peach of the variety "Xinxiang 144" as claimed in claim 1, wherein the nucleotide sequence of the primer pair is as follows:

TCTATAATCCCCTCAACCGCCA, and GTTTAAGGGATCAAGGGCCGT.

4. An InDel marker closely linked with the gene of the vertical branch of peach of the variety Xinxiang 144, which is named as WEInDel-21.61, is characterized in that the primers for amplifying the sequence are as follows:

GGGGCCCAAGGAAAGGATTT, and GTAACCCAATGCTTGCAAAGTCA.

5. The application of the SNP molecular marker which is closely linked with the weeping gene of peach with the variety 'Xinxiang 144' in the auxiliary selection of the new peach variety with the weeping gene of peach as the claim 1.