CN108251554A - Molecular labeling and its application with peach weeping branch gene close linkage - Google Patents
Molecular labeling and its application with peach weeping branch gene close linkage Download PDFInfo
- Publication number
- CN108251554A CN108251554A CN201810315313.4A CN201810315313A CN108251554A CN 108251554 A CN108251554 A CN 108251554A CN 201810315313 A CN201810315313 A CN 201810315313A CN 108251554 A CN108251554 A CN 108251554A
- Authority
- CN
- China
- Prior art keywords
- peach
- weeping branch
- close linkage
- weeping
- wesnp
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/13—Plant traits
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Immunology (AREA)
- Mycology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Botany (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a kind of molecular labeling with peach weeping branch gene close linkage and its application, to be applied to peach weeping branch molecular marker assisted selection and excellent peach germ plasm resource selection and breeding.Present invention screening obtains a kind of and peach weeping branch gene close linkage SNP marker, is located at the 20.839Mb of peach genome Pp03 for WESNP 20.83, WESNP 20.99, WESNP 20.83, and nucleotide is G or C；WESNP 20.99 is located at the 20.998Mb of peach genome Pp03, and nucleotide is C or T.And obtain a kind of InDel labels WEInDel 21.61 with weeping branch gene close linkage.Molecular labeling primer the present invention is based on exploitation provides method for the excellent peach germ plasm resource of assisting sifting, can realize that early stage carries out Molecular Identification and screening to peach weeping branch character, have the advantages that efficiently, limit less, be accurate.
Description
Technical field
The present invention relates to the Molecular Marker Assisted Selection Technology fields of peach weeping branch, and in particular to a kind of tight with peach weeping branch gene
Close chain molecular labeling and its application.
Background technology
Peach [Prunus persica(L.) Batsch] it is the important deciduous fruit tree for originating in China, have more than 3000 years
Cultivation history；In China, peach is the third-largest deciduous fruit tree, and cultivation extensively is an important set of agricultural production in all parts of the country
Into part.
There are many peach growth types, and the heredity that can stablize, such as dwarf form（DW, dwdw）, semidwarf type（SD, semi-
dwarf）, column type（PI, brbr）, compact（CT, Ct）With weeping branch type（WE, plpl）, the development and application of new tree-shaped is China
The important component of breeding work.Wherein short life, cylindricality, compact etc. are tree-like for improvement peach cultivation production model meaning weight
Greatly, and weeping branch type because its branch it is sagging have preferable ornamental value, be the main Breeding direction of ornamental peaches.
Weeping branch peach（Prunus. persica var. Pendula）As a mutation for peach, branch is sagging such as willow, tool
There is high ornamental value.Yamazaki K.（1987）、Bassi D（2000）With Dennis J（2005）By to peach
Cylindricality, weeping branch, normally the hybridization such as tree-like find that weeping branch character is by a single recessive gene（pl）Control.Dirlewanger E
（1994）It is found that weeping branch character（pl）RAPD label, genetic distance be 11.4 cM（Centimorgan）With 17.2 cM,
But genetic distance is too big, and it is an accurate label to be not enough to explanation, it is difficult to realize that early stage carries out molecule mirror to peach weeping branch character
It is fixed.
Therefore, there is an urgent need for developing and obtaining the label with peach weeping branch character close linkage, to realize early stage to peach weeping branch character
Molecular Identification is carried out, is laid the foundation to improve breeding efficiency.
Invention content
The technical problem to be solved in the present invention is to provide a kind of and peach weeping branch gene close linkage molecular labeling and its answer
With.Weeping branch peach trait segregation offspring is selected to try material, by determining that the molecular labeling with peach weeping branch gene close linkage can be real
Now early stage carries out Molecular Identification to objective trait.
In order to solve the above technical problems, the present invention adopts the following technical scheme that：
A kind of and peach weeping branch gene close linkage SNP marker is screened, is named as WESNP-20.83 and/or WESNP-
20.99；
The WESNP-20.83 is located at the 20.839Mb of peach genome Pp03, and the nucleotides sequence of the site and its flank is classified as：
GTCTCTGCTCGGTAATTATTCCTCTTTGCTTGTTTGTGTTCATTGGAAAGTTGGGAAAGTTGGSAAAGTTGGC
AAAGTTTTGCATAGATGGAATTGGTAGGGCACAAAAGTTTTAGATAATTGT；
The WESNP-20.99 is located at the 20.998Mb of peach genome Pp03, and the nucleotides sequence of the site and its flank is classified as：
ACAGAAAACTCATCAAGTTTCTGGAATTTATTGAACAAAATAAACCAAAATAACAAACTAAAATAACGCTGTC
AAAAAGAAAAACCAACCGYACTGCTATTAATCTTCCTTTGAAACATGACATAGAGAACGTCACTTAATTGTTCTTAT
TTTTATACAAACGATATTTAAAATAAAATAAAAA,
S is G in the sequence or C, Y are C or T.
Preferably, weeping branch genotype S is C, Y T.
A kind of primer pair detected with the SNP marker of peach weeping branch gene close linkage is designed, nucleotides sequence is classified as：
CCACATCCCTCTCAGCCTCA and GATCCTGAGCAATGCCACCC and/or
TCTATAATCCCCTCAACCGCCA and GTTTAAGGGATCAAGGGCCGT.
It was found that a kind of InDel with weeping branch gene close linkage is marked, WEInDel-21.61 is named as, sequence is drawn
Object is：
GGGGCCCAAGGAAAGGATTT and/or
GTAACCCAATGCTTGCAAAGTCA。
SNP marker the answering in peach weeping branch molecular marker assisted selection with peach weeping branch gene close linkage
With.
Preferably, it is for detecting the primer pair of filial generation single plant：
CTCTCCAACTTCGCGATTGTGA and TGGGCTGGGAAAACTGATCAAA.
The application with the SNP marker of peach weeping branch gene close linkage in excellent peach germ plasm resource selection and breeding.
Compared with prior art, advantageous effects of the invention are：
1. the present invention uses the third generation molecular marking technique based on SNP, with reference to the separation inbreeding population of structure, using figure position gram
Grand method has carried out finely positioning to the gene of peach weeping branch, in finely positioning region, develop stable, codominance and
The SNP marker of polymorphism obtains the SNP marker with peach weeping branch gene close linkage, is respectively designated as WESNP-20.83
And WESNP-20.99.It, can be according to the close linkage marker clone mesh of acquisition since the object of research has the germplasm of weeping branch character
The gene of character is marked, applied to the excellent ornamental Peach cultivars of molecule assist-breeding.
It lays a good foundation 2. the present invention is not only the finely positioning of peach weeping branch gene and molecular cloning, while is also to utilize to divide
The peach new varieties that sub- marking supplementary breeding has peach weeping branch gene provide high effective way.
3. the molecular labeling primer offer the present invention is based on exploitation is new for peach of the assisting sifting with specific peach weeping branch
The method of kind.
4. by molecular labeling provided by the invention, it can realize that early stage carries out Molecular Identification and sieve to peach weeping branch character
Choosing, have the advantages that efficiently, limit less, it is accurate.
5. the method for the present invention is easy, quick, there is good application prospect.
Description of the drawings
Fig. 1 is weeping branch phenotypic map；
Fig. 2 is weeping branch and common phenotype comparison diagram；
Fig. 3 is the polyacrylamide gel electrophoresis figure that WEIndel-21.61 is marked with the InDeL of weeping branch gene linkage；
Fig. 4 be and the sequencing peak figure of the SNP marker WESNP-20.99 of weeping branch gene complete linkage and SNP site schematic diagram；
Fig. 5 be and the sequencing peak figure of the SNP marker WEYZ-SNP of weeping branch gene close linkage and SNP site schematic diagram；
Fig. 6 is that the SNP marker WEYZ-SNP of detection filial generation single plant resurveys the signal of sequence mutational site in parent ' Xinxiang 144 '
Figure.
Specific embodiment
Illustrate the specific embodiment of the present invention with reference to the accompanying drawings and examples, but following embodiment is used only in detail
It describes the bright present invention in detail, does not limit the scope of the invention in any way.
Involved instrument and equipment is routine instrument device unless otherwise instructed in the examples below；Involved
Reagent is commercially available conventional reagent unless otherwise instructed；Involved test method is conventional method unless otherwise instructed.
Embodiment one：Hybridize the identification of segregating population weeping branch phenotype
According to the upright and weeping branch degree of peach branch, phenotypic evaluation is carried out, it like weeping willow shape is weeping branch that wherein branch is newly slightly sagging
Type, as shown in Figure 1；Newly slightly negative ground is grown up as plain edition branch, as shown in Figure 2.
With " Xinxiang 144 " for parental autocopulation, 152 plants of seedlings of self progeny are obtained, are colonized after in April, 2016 carry out table
Type is evaluated.
By carrying out phenotypic evaluation to offspring's single plant, wherein common 96 plants are found, 56 plants of weeping branch, the two ratio is close to 3：1,
P values are 0.700, meet mendelian inheritance, and weeping branch character is stealthy Dominant gene.
Embodiment two：The extraction of genomic DNA
Peach leaves genomic DNA is extracted using CTAB methods, is as follows：
（1）30 mg of peach young tender leaf agreement that contracts a film or TV play to an actor or actress is taken, is put into 1.2 mL, eight townhouse centrifuge tubes, 15 mm steel ball is respectively added in per hole, is put into
96 bottom hole seats, liquid nitrogen fully freeze；
（2）Manual shaken several times ensure that steel ball fully smashes sample, DNA automatic grinding instrument（Shanghai neck is into the limited public affairs of biotechnology
Department）It is ground, 30 Hz of frequency, 90 s of time；
（3）Prepared 600 μ L of CTAB liquid are added in 300 mL ranges, 8 channel pipettor, 60 DEG C of electric heating constant temperature air blast is put into and does
Dry case heats 30 min, and about every 10 min jogs are even therebetween；
（4）It is put into refrigerated centrifuge（Eppendorf 5810 R）Under the conditions of 4 DEG C, 4000 rpm brief centrifugations；Add in chloroform and
Isoamyl alcohol mixed liquor, volume ratio 24：1, until the eight townhouse centrifuge tubes of 1.2 mL are fully loaded with line, rear slowly 5 min of reverse mixing,
It is put into refrigerated centrifuge（Eppendorf 5810 R）Under the conditions of 4 DEG C, 4000 rpm centrifuge 10 min；
（5）150 μ L of Aspirate supernatant are in two 96 hole PCR plates respectively, wherein a plate adds in isometric absolute ethyl alcohol, in-
20 DEG C of refrigerators 1 hour, later, under the conditions of 4 DEG C, 4000 rpm centrifuge 10 min, abandon supernatant；Another plate is put into 4 DEG C of refrigerators,
It saves backup；
（6）70% ethyl alcohol of 150 μ L, 4000 rpm brief centrifugations, washing precipitation are added in the 96 hole PCR plates with precipitation
2 times, absolute ethyl alcohol washing precipitation is added in once, with 8 channel pipettors of 100 μ L（Eppendorf）Centrifugation bottom of the tube is absorbed to remain
Remaining absolute ethyl alcohol, rear naturally dry；
（7）At room temperature after natural air drying precipitation, 0.1 × TE dissolving precipitation DNA of 150 μ L volumes are added in, while add in 0.5
The RNase of μ L, 37 DEG C of 1 h of placement, dispels RNA pollutions, for follow-up test.
Embodiment three：The design of primers of SNP exploitations
With reference to peach genome sequence（Genome Database for Rosaceae PeachVersion 2.0）, use
Primer 3 Input（version4.0）（http://primer3.ut.ee/）Primer is designed, primer parameter is annealing temperature
Between 60~62 DEG C, 20~25 bp of primer length develops the SNP marker being sequenced based on Sanger, and selection about designs 1 per 1Mb
To primer, expanding fragment length is about 700~1600 bp.
Detailed primer information is as shown in table 1：
Table 1 uses the primer information of close linkage SNP marker
。
Example IV：The acquisition of PCR reaction systems and SNP marker
PCR amplification system total volume is 30 μ L, and concrete component is as shown in table 2：
2 PCR reaction systems of table
。
After mixing, in centrifuge（5810R, Eppendorf）Centrifugation, and in PCR instrument（Eppendorf）On expanded.
PCR amplification program is 95 DEG C of 3min；95 DEG C of 30s, 56.5 DEG C of 30s, 72 DEG C of 90s, 35 cycles；72℃ 10min.
PCR amplification is carried out to parent, each 4 single plants of offspring, after PCR amplification success, product serves the raw work bioengineering in sea
Co., Ltd carries out Sanger sequencings, and sequencing result is opened in Contig softwares, searching and objective trait after sequence alignment
Chain polymorphism SNP marker.
Embodiment five：Genotyping based on Sanger sequencings
After the parent genotype SNP consistent with phenotype is obtained, carried out to serving the raw work in sea after remaining self progeny's PCR amplification
Sanger is sequenced, and sequencing result is opened in Contig softwares, searching and the chain SNP marker of objective trait, to F1Group is single
Strain carries out Genotyping.
Embodiment six：The exploitation and application of objective trait close linkage label
Based on Sanger sequencing results, the SNP marker of close linkage is found, shows as " Xinxiang 144 " parent genotype as Aa, son
It is AA, Aa for common phenotype genes type, weeping branch phenotype genes type is aa.
First, the SNP marker of close linkage is obtained in 4 filial generations, is then extended to each 20 single plants sequencing point of filial generation
Analysis, and then whole offspring's single plant samples are extended to, after the SNP marker for determining close linkage, continual exploitation SNP marker gradually contracts
Small positioning section, finally realizes finely positioning.In finely positioning section more SNP are developed according to the genotype and phenotype of parent
Label for distinguishing different self progeny's single plants, establishes the SNP marker of close linkage.
InDel labels carry out native polyacrylamide gel electrophoresis, and the results are shown in Figure 3, and A gene amplification fragments are long
Degree is about 270 bp, and a gene amplification fragment length is about 250 bp, and Aa genotype has two different bands 270 of clip size
Bp, 250 bp have apparent polymorphism.It is consistent with phenotype based on genotype, it determines to exchange single plant and then to target gene
Carry out finely positioning.
With the sequencing peak figure and SNP site schematic diagram of the SNP marker WESNP-20.99 of weeping branch gene close linkage respectively such as
Shown in Fig. 4, genotype of the WESNP-20.99 in weeping branch single plant amplification site is T/T（aa）, the amplification position in common growth type
Point is C/T（Aa）、CC（AA）, genotype and phenotype close linkage.
For detecting the SNP marker WEYZ-SNP of filial generation single plant sequencing peak figures and SNP site schematic diagram respectively such as Fig. 5
Shown, genotype of the WEYZ-SNP in weeping branch single plant amplification site is C/C（aa）, the amplification site in common growth type is C/
T（Aa）、T/T（AA）, genotype and phenotype close linkage.
For detecting the IGV data of the SNP marker WEYZ-SNP of filial generation single plant as shown in fig. 6, it is in parent ' Xinxiang
Amplification site is C/T in 144 ', and site is expanded in filial generation weeping branch plant as C/C, and amplification site is C/T in common phenotype plant
Or T/T.
The present invention is described in detail above in conjunction with drawings and examples, still, those of skill in the art
Member can also carry out each design parameter in above-described embodiment it is understood that under the premise of present inventive concept is not departed from
Change, forms multiple specific embodiments, is the common variation range of the present invention, is no longer described in detail one by one herein.
SEQUENCE LISTING
<110>Zhengzhou Fruit-tree Inst., Chinese Agriculture Science Academy
<120>Molecular labeling and its application with peach weeping branch gene close linkage
<130> 2018
<160> 12
<170> PatentIn version 3.2
<210> 1
<211> 124
<212> DNA
<213> Prunus persica
<400> 1
gtctctgctc ggtaattatt cctctttgct tgtttgtgtt cattggaaag ttgggaaagt 60
tggsaaagtt ggcaaagttt tgcatagatg gaattggtag ggcacaaaag ttttagataa 120
ttgt 124
<210> 2
<211> 184
<212> DNA
<213> Prunus persica
<400> 2
acagaaaact catcaagttt ctggaattta ttgaacaaaa taaaccaaaa taacaaacta 60
aaataacgct gtcaaaaaga aaaaccaacc gyactgctat taatcttcct ttgaaacatg 120
acatagagaa cgtcacttaa ttgttcttat ttttatacaa acgatattta aaataaaata 180
aaaa 184
<210> 3
<211> 20
<212> DNA
<213>It is artificial synthesized
<400> 3
ccacatccct ctcagcctca 20
<210> 4
<211> 20
<212> DNA
<213>It is artificial synthesized
<400> 4
gatcctgagc aatgccaccc 20
<210> 5
<211> 22
<212> DNA
<213>It is artificial synthesized
<400> 5
tctataatcc cctcaaccgc ca 22
<210> 6
<211> 21
<212> DNA
<213>It is artificial synthesized
<400> 6
gtttaaggga tcaagggccg t 21
<210> 7
<211> 20
<212> DNA
<213>It is artificial synthesized
<400> 7
ggggcccaag gaaaggattt 20
<210> 8
<211> 23
<212> DNA
<213>It is artificial synthesized
<400> 8
gtaacccaat gcttgcaaag tca 23
<210> 9
<211> 22
<212> DNA
<213>It is artificial synthesized
<400> 9
ctctccaact tcgcgattgt ga 22
<210> 10
<211> 22
<212> DNA
<213>It is artificial synthesized
<400> 10
tgggctggga aaactgatca aa 22
Claims (7)
1. a kind of and peach weeping branch gene close linkage SNP marker, is named as WESNP-20.83 and/or WESNP-
20.99, it is characterised in that：
The WESNP-20.83 is located at the 20.839Mb of peach genome Pp03, and the nucleotide sequence of the site and its flank is such as
Shown in SEQ ID NO.1；
The WESNP-20.99 is located at the 20.998Mb of peach genome Pp03, and the nucleotide sequence of the site and its flank is such as
Shown in SEQ ID NO.2；
S is G in the sequence or C, Y are C or T.
2. according to claim 1 and peach weeping branch gene close linkage SNP marker, which is characterized in that weeping branch base
Because type S is C, Y T.
3. a kind of detect the primer pair with the SNP marker of peach weeping branch gene close linkage as described in claim 1, spy
Sign is that nucleotides sequence is classified as：
CCACATCCCTCTCAGCCTCA and GATCCTGAGCAATGCCACCC and/or
TCTATAATCCCCTCAACCGCCA and GTTTAAGGGATCAAGGGCCGT.
4. a kind of InDel with weeping branch gene close linkage is marked, it is named as WEInDel-21.61, which is characterized in that its sequence
Primer be：
GGGGCCCAAGGAAAGGATTT and/or
GTAACCCAATGCTTGCAAAGTCA。
5. the SNP marker described in claim 1 with peach weeping branch gene close linkage is in peach weeping branch molecular marker assisted selection
In application.
It is 6. according to claim 6 auxiliary in peach weeping branch molecular labeling with the SNP marker of peach weeping branch gene close linkage
Help the application in selection, which is characterized in that the primer pair for detecting filial generation single plant is：
CTCTCCAACTTCGCGATTGTGA and TGGGCTGGGAAAACTGATCAAA.
7. the SNP marker described in claim 1 with peach weeping branch gene close linkage is in excellent peach germ plasm resource selection and breeding
Using.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810315313.4A CN108251554B (en) | 2018-04-10 | 2018-04-10 | Molecular marker closely linked with peach drooping branch gene and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810315313.4A CN108251554B (en) | 2018-04-10 | 2018-04-10 | Molecular marker closely linked with peach drooping branch gene and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN108251554A true CN108251554A (en) | 2018-07-06 |
| CN108251554B CN108251554B (en) | 2021-06-01 |
Family
ID=62748068
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810315313.4A Active CN108251554B (en) | 2018-04-10 | 2018-04-10 | Molecular marker closely linked with peach drooping branch gene and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108251554B (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111088388A (en) * | 2020-01-18 | 2020-05-01 | 中国农业科学院郑州果树研究所 | InDel marker and primer pair for identifying flesh red/non-red character of peach fruit and application of InDel marker and primer pair |
| CN113862388A (en) * | 2021-09-28 | 2021-12-31 | 山东农业大学 | TE molecular marker closely linked with peach petaloid and application thereof |
| CN113981123A (en) * | 2021-09-28 | 2022-01-28 | 山东农业大学 | SNP molecular marker for screening Gansu nectarine variety |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20130254945A1 (en) * | 2010-03-17 | 2013-09-26 | United States Of America As Represented By The Secretary Of Agriculture | Soybean aphid resistance gene rag2 |
| CN106399538A (en) * | 2016-10-31 | 2017-02-15 | 中国农业科学院郑州果树研究所 | Application of SNP markers closely chained with peach tree dwarfing genes |
| CN106434944A (en) * | 2016-10-31 | 2017-02-22 | 中国农业科学院郑州果树研究所 | Application of SNP molecular marker closely linked to aphid resistance gene of prunus persica |
-
2018
- 2018-04-10 CN CN201810315313.4A patent/CN108251554B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20130254945A1 (en) * | 2010-03-17 | 2013-09-26 | United States Of America As Represented By The Secretary Of Agriculture | Soybean aphid resistance gene rag2 |
| CN106399538A (en) * | 2016-10-31 | 2017-02-15 | 中国农业科学院郑州果树研究所 | Application of SNP markers closely chained with peach tree dwarfing genes |
| CN106434944A (en) * | 2016-10-31 | 2017-02-22 | 中国农业科学院郑州果树研究所 | Application of SNP molecular marker closely linked to aphid resistance gene of prunus persica |
Non-Patent Citations (3)
| Title |
|---|
| IGNAZIO VERDE1等: "The Peach v2.0 release: high-resolution linkage mapping and deep resequencing improve chromosome-scale assembly and contiguity", 《BMC GENOMICS》 * |
| RIAZ AHMAD等: "Whole genome sequencing of peach (Prunus persica L.) for SNP identification and selection", 《BMC GENOMICS》 * |
| 李雄伟等: "桃基因组及全基因组关/联分析研究进展", 《遗传》 * |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111088388A (en) * | 2020-01-18 | 2020-05-01 | 中国农业科学院郑州果树研究所 | InDel marker and primer pair for identifying flesh red/non-red character of peach fruit and application of InDel marker and primer pair |
| CN113862388A (en) * | 2021-09-28 | 2021-12-31 | 山东农业大学 | TE molecular marker closely linked with peach petaloid and application thereof |
| CN113981123A (en) * | 2021-09-28 | 2022-01-28 | 山东农业大学 | SNP molecular marker for screening Gansu nectarine variety |
| CN113981123B (en) * | 2021-09-28 | 2023-09-22 | 山东农业大学 | SNP molecular marker for screening Gansu nectarine varieties |
| CN113862388B (en) * | 2021-09-28 | 2023-09-22 | 山东农业大学 | TE molecular marker closely linked with peach heavy petal flowers and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN108251554B (en) | 2021-06-01 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106755481A (en) | A kind of SSR molecular marker VI for identifying Gala apple Progeny plants and its application | |
| CN108251554A (en) | Molecular labeling and its application with peach weeping branch gene close linkage | |
| CN110066883A (en) | With the molecular labeling R112146 of Rice Bacterial Blight Xa23 close linkage | |
| US20240102112A1 (en) | Soyasaponin-related kompetitive allele-specific polymerase chain reaction markers and application thereof | |
| CN110499389B (en) | Codominant marker primer closely linked with tobacco anti-spotted wilt site RTSW, identification method and application thereof | |
| CN109609687B (en) | KASP marker primer combination for detecting watermelon fusarium wilt resistance and application thereof | |
| CN112063740B (en) | KASP molecular marker closely linked with wheat powdery mildew resistance gene Pm37 and application thereof | |
| CN111926104B (en) | SSR molecular marker for identifying authenticity of sugarcane and festuca arundinacea filial generation and method thereof | |
| CN110241245A (en) | Detect KASP primer and its application of cucumber bacterial angular leaf spot gene | |
| CN110551843B (en) | Codominant marking primer capable of distinguishing tobacco spot wilt-resistant locus RTSW homozygous heterozygous genotype, distinguishing method and application thereof | |
| CN108796107B (en) | SNP molecular marker coseparated with cucumber spur hardness gene Hard and application thereof | |
| CN111471790B (en) | Molecular marker closely linked with wheat grain filling rate QTL QGfr. sicau-7D.1 and application thereof | |
| CN108456740A (en) | One Rice Resistance To Rice Blast site ' Pi-jx ' and its Indel labeled primers and Breeding Application | |
| CN110777218B (en) | Molecular marker linked with wheat powdery mildew resistance gene Pm37 and application thereof | |
| CN117265168A (en) | Molecular marker related to protein content in soybean and application thereof | |
| CN114480709B (en) | Molecular marker for detecting wheat leaf rust resistance gene Lr47, detection method and application thereof | |
| CN110468229A (en) | Rice wide spectrum high resistance to hoja blanca gene Xa45's (t) isolates molecular labeling Hxjy-1 | |
| CN107475418B (en) | Molecular marker closely linked with tillering character of millet, primer and application | |
| CN115141893A (en) | Molecular marker group containing 7 molecular markers and used for predicting dry matter content of kiwi fruit, application and kit thereof | |
| CN110499388B (en) | Codominant marker primer group for identifying RTSW allele type of tobacco anti-spotted wilt locus, identification method and application thereof | |
| CN114752702A (en) | Molecular marker BnCa-2C2 closely linked with rape calcium content trait QTL and application thereof | |
| CN108546778B (en) | SNP molecular marker for detecting powdery mildew resistance of cucumber and application thereof | |
| CN111733278A (en) | Rice sodium and potassium ion absorption QTL (quantitative trait loci) linked SNP (Single nucleotide polymorphism) molecular marker and application thereof | |
| CN113528703A (en) | Development and application of KASP molecular marker of rice blast resistance gene Pid3-A4 | |
| CN108642203B (en) | SNP (Single nucleotide polymorphism) marker related to millet stem thickness character as well as detection primer and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |