KR101734922B1 - Molecular marker for discriminating black rot-resistant or sensitive cabbage cultivar and uses thereof - Google Patents

Abstract

The present invention relate to: a primer set for discriminating a cabbage cultivar with resistance to black rot comprising an SSR primer set of SEQ ID NOs 1 and 2, an SSR primer set of SEQ ID NOs 3 and 4, an SSR primer set of SEQ ID NOs 5 and 6, an SSR primer set of SEQ ID NOs 7 and 8, an SSR primer set of SEQ ID NOs 9 and 10, and an SSR primer set of SEQ ID NOs 11 and 12; a kit for discriminating a cabbage cultivar with resistance to black rot including the same primer set; a method for discriminating a cabbage cultivar with resistance to black rot by using the same primer set; and a quantitative trait loci related to resistance to black rot located on cabbage chromosome 1. The quantitative trait loci and the molecular marker can determine resistance to cabbage black rot in an early phase, thus can provide an economic help to farmers who cultivate cabbages, and can significantly contribute to reinforcement of market competitiveness.

Description

[0002] Molecular markers for black rot-resistant or resistant breeder selection of cabbage and their uses [0002] Molecular markers for discriminating black rot-resistant or sensitive cabbage cultivars and uses thereof [

The present invention relates to a molecular marker for screening resistant or dubious varieties which can be utilized for breeding cabbage cultivars resistant to black rot disease, which is becoming more and more a problem in cabbage, and its use.

The black rot (black rot) is Zanthomonas campestris v. Calm Fest lease a plant disease caused by (Xanthomonas campestris pv. Campestris, Xcc ), the world occurred in baechugwa crop is the main plant diseases that give a lot of damage. However, in Korea, there is no registered medicament to control black rot, so cultivating resistant varieties is the most effective way to control them.

Molecular markers have the advantage that they can be detected in all tissues by differences in DNA sequence and are not affected by environmental influences and multiple expression of genes. Genomic genetic mapping of major crops is currently underway, and molecular markers are being used in the selection process of breeding. Numerous molecular markers have been developed for the study of plant breeding, and techniques and laboratory equipment for massively verifying and identifying the developed molecular markers are being developed very quickly. A variety of molecular labeling techniques such as SSR (Simple Sequence Repeat), RAPD (Random Amplified Polymorphic DNA), AFLP (amplified fragment length polymorphism) and SNP (single nucleotide polymorphism) analysis are widely used rather than time consuming techniques .

Advances in plant genome analysis techniques have enabled the study of genetic variants involved in quantitative trait loci (QTLs) and have enabled the efficient use of marker-assisted selection (MAS) in the transfer and selection of target genes In particular, quantitative trait locus analysis uses molecular markers and identifies specific parts of the chromosomes involved in the traits that can be measured, thereby identifying the number of genes involved in major traits such as yield, fruit weight, You can get general and direct information about the genetic background of major agricultural traits such as location, influence of individual genes, interaction, interactions between quantitative trait loci and environment, and interactions between quantitative trait loci and genetic background .

The present invention can be produced for each gene map using two parent counterparts objects and F ₂ generation of objects with resistance and Susceptible cabbage black rot, and determine the quantitative trait loci and disease resistance involved in the black rot resistance Molecular markers were developed.

Korean Patent No. 1474910 discloses a primer set, a method and a kit for selecting cabbage moth-resistant cabbage cultivars, and Korean Patent No. 1464247 discloses a method for selecting a cabbage wilt resistance resistant or susceptible varietal sorting SNP marker And its use ', but there is no description about the molecular marker for the cabbage black rot disease resistant or dicot breeding selection of the present invention and its use.

The present invention has been made in view of the above-mentioned needs. The present inventors have made a gene map using two parental and F ₂ genera having resistance and affinity to cabbage black rot disease, respectively. We identified two major loci involved in resistance to black rot disease and developed three EST-SSR markers, one EST-dCAPS and two genomic-SSR markers associated with these regions. Then, a blind test on 24 lines of cabbage was carried out using the above-mentioned molecular markers to discriminate resistance to black rot disease or whether it was a breeding variety, and thus the present invention was completed.

In order to solve the above-mentioned problems, the present invention provides an SSR primer set of SEQ ID NOS: 1 and 2; An SSR primer set of SEQ ID NOS: 3 and 4; An SSR primer set of SEQ ID NOS: 5 and 6; An SSR primer set of SEQ ID NOS: 7 and 8; A dCAPS primer set of SEQ ID NOs: 9 and 10; And a set of SSR primers of SEQ ID NOS: 11 and 12, respectively, in order to identify a cabbage black rot disease resistant cultivar.

Further, the present invention provides a primer set comprising: the primer set; And a reagent for carrying out an amplification reaction. The kit for identifying a cabbage black rot disease resistant cultivar is provided.

The present invention also provides a method for discriminating cabbage cultivars resistant to cabbage black rot disease using the primer set.

In addition, the present invention provides a black rot-resistant resistant locus locus locus located on chromosome 1 of cabbage.

The quantitative trait loci and six molecular markers of the present invention can discriminate resistance to cabbage black rot disease early and contribute to increase production of cabbage. In particular, the molecular markers of the present invention can be used for cultivation This is a resistant marker that can be used to identify the resistant varieties of Korean cabbage disease during the breeding period. This will reduce the cost of cultivating the cabbage varieties, reduce labor and breeding period, It is thought that it can make a great contribution to

Figure 1 is a genetic association map of cabbage constructed using 368 markers. Marked in red is the newly developed dCAPS marker, and blue markers are EST-dCAPS, MIP, IBP, genomic SSR and INDEL markers. Arrowheads indicate the location of the highest LOD score in each quantitative trait locus.
Figure 2 shows the disease index profile of the F ₂ population.
Fig. 3 is a blind test result for 24 lines of cabbage using the primer set for molecular marker amplification of the present invention.

In order to accomplish the object of the present invention, the present invention provides an SSR primer set of SEQ ID NOS: 1 and 2; An SSR primer set of SEQ ID NOS: 3 and 4; An SSR primer set of SEQ ID NOS: 5 and 6; An SSR primer set of SEQ ID NOS: 7 and 8; A dCAPS primer set of SEQ ID NOs: 9 and 10; And a set of SSR primers of SEQ ID NOS: 11 and 12, respectively, in order to identify a cabbage black rot disease resistant cultivar.

The primer set of the present invention specifically includes SSR primer sets of SEQ ID NOS: 1 and 2; An SSR primer set of SEQ ID NOS: 3 and 4; An SSR primer set of SEQ ID NOS: 5 and 6; An SSR primer set of SEQ ID NOS: 7 and 8; A dCAPS primer set of SEQ ID NOs: 9 and 10; And SSR primer sets of SEQ ID NOS: 11 and 12. For the analytical samples, it is possible to discriminate the resistant cultivars of cabbage black rot disease by the analysis results using all of the above six primer sets.

The primer set of the present invention was created by using genetic maps and F ₂ individuals having resistance and paternity to cabbage black rot disease, and identifying two regions of the main quantitative trait loci involved in black rot disease resistance through pathological experiments SEQ ID NOS: 1 and 2, SEQ ID NOS: 3 and 4, and primer sets of SEQ ID NOS: 7 and 8 capable of amplifying three EST-SSR (simple sequence repeat) markers developed in association with these regions SEQ ID Nos. 9 and 10 capable of amplifying an EST-dCAPS (derived cleaved amplified polymorphic sequence) marker and SEQ ID Nos. 5 and 6 capable of amplifying two genomic-SSR markers and primers of SEQ ID Nos. 11 and 12 A set of SSR primers of SEQ ID NOs: 1 and 2; An SSR primer set of SEQ ID NOS: 3 and 4; And SSR primer sets of SEQ ID NOS: 5 and 6 are primer sets that amplify each of the molecular markers present on one quantitative trait locus, and SSR primer sets of SEQ ID NOS: 7 and 8; A dCAPS primer set of SEQ ID NOs: 9 and 10; And SSR primer sets of SEQ ID NOS: 11 and 12 are present on another 1 quantitative trait locus. SEQ ID NOS: 1, 3, 5, 7, 9 and 11 are forward primers and SEQ ID NOS: 2, 4, 6, 8, 10 and 12 are reverse primers.

According to the sequence length of each primer, the primers include SEQ ID NOS: 1 and 2; SEQ ID NOS: 3 and 4; SEQ ID NOS: 5 and 6; SEQ ID NOS: 7 and 8; SEQ ID NOS: 9 and 10; At least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24 consecutive nucleotides in SEQ ID NOs: 11 and 12 Lt; RTI ID = 0.0 > oligonucleotides < / RTI > For example, the primer (20 oligonucleotides) of SEQ ID NO: 1 comprises an oligonucleotide consisting of fragments of at least 15, at least 16, at least 17, at least 18, at least 19 contiguous nucleotides in the sequence of SEQ ID NO: 1 . In addition, the primers include SEQ ID NOs: 1 and 2; SEQ ID NOS: 3 and 4; SEQ ID NOS: 5 and 6; SEQ ID NOS: 7 and 8; SEQ ID NOS: 9 and 10; Addition, deletion or substitution of the nucleotide sequences of SEQ ID NOS: 11 and 12.

In the present invention, a "primer" refers to a single strand oligonucleotide sequence complementary to a nucleic acid strand to be copied, and may serve as a starting point for synthesis of a primer extension product. The length and sequence of the primer should allow the synthesis of the extension product to begin. The specific length and sequence of the primer will depend on the primer usage conditions such as temperature and ionic strength, as well as the complexity of the desired DNA or RNA target.

As used herein, an oligonucleotide used as a primer may also include a nucleotide analogue, such as phosphorothioate, alkylphosphorothioate, or peptide nucleic acid, or alternatively, And may include an intercalating agent.

In order to achieve still another object of the present invention,

There is provided a kit for discriminating a cabbage black rot disease resistant cultivar, comprising a primer set according to the present invention and a reagent for carrying out an amplification reaction.

In the kit of the present invention, the reagent for carrying out the amplification reaction may include DNA polymerase, dNTPs, buffer and the like. In addition, the kit of the present invention may further include a user guide describing optimal reaction performing conditions. The manual is a printed document that explains how to use the kit, for example, how to prepare PCR buffer, the reaction conditions presented, and so on. The manual includes instructions on the surface of the package including a brochure or leaflet in the form of a brochure, a label attached to the kit, and a kit. In addition, the brochure includes information that is disclosed or provided through an electronic medium such as the Internet.

In order to achieve still another object of the present invention,

Isolating the genomic DNA from the cabbage sample;

Amplifying the target sequence by performing amplification reaction using the separated genomic DNA as a template and using the primer set of the present invention; And

And detecting the amplification product. The present invention also provides a method for identifying a cabbage variety resistant to cabbage black rot disease.

The method of the present invention comprises isolating genomic DNA from a cabbage sample.

A method known in the art may be used for separating the genomic DNA from the sample. For example, a CTAB method may be used, or a Wizard prep kit (Promega, USA) may be used. The target sequence can be amplified by performing amplification reaction using the separated genomic DNA as a template and using a primer set according to an embodiment of the present invention as a primer. Methods for amplifying a target nucleic acid include polymerase chain reaction (PCR), ligase chain reaction, nucleic acid sequence-based amplification, transcription-based amplification system, Strand displacement amplification or amplification with Q [beta] replicase, or any other suitable method for amplifying nucleic acid molecules known in the art. Among them, PCR is a method of amplifying a target nucleic acid from a pair of primers that specifically bind to a target nucleic acid using a polymerase. Such PCR methods are well known in the art, and commercially available kits may be used.

In the method of the present invention, the amplified target sequence may be labeled with a detectable labeling substance. In one embodiment, the labeling material can be, but is not limited to, a fluorescent, phosphorescent or radioactive substance. Preferably, the labeling substance is Cy-5 or Cy-3. When the target sequence is amplified, PCR is carried out by labeling the 5'-end of the primer with Cy-5 or Cy-3, and the target sequence may be labeled with a detectable fluorescent labeling substance. When the radioactive isotope such as ³² P or ³⁵ S is added to the PCR reaction solution, the amplification product may be synthesized and the radioactive substance may be incorporated into the amplification product and the amplification product may be labeled as radioactive. The primer set used to amplify the target sequence is as described above.

The method of the present invention comprises detecting said amplification product. The detection of the amplification product can be performed through capillary electrophoresis, DNA chip, gel electrophoresis, radioactivity measurement, fluorescence measurement or phosphorescence measurement, but is not limited thereto. As a method of detecting the amplification product, gel electrophoresis can be performed, and gel electrophoresis can be performed using acrylamide gel electrophoresis or agarose gel electrophoresis according to the size of the amplification product. In addition, capillary electrophoresis can be performed. Capillary electrophoresis can be performed, for example, using the ABI Genetic Analyzer. In the fluorescence measurement method, when a fluorescent dye is labeled at the 5'-end of the primer and PCR is performed, the target sequence is labeled with a fluorescent label capable of detecting the fluorescence. The fluorescence thus labeled can be measured using a fluorescence analyzer. In addition, in the case of performing the PCR, the radioactive isotope such as ³² P or ³⁵ S is added to the PCR reaction solution to mark the amplification product, and then a radioactive measurement device such as a Geiger counter or liquid scintillation counter The radioactivity can be measured using a liquid scintillation counter.

In a method according to an embodiment of the present invention, the method for distinguishing each cabbage cultivar after detection of the amplification product is characterized in that two of three molecular markers present on each locus of cabbage black rot resistance resistance-related two quantitative trait loci When the result of the same genotype as the parent of resistance or dysplasia is confirmed, the locus is divided into resistant or migratory loci, and the individuals showing resistance results in both loci are resistant to black rot, Individuals that show the consequences of disease on all loci are identified as individuals who are susceptible to black rot disease, and individuals that exhibit resistance results on only one locus as moderate resistant individuals.

The present invention also provides a black rot-resistant resistance-related quantitative trait loci located on chromosome 1 of cabbage. Specifically, it is characterized in that it is located from the 14,884,502 base to the 16,579,946 base of cabbage chromosome 1, and is located from the 18,227,386 base to the 37,119,290 base of chromosome 1 of cabbage 1 and black rot disease resistant locus To provide a black rot-resistant resistant locus of quantitative trait loci.

The term 'quantitative trait locus' refers to a locus that governs a quantitative trait, and a quantitative trait is a genetic trait that can be expressed in quantities such as weight, length, size, etc., and is also referred to as a quantity trait.

The two quantitative trait loci of the present invention are characterized by being associated with a black rot-resistant trait of cabbage.

Hereinafter, the present invention will be described in detail with reference to examples. However, the following examples are illustrative of the present invention, and the present invention is not limited to the following examples.

Materials and methods

1. Plant material and whole genome sequencing

Ltd. Joe Two cabbage seedlings purchased from (South Korea) (Brassica oleracea L. var. Capitata ) system was selected as the C1184 and C1234 all counterparts for developing mapping populations. Two strains react differently to black rot, while C1184 is a rotavirus pathogen, Mantoma Monas Campestris. Kam paste-less (Xanthomonas campestris pv. Campestris, Xcc) susceptible to bacteria, C1234 showed resistance. The mapping group consisted of 97 F ₂ plants generated through crosses between C1184 and C1234. In addition, 97 F ₂ plants promoted flowering defects and self-pollinated to produce F ₃ offspring seeds for inoculation experiments.

About 5 g of young leaf tissue was extracted from cabbage of parental lineage and genomic DNA was extracted by CTAB (cetyltrimethylammonium bromide) method. The amount and quality of extracted DNA was measured using Nano Drop ND-1000 (NanoDrop Technologies, Inc., USA). At least 5 μg of the extracted DNA was randomly sliced and quantified using DNA 1000 kit (Agilent Technologies, Inc., USA). Sequencing of the prepared shotgun libraries of C1184 and C1234 was then performed using an Illumina Hi-seq 2000. Fragmentation, library construction and sequencing were done at the National Instrumentation Center for Environmental Management, Seoul National University.

2. SNP  Explore and dCAPS Marker  design

The overall process of SNP search was performed according to DePristo et al. Briefly, using the Bowtie 2 program, paired readers of the parental line were aligned with the cabbage reference sequence (Parkin IA et al., 2014, Genome Biol. 15: R77) completed in the Canadian group. Then, lead grouping and removal of PCR duplicates were performed using Picard (http://picard.sourceforge.net). The misalignment caused by the INDEL was corrected by local re-alignment using the Genome Analysis Toolkit (GATK), and the candidate SNP was retrieved using the Variant Caller, a utility of the GATK. To filter out variants and avoid false positives, candidate SNPs with the following characteristics are removed: (1) the mapping quality score is lower than 4; (2) the quality is lower than 30; (3) The mapping depth is lower than 10x or higher than 45x.

Initially, the C1184 and C1234 SNPs related to the reference genome were separately called up, and those with the same SNP position in both parental lines were merged and compared, and promising SNPs were identified. Selected SNPs were used to develop dCAPS markers using the dCAPS Finder 2.0 program (http://helix.wustl.edu/dcaps) for the design of nearly identical primers containing SNP positions. After designing such mismatch primers for each SNP, the other primers were generated using the Primer3 program (http://primer3.wi.mit.edu/). All primers of the present invention were synthesized in Macrogen (Korea).

3. Molecular marker analysis

The newly developed dCAPS marker has been verified by polymorphism testing between two parent lines. Additional expressed sequence tags (EST) -based dCAPS, intron-based polymorphic (IBP), genomic SSR, and INDEL markers were not included in the genetic map of previous studies and were further analyzed in the present invention. In addition, five polymorphic markers based on the miniature inverted transposable element (MITE) insertion polymorphism (MIP) were also used for genotyping the F ₂ population. The PCR amplification was performed with a total volume of 25 μl containing 20 ng genomic DNA, 1 × PCR buffer, 20 pM primer set, 0.2 mM dNTPs and 1 U Taq DNA polymerase (Vivagen, Korea), and the amplicon of the dCAPS marker 3U of appropriate restriction enzymes, the corresponding 1X buffer and, if necessary, 1X BSA (bovine serum albumin) were reacted at 37 ° C for at least 3 hours. Amplicons of dCAPS markers and other markers were identified by staining with EtBr (ethidium bromide) after electrophoresis on 9% non-denaturing polyacrylamide gel or 1% agarose gel to match the size of the fragment.

4. Inoculation experiment

Zanthomonas campestris pv. Purchased from the Korean Agricultural Culture Collection (KACC). Kam the paste-less (Xanthomonas campestris pv. Campestris, KACC 10366) strain was used in the immunization experiments. Bacterial inoculum was cultured in TSA (tryptic soy agar) solid medium at 30 ° C for 48 hours. The cultured bacteria were recovered using a spreader and diluted with distilled water to an absorbance of 0.125 at 600 nm.

Inoculation experiments carried out in 2012, 2013 and 2014 under the same conditions at the Korea Research Institute of Chemical Technology were carried out with 10-15 F ₃ plants of each individual F ₂ plant selected for genotyping. F ₅ seeds in a plastic pot of a total of 40 balls and 8 seeds in a horizontal direction were seeded with F seeds and cultivated in a greenhouse for 20 days. Bacteria were inoculated by spraying a bacterial suspension on the 20-day-old plants with two fully-grown bolls until the axillary and hypocotyl surfaces were sufficiently wetted. Each plastic pot (40 plants) received 80 ml of bacterial suspension, and the inoculated plants were transferred to a high humidity dew chamber set at a temperature of 28 ° C and allowed to stand for 48 hours, And 80% humidity, and further cultured for 7 days under a condition of 12 hours / day, and the disease was observed in two leaves. The intensity of black rot disease symptoms was recorded by evaluating the following disease index based on the infected leaf area: (0), less than 15% of leaf areas showing black rot disease symptoms; (1), 15-30% of leaf area with black rot disease symptoms; (2), 30-55% of leaf area with black rot symptoms; (3), 55-75% of leaf area with black rot disease symptoms; (4) More than 75% of leaf areas showing black rot disease symptoms.

5. Genetic map construction and quantitative trait locus analysis

A total of 103 polymorphic markers were identified in the F ₂ group and the results were merged into the genetic map of the previous study. We used JoinMap version 4.1 program for association analysis and map building. We used the Kosambi mapping function to convert recombination frequencies to genetic distance.

The disease index of each F ₂ population was calculated as the average grade of 10 to 15 F ₃ seedlings. Xcc Quantitative trait loci for resistance were calculated using composite interval mapping (CIM) analysis with the QGene program. CIM was performed with a logarithm of odds (LOD) threshold value calculated using a 5-percent significance to 1,000 permutation test at 0.5 cM scan interval.

6. Blind experiment of cabbage samples using molecular markers

PCR was performed on the 24 cabbage lines from Joe Eun Seed Co., Ltd. using the molecular markers of the present invention. The amplified products were then loaded on a 9% acrylamide gel and electrophoresed for approximately 1 hour and 40 minutes. The gel was stained with EtBr and visualized with a UV transilluminator. The amplification products of C1184 strain and C1234 strain, which are resistant to cabbage black rot, were loaded and analyzed for genotyping.

Example  1. Cabbage Motherhood  Whole genome of object Resequencing  And SNP  Detection result

The results of whole genome sequencing for the C1184 strain showing resistance to cabbage black rot disease and the C1234 strain showing resistance are shown in Table 1 below. This result shows approximately 18 times genome coverage for the parental lines based on the estimated genome size. Each set of paired leads was mapped to nine pseudo-chromosomes of the reference genome sequence. Overall, 94 million unprocessed leads (82.1%) from the C1184 strain and 88 million leads (77.6%) from the C1234 strain were successfully aligned to the reference genome. The average mapping depth was 21.2-fold and 20-fold for the C1184 and C1234 lines, respectively.

Whole genome sequencing results for cabbage line C1184 C1234 Raw reads 114,454,524 113,830,992 Raw bases 11,559,906,924 11,496,930,192 Coverage of B. oleracea genome 17.8X 17.7X GC (%) 36.1 35.6 Mapped reads 93,956,750 88,382,752 Mapped percentage (%) 82.1 77.6 Mapped bases 9,489,631,750 8,926,657,952 Mapping depth (average) 21.2 20.0

The total number of SNPs related to the reference sequence and the average SNP density were similar to those of the two parental lines. A comparison of the reference sequences revealed approximately 1,200 and 1,240,000 high quality SNPs for C1184 and C1234, respectively. On average, SNPs were found at 372.8 bp for C1184 and 360.0 bp for C1234, SNPs were found most frequently at the third chromosome in both strains, and at the sixth chromosome at C1184 and at the fourth chromosome at C1234 .

These SNPs were merged and used to search for SNPs between two parental lines (Table 2). As a result, a total of 674,521 SNPs were identified across all nine chromosomes, and one SNP was identified at 662.5 bp intervals. The highest density of SNPs was identified on the third chromosome, while the lowest density of SNPs was identified on the fifth chromosome. By analyzing the distribution of SNPs per 100 kb along the nine chromosomes, high and low SNP density regions could be identified for each chromosome.

Development of dCAPS markers for SNPs and assays detected from the results of whole genome sequencing of cabbage Ch. Number of SNPs (ave. Bp per SNP) Validation Ref. C1184 Ref. C1234 Amplified /
Designed Polymorphic (h) ^a % ^b C01 122,191 (358.2) 114,778 (381.3) 31/35 20 (4) 64.5 CO2 149,730 (353.2) 161,246 (328.0) 14/17 10 (1) 71.4 C03 196,150 (331.3) 205,306 (316.5) 13/22 11 (1) 84.6 C04 136,815 (392.6) 132,144 (406.5) 14/20 8 (4) 57.1 C05 130,557 (359.2) 132,887 (353.0) 15/18 14 (2) 93.3 C06 87,712 (454.1) 102,422 (388.8) 28/34 16 (4) 57.1 C07 119,275 (405.5) 128,978 (375.0) 8/15 5 (1) 62.5 C08 108,586 (384.6) 113,956 (366.4) 21/26 18 (3) 85.7 C09 147,866 (369.8) 149,581 (365.6) 23/35 15 (6) 65.2 total 1,198,882 (372.8) 1,241,298 (360.0) 167/222 117 (26) 70.1

(a, number of markers showing heterozygosity results; b, percentage of total expanded dCAPS marker of polymorphism)

Example 2. Development of dCAPS marker and genetic mapping

SNPs between C1184 and C1234 were used to develop dCAPS markers. Based on the physical location of all markers used in the genetic map of previous studies, a new dCAPS marker was designed in a low marker density region. Of the magnified 167 markers, 117 (70.1%) were polymorphic between the two parental lines (Table 2). In the present invention it was used for 87 of these polymorphisms dCAPS Marker for each object by genotype analysis of the F ₂ population. In addition, 16 polymorphic markers, including five EST-based dCAPS markers, five MIP markers, three IBP markers, two genomic SSR markers, and one INDEL marker were also used for genotyping the same population. Of the 103 newly analyzed markers, 25 markers showed a 1: 2: 1 Mendelian ratio in the F ₂ population that was distorted.

A high density of genetic map was developed by adding 103 new polymorphic marker positions to 265 markers from previous studies. All 368 markers were placed on the map, and each association group produced associative maps with nine association groups with more than 32 markers (Figure 1 and Table 3). The improved cabbage gene map was extended over 1,467.3 cM, 135.4 cM greater than the genetic map of the previous study, and the mean distance between neighboring locations was reduced from 5.02 cM to 3.88 cM. Most of the new dCAPS markers were mapped to the original predicted positions of each chromosome sequence, but BoRSdcaps1-35 designed on the first chromosome on the second chromosome and BoRSdcaps5-18 designed on the fifth chromosome were mapped to the ninth chromosome There were also.

Distribution of molecular markers in cabbage gene map Marker type C01 CO2 C03 C04 C05 C06 C07 C08 C09 Sum Invention dCAPS 15 8 10 3 11 12 4 15 9 87 Other markers 0 One One 2 6 One One One 3 16 Previous studies 18 25 52 43 23 19 29 25 31 265 Sum 33 34 63 48 40 32 34 41 43 368 Length (cM) 115.7 142 189.4 176.8 225.4 126.8 147.4 144.1 199.7 1467.3 Average spacing
(cM) 3.51 4.18 3.01 3.68 5.64 3.96 4.34 3.51 4.64 3.88

Example 3. Analysis of resistance to black rot disease and quantitative trait locus (QTL) analysis

In the present invention, three independent inoculation tests were conducted over three years from 2012 to 2014. Balbyeongdo end of the F ₂ plants, 10 to 15 F ₂ in each test _was measured to calculate the average value of the black rot disease index for the _three progeny plants. Although three tests were performed under the same conditions, the severity of each test was not consistent and tended to become more severe each year (Fig. 2), perhaps due to differences in plant growth or F3 seed storage period or weather between each year It was presumed to be due to a difference.

The inventors have discovered important quantitative trait loci based on LOD scores higher than thresholds calculated in permutation assays. The LOD threshold value for each year is 3.063 in 2012, 2.912 in 2013 and 2.906 in 2014. In the first test performed in 2012, there were three important quantitative trait loci, BRQTL-C1_1 and BRQTL-C1_2, located on the first chromosome, and BRQTL-C3, located on the third repeat chromosome. LOD value, additive effect and variance explained (Table 4). In the second trial, only one quantitative trait locus (BRQTL-C1_2) was identified and in the third trial performed in 2014 BRQTL-C1_1 and BRQTL-C1_2 as well as a new quantitative trait locus of BRQTL-C6 on chromosome 6 Respectively. BRQTL-C1_2 identified in the 2014 trial was identified as smaller than the region identified in 2012, but showed the highest LOD score among all quantitative trait loci.

Example 4. Confirmation of NBS coding gene in quantitative trait locus

In most plants, the disease resistance-associated gene (R gene) encodes the NBS-NRR protein, which contains a nucleotide binding site (NBS) and a series of leucine-rich repeats (LRRs). The NBS-NRR protein recognizes pathogenic toxic agents and induces defense mechanisms and hypersensitive responses. Accordingly, the present inventors compared the gene map of the present invention with the pseudo-chromosome and examined the NBS-NRR gene in the quantitative trait region (Table 5). BRQTL-C1_1 was found between H073E22-3 and BoRSdcaps1-11 markers, and BRQTL-C1_2 was found between BoRSdcaps1-13 and BoRSdcaps4.

Example 5. Verification of marker resistance of black rot disease of cabbage

Six primer markers having the highest peaks in the BRQTL-C1_1 and BRQTL-C1_2 loci which were repeatedly identified through the above three inoculation tests were selected and a primer set capable of amplifying the markers was designed (Table 6).

Molecular marker for the identification of resistance to cabbage black rot disease Primer for amplification Marker name Marker type (5 'to 3') (SEQ ID NO: 5) Reverse direction (5 '- > 3') (SEQ ID NO: limit
enzyme BoESSR145 EST-SSR GGGCGAGGATGGTTACTACA (1) TCATACCCCAAGGCTATTTT (2) BoESSR726 EST-SSR CAATGGGTTACGCATGGTTT (3) CGTTTGTGAAACAGCCATTG (4) BnGMS301 Genomic SSR AATATGCAGCATTCTAGACAAA (5) ATCATTCTCGTGATGACACA (6) BoESSR089 EST-SSR ATGATCAGCGAAACCACTCC (7) TGATACATCCCGTTTGCTCA (8) BoEdcaps4 EST-dCAPS GCAACGTTCCCTGTTCTTGT (9) GCCGTTGACTACATCGACGAGAGCGGGATC (10) BamH I BnGMS299 Genomic SSR AACGTTGGAAAGAACTTTGA (11) TTTCAATGGTTTGTTGATGA (12)

Then, for the validation of the molecular markers, 24 superior cabbage breeding lines purchased from domestic seed companies were tested for blindness. PCR results using the molecular markers of the present invention show that when two or more of three locus markers exhibit the same genotype results as the C1234 strain and when they exhibit the same results as those of the C1184 strain at two or more markers, , The individuals exhibiting resistance to both BRQTL-C1_1 and BRQTL-C1_2 loci were resistant to black rot, and showed resistance to BRQTL-C1_1 only in the middle resistance-resistant individuals and in both loci When the result of the experiment is shown, it is identified as a disease - resistant organism and the results are analyzed.

As a result of the blind test, 22 strains of 24 cabbage lines in total, as shown in Fig. 3 and Table 7, were able to discriminate resistance to or resistance to black rot disease using the molecular markers of the present invention. Because the black rot fungi resistant trait is a quantitative trait involving several loci, it is presumed that the two strains, for which the results of the blind test are inconsistent, are due to the effect of the fine loci.

<110> Seoul National University R & DB Foundation <120> Molecular marker for discriminating black rot-resistant or          sensitive cabbage cultivar and uses thereof <130> PN15365 <160> 12 <170> Kopatentin 2.0 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 1 gggcgaggat ggttactaca 20 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 2 tcatacccca aggctatttt 20 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 3 caatgggtta cgcatggttt 20 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 4 cgtttgtgaa acagccattg 20 <210> 5 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 5 aatatgcagc attctagaca aa 22 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 6 atcattctcg tgatgacaca 20 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 7 atgatcagcg aaaccactcc 20 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 8 tgatacatcc cgtttgctca 20 <210> 9 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 9 gcaacgttcc ctgttcttgt 20 <210> 10 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 10 gccgttgact acatcgacga gagcgggatc 30 <210> 11 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 11 aacgttggaa agaactttga 20 <210> 12 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 12 tttcaatggt ttgttgatga 20

Claims (7)

An SSR primer set of SEQ ID NOS: 1 and 2; An SSR primer set of SEQ ID NOS: 3 and 4; An SSR primer set of SEQ ID NOS: 5 and 6; An SSR primer set of SEQ ID NOS: 7 and 8; A dCAPS primer set of SEQ ID NOs: 9 and 10; And a set of SSR primers of SEQ ID NOs: 11 and 12, respectively, to identify a cabbage black rot disease resistant variety. A primer set according to claim 1; And a reagent for carrying out an amplification reaction. A kit for discriminating a cabbage black rot disease resistant cultivar. 3. The kit according to claim 2, wherein the reagent for carrying out the amplification reaction comprises a DNA polymerase, dNTPs and a buffer. Isolating the genomic DNA from the cabbage sample;
Amplifying the target sequence by performing amplification reaction using the separated genomic DNA as a template and using the primer set according to claim 1; And
And detecting the amplification product. &Lt; Desc / Clms Page number 20 &gt; 5. The method of claim 4, wherein the detection of the amplification product is performed by gel electrophoresis, capillary electrophoresis, DNA chip, radioactivity measurement, fluorescence measurement or phosphorescence measurement. delete delete

Images