CN113061623B

CN113061623B - Preparation method of transgenic plant for expressing cell nucleus transformation of virus-like particles and application of transgenic plant in resisting cotton bollworm

Info

Publication number: CN113061623B
Application number: CN202110491857.8A
Authority: CN
Inventors: 张江; 任康; 姜春妹; 付金秋; 常玲
Original assignee: Hubei University
Current assignee: Hubei University
Priority date: 2021-05-06
Filing date: 2021-05-06
Publication date: 2022-11-08
Anticipated expiration: 2041-05-06
Also published as: CN113061623A

Abstract

The invention belongs to the technical field of biology, and particularly relates to a preparation method of a transgenic plant for expressing cell nucleus transformation of virus-like particles and application of the transgenic plant in cotton bollworm resistance. The invention constructs a tobacco expression vector, successfully detects the high-efficiency expression of the MS2 phage capsid protein in tobacco, detects the expression of hpRNA and selects a tobacco strain with the highest expression quantity. Secondly, a mature cotton bollworm feeding system is established, and physiological test of the cotton bollworms is carried out on the basis. The technical scheme of the invention effectively improves the resistance of the plant to the cotton bollworm, inhibits the growth and pupation of the cotton bollworm, and obviously reduces the target gene Ace1 in a treatment group, thereby indicating that the successful application of virus-like particle mediated RNAi can effectively improve the resistance of the plant to the cotton bollworm. The successful application of the VLP mediated RNAi molecule delivery technology in plants lays a solid foundation for the prevention and control of the cotton bollworm and provides an effective way for the prevention and control of the cotton bollworm.

Description

Preparation method of transgenic plant for expressing cell nucleus transformation of virus-like particles and application of transgenic plant in resisting cotton bollworm

Technical Field

The invention belongs to the technical field of biology, and particularly relates to a preparation method of a transgenic plant for expressing cell nucleus transformation of virus-like particles and application of the transgenic plant in cotton bollworm resistance.

Background

The cotton bollworm is one of the most important agricultural pests in China and is also a worldwide pest, more than 200 plants are damaged, and the prevention and control of the cotton bollworm by using bacillus thuringiensis (Bt) is considered to be an environment-friendly prevention and control method and is widely applied. But also brings new problems with its widespread planting, such as emergence of resistance to Bt by cotton bollworms, secondary pests becoming major pests, acceleration of the evolution of cotton bollworms, and the like. The developed RNAi insect-resistant technology in recent years has the advantages of high sequence specificity and environmental friendliness, and provides a new idea and direction for pest control.

RNAi is a phenomenon of gene silencing induced by dsRNA in eukaryotes, the dsRNA is cut into 21-24nt siRNA by endonuclease Dicer, then the siRNA and some AGO proteases in vivo form an RNA-induced silencing complex (RISC), and then complementary mRNA is cut, so that the mRNA is degraded, and the gene silencing is induced. In the field of pest control, RNAi technology affects the growth of pests or kills pests by inhibiting the expression of key genes of the pests. The technology has sequence specificity, is harmless to crops, human beings and livestock aiming at a specific target site, and has great application potential.

Over the past 10 years, significant efforts have been made to control pests using plant-mediated RNAi technology. The earliest reports were: mao et al, after feeding cotton bollworms with tobacco and cotton expressing P450 gene RNAi molecules, the expression of the P450 gene in the intestinal tracts of the cotton bollworms is significantly reduced, thereby inhibiting the feeding and growth of the cotton bollworms. Further research shows that cysteine protease gene is additionally transferred into cotton to further improve the insect-resistant effect of RNAi; baum and the like genetically modify corn to express RNAi molecules targeting the A subunit gene of vacuolar ATP enzyme of Diabrotica virgifera Leconte, and the result shows that eating the genetically modified corn can inhibit the expression of target genes of intestinal cells of pests, and the damage to the genetically modified corn roots is 50 percent less than that of wild corn; in the research of plant-mediated RNAi (ribonucleic acid interference) resistance to cotton bollworms, different subject groups report that the expression of corresponding genes can be inhibited aiming at different target genes, and transgenic plants have certain resistance to the cotton bollworms; in addition, ni et al reported that by polymerizing RNAi and Bt in cotton, the insect resistance of plants could be further improved and the rate of evolution of the Bt resistance of Heliothis armigera could be delayed. Plant-mediated RNAi has also been successfully reported on piercing-sucking mouthpart pests, for example, pitino and the like feed peach aphids with transgenic plants containing dsRNA expressed by salivary gland MpC gene and intestinal track 1 gene, and the expression of more than 60% of target genes of the peach aphids is found to be inhibited, and the quantity of the progeny thereof is obviously reduced. Zha and the like prove that RNA interference and insect resistance can also be used for resisting piercing-sucking insects, namely brown planthopper of rice, and that the rice fed with RNAi molecules can inhibit the expression of corresponding genes; wang Hui and the like feed the sitophila avenae and the green peach aphids by using dsRNA expressed by cytochrome P450 genes, successfully inhibit the cytochrome expression in the aphids, and finally cause the death of the aphids.

Although plant nuclear transgene-mediated RNAi technology has achieved remarkable success in pest management, its pest-resistance effect is less than ideal for controlling pests with Bt crops. The possible reasons for this are: (1) since insects lack RNA-dependent RNA polymerase (RdRP), RNAi anti-insect effect will depend on uptake of dsRNA dose, however the amount of dsRNA expressed by nuclear transformation is not high enough to elicit a significant RNAi response by the target pest. (2) As the plant has an RNAi pathway, dsRNA expressed in the plant can be processed into siRNA by Dicer of the plant, and the siRNA produced by the plant has poor effect on resisting insects. Thus reducing the insect-resistant effect as a whole. Therefore, increasing the expression level of the insecticidal dsRNA in plants and improving the stability thereof in plants would be a strategy to effectively improve the insect-resistant effect.

In summary, the problems of the prior art are:

helicoverpa armigera is a lepidopteran pest, which is currently generally recognized as being refractory to RNAi. Firstly, the method comprises the following steps: the stability of dsRNA is related to the activity of RNase and physiological pH, and the dsRNA has higher stability in body fluid of coleoptera and lowest stability in lepidoptera and is degraded quickly. Secondly, the method comprises the following steps: dsRNA is differentially internalized into cells, where it is taken up by midgut epithelial cells by clathrin-dependent endocytosis or other dsRNA transposons and subsequently released into the cytoplasm, where it is cleaved into siRNA to efficiently trigger RNAi. In lepidoptera, a portion of the dsRNA is degraded by RNase, and another portion enters the midgut epithelial cells, is mostly captured by endosomes, and is not processed into sirnas to form useful RNAi. Some dsRNA is rapidly degraded by RNase in the blood cavity when being transported into the blood cavity, and is not sufficiently transported into fat cells. Thirdly, the steps of: the efficiency of RNAi core elements varies, and even if dsRNA is successfully internalized into cells and contacts core enzymes in the RNAi pathway, the variation in expression and function of these core enzymes results in a variation in the efficiency of RNAi production in insects. Fourthly: RNAi is limited in efficiency by insufficient systemic transmission of RNAi and insufficient transmission of silencing signals between cells. Thus, the expression of dsRNA/AmiRNA in plants against Helicoverpa armigera by means of RNAi is greatly restricted.

Therefore, optimization aiming at the four aspects is urgently needed to enhance the insect-resistant effect of the plant on lepidoptera pests through an RNAi method, namely, the stability of dsRNA in the pests is improved, the capacity of dsRNA internalized by cells is enhanced, the efficiency of RNAi core elements is improved, and the systemic transmission of RNAi is enhanced, so that the effect of protecting the plant is achieved.

Disclosure of Invention

Aiming at the problems in the prior art, the invention provides a preparation method of a transgenic plant transformed by a cell nucleus expressing virus-like particles and application thereof in resisting cotton bollworm, aiming at resisting the cotton bollworm by expressing the virus-like particles MS2 and insecticidal hpRNA aiming at insect essential genes in the plant. Provides a new effective method for plant protection and prevention and control of lepidoptera pests.

The invention is realized in such a way, the preparation method of the transgenic plant for expressing the cell nucleus transformation of the virus-like particle inserts the cell nucleus gene through the T-DNA mediated by agrobacterium to carry out recombinant expression on the virus capsid protein and the hpRNA of the key gene for inhibiting pests in the plant, thereby obtaining the transgenic plant for expressing the recombinant virus-like particle.

The invention also discloses the application of the preparation method in preparing cotton bollworm resistant plants.

The invention also discloses a preparation method of the cotton bollworm resistant plant, which is characterized by comprising the following steps: the recombinant expression of viral capsid protein and hpRNA of key gene for inhibiting cotton bollworm in plant is realized by inserting T-DNA mediated by agrobacterium into nucleus gene.

Further, the key gene for inhibiting the cotton bollworm comprises an Ace1 gene.

The preparation method of the bollworm Ace1 gene hpRNA comprises the following steps: the Ace1 gene and a gene derived from a potato intron (GA 20) were used to construct hpRNA, and the expression cassette was constructed by combining the double-caMV 35s promoter and the NOS terminator, and the hpRNA was expressed in a plant tobacco by ligating the hpRNA of the Ace1 gene to a plasmid pBl121 having a kanamycin expression cassette.

Further, the viral capsid proteins include the MS2 bacteriophage capsid protein and the transmembrane peptide TAT.

Further, the virus capsid protein is MS2 capsid protein with 2 copies, and a transmembrane peptide sequence TAT is fused in the AB loop structural domain of the MS2 capsid protein with the second copy, and the whole sequence is shown in SEQ ID NO. 2.

Further, the plant comprises tobacco. The tobacco seeds are cultured under sterile conditions. The culture conditions were: the temperature is 25 ℃/20 ℃, the illumination period is 16h illumination/8 h darkness, and the light intensity is 50-150 muE. Cutting and decomposing 2-4 tender tobacco leaves, placing the cut tobacco leaves into cultured agrobacterium tumefaciens, shaking and vibrating, then placing tobacco leaf fragments into a selective culture medium for screening positive buds, obtaining nuclear transfer tobacco after detecting the positivity of the nuclear transfer tobacco through PCR, then detecting the expression quantity of the nuclear transfer tobacco through qRT-PCR, and selecting the tobacco with the highest expression quantity for subsequent bioassay experiments.

Further, the method for introducing the target gene into Agrobacterium includes any one of an electric transformation method and a freeze-thaw method.

Further, a plasmid pBl is used as an expression vector to construct a plant vector for expressing hpRNA of the Ace1 gene and the MS2 virus capsid protein shown in SEQ ID NO.2, the plant vector is transformed into tobacco leaves, and the plant resistant to cotton bollworm is obtained by culturing.

The invention also discloses application of the transgenic plant prepared by the preparation method of the cotton bollworm resistant plant in cotton bollworm resistance.

Further, the application is manifested by the growth and development delay and/or death of the cotton bollworm.

Further, the use is manifested by inhibition of the growth and/or pupation and/or lethality of cotton bollworms.

Further, the application appears to be effective in protecting plants to some extent.

In summary, the advantages and positive effects of the invention are:

the Escherichia coli MS2 bacteriophage belongs to positive single-stranded RNA spherical virus, the genome has a full length of 3659bp, 4 protein molecules such as coded mature enzyme protein, coat protein, replicase protein, cracking protein and the like are encoded, each MS2 bacteriophage contains 180 copies of coat protein, one copy of mature protein and a positive icosahedron wrapping one molecule of RNA. In early phage studies, it was found that 5' end of phage replicase gene has a stem-loop region (pac) consisting of about 21 nucleotides, and binding of phage coat protein dimer to this stem-loop structure not only initiates the assembly of coat protein itself, but also the process of coating whole phage genome RNA with coat protein. The TAT polypeptide is a nucleotide sequence derived from the transduction domain of the HIV virus, and its display on the surface of the phage particle helps to cross the cell membrane. By encapsulating the hpRNA into the phage particle via the pac site, the mature virus-like particle can prevent the processing of hpRNA by Dicer enzyme and cleavage into siRNA in plant cells, and can protect the degradation of hpRNA by DNAse and RNase in plant cells and in the gut of Helicoverpa armigera. TAT helps the virus-like particles to cross the cell membrane to ensure that hpRNA enters the cotton bollworm cell, resulting in an effective RNAi response.

According to the invention, a tobacco expression vector is firstly constructed, the high-efficiency expression of the MS2 phage capsid protein in tobacco is successfully detected through Western blot, the expression of hpRNA is detected through qRT-PCR, and a tobacco strain with the highest expression quantity is selected. Secondly, a mature cotton bollworm feeding system is established, and the physiological test of the cotton bollworms is carried out on the basis. The technical scheme of the invention effectively improves the resistance of the plant to the cotton bollworm, inhibits the growth and pupation of the cotton bollworm, detects the obvious down-regulation of the objective gene Ace1 in a treatment group through qRT-PCR, and shows that the successful application of virus-like particle mediated RNAi can effectively improve the resistance of the plant to the cotton bollworm. The successful application of the VLP mediated RNAi molecule delivery technology in plants lays a solid foundation for the prevention and control of the cotton bollworm and provides an effective way for the prevention and control of the cotton bollworm.

Drawings

FIG. 1 is a vector diagram of a plant expression vector provided in an embodiment of the present invention;

FIG. 2 is a qRT-PCR diagram for identifying dsRNA expression level in different strains of plant expression vector JQ14 transgenic tobacco provided by the embodiment of the invention;

FIG. 3 is a qRT-PCR diagram for the identification of dsRNA expression levels in different strains of plant expression vector JQ44 transgenic tobacco provided by the embodiment of the invention;

FIG. 4 is a western blot of the plant expression vector JQ32 induced expression of the capsid protein of the MS2 bacteriophage;

FIG. 5 is a western blot of the plant expression vector JQ44 induced expression of the capsid protein of the MS2 bacteriophage;

FIG. 6 is a graph showing weight changes of cotton bollworms according to the results of the example of the present invention;

FIG. 7 is a phenotype plot of Heliothis armigera on day six of the results of the example of the present invention;

FIG. 8 is a graph showing the results of examples of the present invention, together with the results of qRT-PCR method for detecting Ha-Ace1 gene expression levels in Helicoverpa armigera.

Detailed Description

In order to make the objects, technical solutions and advantages of the present invention more apparent, the present invention is further described in detail below with reference to examples, and the equipment and reagents used in the examples and test examples are commercially available without specific reference. The specific embodiments described herein are merely illustrative of the invention and are not intended to be limiting.

Various modifications to the precise description of the invention will be readily apparent to those skilled in the art from the information contained herein without departing from the spirit and scope of the appended claims. It is to be understood that the scope of the invention is not limited to the procedures, properties, or components defined, as these embodiments, as well as others described, are intended to be merely illustrative of particular aspects of the invention. Indeed, various modifications of the embodiments of the invention which are obvious to those skilled in the art or related fields are intended to be covered by the scope of the appended claims.

For a better understanding of the invention, and not as a limitation on the scope thereof, all numbers expressing quantities, percentages, and other numerical values used in this application are to be understood as being modified in all instances by the term "about". Accordingly, unless expressly indicated otherwise, the numerical parameters set forth in the specification and attached claims are approximations that may vary depending upon the desired properties sought to be obtained. At the very least, each numerical parameter should at least be construed in light of the number of reported significant digits and by applying ordinary rounding techniques. In the present invention, "about" means within 10%, preferably within 5% of a given value or range.

In the following examples of the present invention, the temperature is not particularly limited, and all of the conditions are normal temperature conditions. The normal temperature refers to the natural room temperature condition in four seasons, no additional cooling or heating treatment is carried out, and the normal temperature is generally controlled to be 10-30 ℃, preferably 15-25 ℃.

The genes, proteins or fragments thereof involved in the present invention may be either naturally purified products or chemically synthesized products or produced from prokaryotic or eukaryotic hosts (e.g., bacteria, yeast, plants) using recombinant techniques.

The invention screens lethal gene Ace1 gene based on cotton bollworm transcriptome data, MS2 armored RNA technology and transmembrane property of TAT polypeptide, designs plant expression vector, develops a preparation method of transgenic plant for expressing virus-like particle cell nucleus transformation and application thereof in resisting cotton bollworm, and is concretely shown in the following embodiment. The strains involved in the invention comprise: agrobacterium tumefaciens EHA105; a vector for MS2 capsid protein expression; the double caMV35s promoter and SUPER promoter and kanamycin-resistant plasmid pBl are expression vectors as plant vectors for expressing MS2 protein and RNA.

Example 1 establishment of an indoor rearing technique for Heliothis armigera

The cotton bollworm eggs selected in the embodiment are purchased from Jiyuan Baiyun industry Co., ltd (official Internet shop of Congyun biology, henan province), the cotton bollworm is incubated in an environment with 28 ℃, 60% humidity and 14h light/10 h dark, and the cotton bollworm with the incubation time within 6h is selected to be cultured on the artificial cotton bollworm feed. The formula of the artificial feed for the cotton bollworms is as follows:

adding 700ml of boiling ultrapure water into 135g of yeast powder, uniformly mixing, and pouring 300g of corn flour; 150g of soybean flour; 75g sugar, stirring to smooth and adding 25ml of 22.4% NaOH in order; 60ml 5% acetic acid; 22.5ml of 25% formaldehyde; 22.5ml of multivitamin (1.528 g nicotinic acid; 1.525g B5;0.764g riboflavin; 0.382g vitamin B1;0.382g vitamin B6;0.382g folic acid B9;0.305g vitamin H;0.003g cyanocobalamin B12;500g water) and then 3g sorbic acid; 3g of methylparaben; 9.4g of vitamin C, stirring uniformly, then adding 30g of agar into 800ml of ultrapure water, boiling until the agar is viscous and drawn, mixing with the agar, stirring uniformly again, placing in a box, cooling for later use, storing in a refrigerator at 4 ℃ and keeping the shelf life of one week.

The insects growing on the feed should be separately raised with 24-pore plates at the later stage of growing to two years old to avoid self-killing, the feed is replaced once every two days before four years old, and the insects are replaced into 12-pore plates every day after four years old. The culture conditions are as follows: at 28 deg.C, 60% humidity, 14h light/10 h dark; the illumination intensity is as follows: 30-40 mu Em-2 s-1.

Example 2 obtaining of the bollworm Ace1 Gene

1. Design of specific primer of bollworm Ace1 gene

An upstream primer F:5'-acccatgtaagcttCAATGCAATATAGA-3'

A downstream primer R:5'-cgtaccagatctTACTTTCCTCTCT-3'

The sequence of the target fragment (the cDNA of the bollworm Ace1 gene) is shown as SEQ ID NO. 1.

2. Obtaining of Cotton bollworm mRNA

2.1 acquisition of the material: and selecting the bollworm adults with good growth, and immediately freezing the bollworm adults by liquid nitrogen.

2.2 Total RNA extraction: the total RNA of the cotton bollworm is extracted by adopting an RNAioso Plus reagent of TaKaRa, and the main steps are as follows: one adult is taken and put in liquid nitrogen for quick freezing, and ground in a proofing machine. Adding 1ml takara RNAioso Plus, shaking up quickly, vortexing for about 18s, and standing at room temperature for 10min for full lysis. Adding 200Mu.l of chloroform, mixed well, stood on ice, centrifuged at 12000rpm for 1min at 4 ℃. About 400. Mu.l of the upper colorless aqueous phase was transferred to a new tube. Repeat 4-5 times, extract several times with chloroform. Adding equal volume of isopropanol, mixing gently, standing at-20 deg.C for 10min, centrifuging at 12000rpm for 10min, and discarding supernatant. The precipitate was washed with 1ml of 75% ethanol, left on ice for 2min, centrifuged at 7500rpm for 5min at 4 ℃ and the supernatant discarded. And (4) carrying out microcentrifugation, sucking away residual alcohol by using a gun head, and drying. Drying the precipitate at room temperature, adding 30-50 μ l DEPC water or (RNase free H in kit) ₂ 0) And dissolving at room temperature, and measuring the concentration by using an enzyme-free gun head.

3. Reverse transcription reaction

3.1 residual genomic DNA removal

Prepare the following mixture in RNase free centrifuge tube, gently blow and mix with a pipette. Incubate at 42 ℃ for 2min.

3.2 preparation of reverse transcription reaction System (20. Mu.L System)

2 XHifair is directly added into the reaction tube of the step 1 ^TM II Supermix plus, gently pipetting and mixing.

3.3 reverse transcription Programming

The above mixture was incubated according to the following procedure.

After reaction, the mixture can be stored at the temperature of minus 80 ℃ for a long time after being split and packaged.

4. Specifically amplified Ace1 gene and validation thereof

The cotton bollworm cDNA is taken as a template, the designed primers are combined to form a pair primer, and PCR reaction is carried out, wherein the reaction system comprises the following steps:

after mixing, PCR reaction was carried out:

94 ℃ for 3min;95 ℃,15s,58 ℃,15s,72 ℃,30s (1 min/kb), 35cycles; and (3) carrying out sampling and electrophoresis at 72 ℃ for 5min, and observing a target band in an ultraviolet gel imaging system. Recovering the target fragment.

EXAMPLE 3 preparation of Agrobacterium-infected competent cells

1. Preparation of Agrobacterium competent cells

(1) Marking activated agrobacterium tumefaciens EHA105, picking a single colony of the agrobacterium tumefaciens EHA105 in 3ml of YEB liquid culture medium (containing Rif 50 mg/l), and carrying out shaking culture at 28 ℃ for overnight;

(2) Inoculating 1ml of overnight culture liquid into 50ml of YEB (Rif 50 mg/l) liquid culture medium, and performing shaking culture at 28 ℃ until OD600 is 0.5;

(3) The bacterial liquid is divided into two 50mL centrifuge tubes (balancing), and centrifuged for 5min at 5000-6000rpm (or 4000rpm for 10min), and the supernatant is discarded;

(4) Adding 12.5ml (1/2 of the bacterial liquid) of 20mM CaCl2 into each tube to fully suspend the agrobacterium cells, and carrying out ice bath for 30min;

(5) Centrifuging at 5000-6000rpm for 5min (or 4000rpm for 10min), discarding supernatant, placing on ice, adding 6.25mL (1/4 of the bacterial solution) of pre-cooled 20mM CaCl2, suspending cells sufficiently, subpackaging 100-200 μ L per tube in 1.5mL EP tube, quickly freezing in liquid nitrogen for 1min, and storing in a refrigerator at-80 deg.C for use.

EXAMPLE 4 construction of plant expression vectors

In this example, a plasmid pBl containing a double caMV35s promoter and a SUPER promoter and having kanamycin resistance is used as an expression vector and introduced into agrobacterium tumefaciens EHA105 as a plant transformation vector for expressing an MS2 gene and RNA.

Plasmid pBl is used as a vector framework, and a synthesized MS2 phage capsid protein sequence (shown as SEQ ID NO. 2), haace1 gene sequence (shown as SEQ ID NO. 3) and HIV TAT gene sequence are cloned into plasmid pBl to construct a series of plant expression vectors. The MS2 sequence adopted is two identical copies of the capsid protein sequence of the bacteriophage, and the AB loop structural domain of the second copy of the MS2 capsid protein is fused with a TAT sequence (the protein translated by the sequence is used for protecting in vitro synthesized RNA, maintaining the stability of the RNA and helping the RNA to pass through the cell membrane and enter the cell to participate in RNAi reaction because of the property of resisting nuclease and the property of passing through the cell membrane); the TAT sequence is an amino acid sequence which is considered to have a membrane penetrating function and is derived from an HIV virus transduction domain; haace1 is an acetylcholinesterase gene of cotton bollworm, a 298bp section is selected as a stem of hairpin loop RNA, and a 203bp sequence (CCTATATAATTTTAAGTGGAAAAAAAAGGTTAACTCATTTACATATATAATCGAGAATATGTATATATATAGTGCCTCTATATCAAATTGTTTATCTGGTTTTGAGTGACACAAAATTTAAAATAATAAAGAAATTTTTGAATCTTGCAGTCAGCTGAAACAAATAAATATATTGAAACGAATAGAGTAGTACGGTCCGTACC shown as SEQ ID NO. 4) of an intron of GA20 oxidase gene from potato is used as a loop of the hairpin loop. A series of plant expression vectors were constructed: pBl121+ hpHaAce1; pBl121+ MS2; pBl121+ hpHaAce1+ MS2. As shown in fig. 1. The specific construction process is as follows:

5363 construction of a plant expression vector of pBl + hpHaAce1; the vector pBl was first digested simultaneously with restriction enzymes XbaI and XhoI at 37 ℃ for 3 hours, and the linear vector backbone was recovered and designated fragment 1. The enzyme digestion system is as follows: pET28a:10.0 mu L; xbaI and XhoI each 0.5. Mu.L; 10 × buffer 5.0 μ L; ddH2O 34.0. Mu.L.

A cotton bollworm cDNA is taken as a template, primers HaAce-F1 (5 'TCTAGAACATGAGGATCACCCATGTAAGCTTCAATGCAATATAGAGAGT 3',) and haAce1-R1 (5 'AAAATTATAGGGGATCCTACTTTCCTCTCTTCTTGATA 3',) are amplified to obtain a 298bp target sequence (the same as the system) in the Ace1 gene, the front end of the target sequence is provided with a restriction enzyme cutting site XbaI, the rear end of the target sequence is provided with a GA20 front end homologous sequence, and the fragment is named as a fragment 2.

The reverse target sequence of 298bp in Ace1 gene is obtained by amplifying primers Haace1-F2 (5 'CGGTCCGTACCAGATCTTTACTTTCCTCTTG 3',), haace1-R2 (5 'CTCGAGACATGAGGATCACCCATGTCAATGCAATATAGAGAGT 3',) (the same system is the same as the same), the front end of the reverse target sequence is provided with a digestion site of Bgl II, and the rear end of the reverse target sequence is provided with a fragment of restriction digestion site XhoI, and the fragment is named as fragment 3.

Using potato DNA as a template, and using GA20 intron primers Ace-GA20-F (5 'AAGAGAGAAGTAGTAGGATCCCTATATATAATTTTAAGTGG 3'), and GA20-Ace-R (5 'TCAAGAGAGAGAGGAAAGTAAGATCTGGTACGGACCGTACT 3'), amplification (same system as above) gave a fragment having a sequence homologous to Ace1 at one end and a Bgl II cleavage site at the other end, and this fragment was named fragment 4.

Using fragment 2 and fragment 4 as templates, the two primers Haace-F1 and GA20-Ace-R were amplified by overlap extension PCR to obtain a spliced fragment, which was named fragment 5.

The system and procedure for overlap extension PCR was as follows:

after mixing, PCR reaction was carried out:

94 ℃ for 3min;95 ℃,15s,58 ℃,15s,72 ℃,30s (1 min/kb), 35cycles; and (3) carrying out sampling and electrophoresis at 72 ℃ for 5min, observing a target band in an ultraviolet gel imaging system, and recovering a target fragment 5.

Fragment

1,3,5 was mixed in a molar ratio of 1 to 10 and ligated to support pBl at 16 ℃ as follows:

2 μ L of each of the

fragments

3 and 5 of interest

Carrier pBl1 μ L

Solution I 5μL。

Wherein, the specific volume dosage of the target fragment in the system is calculated according to the concentration of the sample, so that the dosage of the sample is in accordance with the molar ratio. After connection, escherichia coli XL10-gold is transformed, screening is carried out on a plate containing kanamycin, recombinants are preliminarily identified through enzyme digestion verification, finally the recombinants are verified through sequencing, and the correctly verified recombinants are named as pJQ14.

Then, the plasmid was transformed into Agrobacterium EHA105 competent cells and plated on YEB medium containing kanamycin, and after 12 hours, single colonies were randomly picked from the medium, inoculated into 50mg/L YEB liquid medium containing kanamycin, and cultured overnight (37 ℃ C., 220 rpm), and the cultured bacterial solution was used as a PCR template as it is.

The method for introducing plasmid DNA into Agrobacterium is as follows:

(1) electric transfer method:

2. adding 2 mul plasmid DNA into 100 mul competent cell, and gently stirring and mixing by a gun head;

3. then the glass is transferred into an electric rotating cup (no air bubble is generated), and electric shock is carried out under 2500V high voltage; ( Soaking the electric rotary cup in 75% ethanol in advance, air drying in a sterile table, pre-cooling at-20 deg.C before use, and wiping the electric rotary cup before electric shock; the voltage changes with the different gaps of the electric rotating cup, and the setting of the four stories can be directly used )

4. Taking out the electric rotating cup, adding 500 μ L of precooled YEB culture medium (containing no antibiotics), gently blowing and uniformly mixing, transferring the aspirated bacterial liquid into a 1.5ml centrifuge tube, and carrying out shake culture at 28 ℃ and 200rpm for 5h;

5. spreading 30-40 μ L bacterial solution on YEB plate containing corresponding antibiotics (50 mg/L Kan and 50mg/L Rif), and performing inverted culture at 28 deg.C for 1.5-2 days;

(2) a freeze-thaw method:

1. adding 2-10 μ L (about 1-10 μ g) plasmid DNA into 200 μ L competent cells, ice-cooling for 5min, and rapidly freezing in liquid nitrogen for 5min;

2. quickly transferring into 37 deg.C water bath, and thermally shocking for 5min;

3. adding 1mLYEB (without antibiotics) liquid culture medium, and performing shaking culture at 28 deg.C and 180-200rpm for 2-4 hr;

4. centrifuging at 3000rpm for 4min, removing part of supernatant, and collecting 200 μ L of bacterial solution and coating on YEB plate containing 50mg/L Kan and 50 mg/LRif;

5. standing for about 0.5h, and after the water content is dried, culturing at 28 deg.C for about 24 hr until colonies grow out.

The PCR reaction system is as follows:

after mixing, PCR reaction was carried out: 95 ℃ for 5min;95 ℃,30s,56 ℃,30s,72 ℃,30s,35cycles;72 ℃ for 5min.

Selecting PCR positive clone to carry out enzyme digestion and sequencing verification, screening to obtain correct monoclonal, and storing the strain with correct sequencing at-80 ℃ for later use.

Construction of pBl + MS2 plant expression vector: firstly, pBl plasmid DNA is double digested with restriction enzymes KpnI and SpeI by a general digestion method, and then the linear vector backbone is recovered and named fragment 6. A834 bp MS2 phage capsid protein sequence with two copies optimized by codons is synthesized by a third party company, primers MSF (5'-TTTccatggtgGCTTCTAACTTTACTCAGTTCGTTCTT-3') and MSR (5'-TTTggtaccTTAATAAATTCCTGAATTAGCTGCTATAG-3') are designed and amplified (the system is the same as the above), a fragment with KpnI at the front end and SpeI at the rear end is obtained, and the fragment which is recovered after double digestion by NcoI and Hind III is named as a fragment 7. The

fragment

6,7 was mixed in an amount of 1 in terms of molar ratio, ligated with Solution I enzyme, transformed into E.coli XL10-gold, screened on a kanamycin-containing plate, preliminarily identified by enzyme digestion verification, and finally verified by sequencing, and the correctly verified recombinant was named pJQ.

Subsequently, the plasmid was transformed into Agrobacterium EHA105 competent cells and spread on YEB medium containing kanamycin, and after 12 hours, single colonies were randomly picked from the medium and inoculated into YEB liquid medium containing 50mg/L kanamycin, respectively, and cultured overnight (37 ℃ C., 220 rpm), and the cultured broth was used as a PCR template as it is. And selecting PCR positive clones for enzyme digestion and sequencing verification in the same way as the PCR reaction system, screening to obtain correct monoclonals, and storing strains with correct sequencing at-80 ℃ for later use.

5363 construction of a plant expression vector of pBl + hpHaAce1+ MS 2: first, pBl + hpHaAce1 plant expression vector was digested with SpeI and XhoI, and then the hpHaAce1 fragment was recovered and named fragment 8. Next, pBl + MS2 bacterial expression vector was digested simultaneously with SpeI and XhoI, and the linear backbone was recovered and designated fragment 9. Mixing the

fragments

8 and 9 according to the molar ratio of 10 to 1, using Solution I enzyme to connect, transforming escherichia coli XL10-gold, screening on a plate containing kanamycin, verifying a recombinant preliminarily by enzyme digestion, finally verifying the recombinant by sequencing, and naming the correctly verified recombinant as pJQ.

Then, the plasmid was transformed into Agrobacterium EHA105 competent cells and plated on YEB medium containing kanamycin, and after 12 hours, single colonies were randomly picked from the medium, inoculated into 50mg/L YEB liquid medium containing kanamycin, and cultured overnight (37 ℃ C., 220 rpm), and the cultured bacterial solution was used as a PCR template as it is. And selecting PCR positive clones for enzyme digestion and sequencing verification in the same way as the PCR reaction system, screening to obtain correct monoclonals, and storing strains with correct sequencing at-80 ℃ for later use.

Example 5 preparation of plants transformed with the Nuclear genome and identification thereof

1. Reagent and Medium preparation

After sterilization, per 500ml of medium were added:

0.1mg/L NAA 1mg/ml NAA 50μL

1mg/L 6-BA 1mg/ml6-BA 500μL

YEB:

solid medium:

and adding 15g of agar powder into each liter of YEB liquid culture medium, and autoclaving.

Kanamycin (Kan) stock: 100mg/ml

Rifampin (Rif) stock: 50mg/ml

YEB solid medium plate: adding kanamycin (Kan) and rifampicin (Rif) into the sterilized YEB solid culture medium when the temperature of the YEB solid culture medium is reduced to 50 ℃ until the final concentration is 50mg/l, uniformly mixing, immediately pouring into a culture dish, and reversely storing at 4 ℃ after solidification.

2. Agrobacterium-mediated tobacco nuclear gene transformation

(1) Agrobacterium was streaked onto a plate, and a single colony was picked from the plate, inoculated into 20mL of YEB liquid medium supplemented with the corresponding antibiotic (kan 50mg/L, rif 50 mg/L), and cultured at 180r/min at 28 ℃ on a constant temperature shaker until the OD600 became 0.6-0.8 (about 17 hours).

(2) Transferring the bacterial liquid with OD600 of 0.6-0.8 in 1-2% proportion into YEB liquid culture medium without antibiotics (containing Rif), and simultaneously adding 100-500 μmol/L acetosyringone. The cells were cultured under the same conditions for about 6 hours, and then used for transformation when OD600 was 0.2-0.5.

(3) Centrifuging at 4 deg.C and 2500r/min to precipitate thallus, resuspending thallus on an ultraclean bench with 40ml MS, pouring the resuspended bacterial liquid into a glass plate, placing tobacco leaves (germinating for about one month) cut into 5 × 5mm size into the bacterial liquid, soaking for 5-30min (usually about 10 min), taking out the leaves, and placing on sterile filter paper to suck off the attached bacterial liquid.

(4) The impregnated leaves were placed on RMOP and co-cultured for 2-4 days at 28 ℃ under dark culture conditions (until a circle of Agrobacterium grows slightly around).

(5) The co-cultured explants were transferred to RMOP (Add 500mg/L carbenicillin to inhibit the growth of Agrobacterium tumefaciens) supplemented with antibiotics (100 mg/L kana) and subjected to selective culture at 25. Mu. Mol. M-2. S-1 under light.

(6) After 2-3 weeks of selection, the transformed cells of the explants will differentiate to resistant adventitious shoots or to produce resistant callus, and these resistant material will be transferred to the corresponding selection medium (RMOP +100mg/L kana +500mg/L Cb) for subculture.

(7) When the adventitious bud grows to be more than 1cm, cutting off the bud, inserting the bud into a tobacco rooting culture medium (MS +0.1mg/LNAA +100mg/L kana +500mg/L Cb) containing selective pressure to perform rooting culture, growing adventitious roots about two weeks, and performing molecular identification after the bud grows slightly.

3. Identification of Positive Nuclear transformed plants by PCR

3.1 reagent preparation:

CTAB-Extraction Buffer(100ml)：

and finally, adding beta-ME when in use, and adding the mixture according to the proportion of 1:100 (100 ml buffer added 1 ml. Beta. -ME).

3.2 Extraction of DNA by CATB method

1. About 100mg of plant leaves (thumb size) were placed in a 2ml EP tube containing three sterilized steel balls, snap frozen in liquid nitrogen, ground in a proof press, soaked in liquid nitrogen, symmetrically set out, 55HZ 40S, ground thoroughly (RNase may be in insufficiently ground sample) to prevent thawing.

2. Add 500. Mu.l CTAB extract, vortex, warm bath at 60 ℃ for 30min (mix well every ten minutes).

3. Add 200 μ l chloroform/isoamyl alcohol (24).

Centrifuging at 12000rpm at 4.4 deg.C for 10min, placing 400. Mu.l of the supernatant in a new 1.5ml EP tube, adding 360. Mu.l of isopropanol (0.8-0.9 vol.), and mixing.

Centrifugation was carried out at 12000rpm at 5.4 ℃ for 30min.

6. The supernatant was discarded, and the precipitate (0.5-1 ml) was washed 1-2 times with 70% ethanol.

7. And (4) carrying out microcentrifuge, removing supernatant, naturally drying, adding about 40 mu l of ddH2O for dissolution, measuring the concentration, and storing at-20 ℃.

3.3 PCR identification of positive plants

Using the extracted plant DNA as a template, primers HaAce1-F2 (5 'CGGTCCGTACCAGATCTTTACTCCTCCTCTTG 3'), haAce1-R2 (5 'CTCGAGACATGATGATCCCATGTCAATGCAATATAGT 3'), and PCR reaction system as follows were used to identify transgenic plants JQ 14:

The extracted plant DNA was used as a template to identify transgenic plants JQ32 and JQ44 using primers MSF (5'-TTTccatggtgGCTTCTAACTTTACTCAGTTCGTTCTT-3') and MSR (5'-TTTggtaccTTAATAAATTCCTGAATTAGCTGCTATAG-3') and the PCR reaction system was the same as above.

Example 6 qRT-PCR detection of Gene expression levels in Nuclear transferred plants

RNA is extracted, purified and reverse transcribed to obtain cDNA according to the method. Actin gene (actin) was used as an internal reference gene. The quantitative fluorescent detection was carried out by SYBR Green method using fluorescent quantitative detection kit (TB Green Premix Ex Taq) from takara.

actin upstream primer F:5'-CCTGGTATTGCTGACCGTATGC-3'

actin downstream primer R:5'-CTGTTGGAAGGTGGAGAGGGAA-3'

Ace1 gene upstream primer F5'-CAGTCAACTCCAGCTCCATAG-3'

Ace1 gene downstream primer R5'-AATAAGCCAGAACCTCCGAAG-3'

Then, PCR was performed using a fluorescent quantitative PCR apparatus (Bio-Rad), and the reaction system (10. Mu.L) was as follows:

after mixing, PCR reaction was carried out: at 95 ℃ for 30s;95 ℃,5s,60 ℃,30s,39cycles;95 ℃ for 5s;60 ℃ for 30s. When the Ace1 gene expression level is calculated, actin is used as an internal reference, and the expression level is calculated by using a standard curve method.

The experimental results are shown in FIGS. 2 and 3, and the strain with the highest expression level, namely JQ14#7 and JQ44#9, is selected for bioassay experiments.

Example 7 plant expression and detection of MS2 protein

5.1 reagent preparation:

Extraction buffer(500mL)

the pH was adjusted to 9.4 with KOH and the volume was adjusted to 500mL. Before use, every 500. Mu.L add: 2% beta-mercaptoethanol (10. Mu.L) 5. Mu.M and protease inhibitor (100mM, 10. Mu.L);

NH4Ac in methane (500 mL): 0.1M, i.e. 3.854g NH4Ac was dissolved in 500ml methanol.

5.2 the operation steps are as follows:

1) About 100mg of tobacco plant leaf (big thumb cover size) is taken and put in liquid nitrogen for quick freezing, ground in a proofing machine, soaked by liquid nitrogen, symmetrically lofted, 55HZ 40S and fully ground.

2) Add 500. Mu.L of the extraction buffer to the plant material and vortex for 30s (timed).

3) Add 500. Mu.L of phenol, vortex 30s,4 ℃,13000rpm,10min.

4) Transfer supernatant to a new EP tube.

5) Add 1mL of 0.1M NH4Ac per 200. Mu.L of extract and vortex for 10s.

6) The protein was precipitated in the lowest layer of the refrigerator.

7)13000rpm，4℃，5min。

8) Washed twice with 50. Mu.L of 0.1M NH4Ac and then dried at room temperature.

9) The resulting mixture was dissolved in 100. Mu.L of 1% SDS (60 ℃ warm bath).

10 200 μ L of the suspension was centrifuged, resuspended in 80 μ L of 1% SDS solution, and 20 μ L of 5X protein loading buffer was added and heated at 100 ℃ for 10min to prepare a protein sample, and the protein expression (MS 2-specific antibody) was detected using western blot.

The result is shown in figures 4 and 5, MS2 protein with the size of about 28kDa is accurately detected in pBl + MS2 and pBl + hpHaAce1+ MS2, the induction expression of the plant is successful, and then JQ32#4 strain with the highest expression quantity is selected for biological test experiments.

Example 8 measurement of Effect of plant expression vectors on Cotton bollworm resistance

1. Effect of plant feeding on Cotton bollworms

The cotton bollworm is fed in vitro by the tobacco leaves in the embodiment, the leaves are changed every two days, the feed is kept fresh and the humidity is moderate, and the insects in the second instar are inoculated to the tobacco leaves of the semi-living body. Culturing at 28 deg.C, 60% humidity, 14h light/10 h dark environment, recording the weight of the insect every other day, replacing fresh tobacco leaf, and feeding to pupate. And recording the weight of the worms and the pupation rate.

The weight of bollworms fed with plants expressing hpAce1 enveloped by MS2 was significantly lower than that of the control group (WT) and the treatment group fed with plants expressing hpAce1 alone (see FIG. 6, P-tress of 0.001). Phenotypic analysis revealed that the bollworms fed to plants expressing hpRNA expressing the targeted Ace1 gene grew significantly slower on day six than the control, and that the bollworms fed to plants expressing hpAce1 encapsulated by MS2 also tended to grow slower on day six than the bollworms fed to plants expressing hpAce1 alone (see FIG. 7).

2. Effect of plant feeding on bollworm Ace1 Gene expression

After feeding for 6 days, each group of worms was sampled for 5 times around the mean value, ground rapidly with liquid nitrogen, extracted for RNA, purified, and reverse-transcribed as described above to obtain cDNA. Actin gene (actin) was used as an internal reference gene. The quantitative fluorescent detection was carried out by SYBR Green method using fluorescent quantitative detection kit (TB Green Premix Ex Taq) from takara.

actin upstream primer F:5'-CCTGGTATTGCTGACCGTATGC-3'

actin downstream primer R:5'-CTGTTGGAAGGTGGAGAGGGAA-3'

Ace1 gene upstream primer F5'-CAGTCAACTCCAGCTCCATAG-3'

Ace1 gene downstream primer R5'-AATAAGCCAGAACCTCCGAAG-3'

Then, PCR was performed using a fluorescence quantitative PCR apparatus (Bio-Rad), and when the Ace1 gene expression level was calculated in the reaction system (10. Mu.L) as described above, the expression level was calculated using actin as an internal reference and a standard curve method.

The Ace1 gene expression level of adults feeding with plants expressing MS2-hpAce1 is significantly lower than that of a control group (as shown in FIG. 8, P < -0.05), which indicates that the RNA delivery mode can significantly degrade the mRNA of the Ace1 gene.

The results show that the feeding of the transgenic plant expressing the targeted Ace1 gene hpRNA can obviously inhibit the cotton bollworm Ace1 gene, and can effectively influence the growth of the cotton bollworm and inhibit the pupation of larvae.

The above description is only for the purpose of illustrating the preferred embodiments of the present invention and is not to be construed as limiting the invention, and any modifications, equivalents and improvements made within the spirit and principle of the present invention are intended to be included within the scope of the present invention.

Sequence listing

<110> university of Hubei

<120> method for preparing transgenic plant transformed with cell nucleus expressing virus-like particle and its use in resisting bollworm

<160> 4

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1488

<212> DNA

<213> Ace1 Gene cDNA

<400> 1

aagtcgacgc gtggttcggc attccttacg ctcaaaaacc tgtaggtgac ttgagattta 60

gacaccccag accagcggaa agttggggtg atgaaatact gaatactacg acactgccac 120

actcatgcgt ccaaattata gatactgtgt tcggtgattt tcctggagcg atgatgtgga 180

atcccaacac agatatgcag gaagactgtc tgtttattaa catagtgacg ccaagaccac 240

gacccaaaaa cgcagctgtt atgctttggg tcttcggtgg tggattttac tcaggaacgg 300

ctactttaga tgtttatgat ccgaaaattc ttgtgtcaga agagaaagtt gtttacgttt 360

caatgcaata tagagtagcg tctcttggtt ttctattctt tgatactccc gacgttccag 420

gcaatgccgg tctttttgat cagcttatgg cattgcaatg ggtaaaagat aacatagctt 480

acttcggagg aaatccccat aacataactt tattcggtga gtcggctggg gcagcatcag 540

tatctttaca tctattgtcc cctattgtcc cctctgtcaa ggaacttgtt ttctcaagcg 600

ataatgcaat caggagcggc taccgcacct tgggctatta tatcaagaga ggaaagtatt 660

ttgagaggaa ttcgtttagc cgaagctgtt cactgtccgc attctagaac agatatgggg 720

ccgatgatcg agtgcctcag gaagaagagt cctgatgaac tagtcaacaa cgagtggggc 780

actctcggca tttgtgaatt tcctttcgtc ccgataatag acggttcatt cttagacgag 840

ttacctgtta gatccttagt tcaccagaac tttaagaaga ccaatatttt gatgggatca 900

aacacagagg agggttatta ctttatactt tattacttaa ctgaattgtt ccccaaagag 960

gagaatgttg gaattagtag ggagcagtac ttgcaggcag tgagggaatt gaacccctat 1020

gtgaatgacg ctggacgaca agctattgtt ttcgagtaca ctgactggtt gaatcccgaa 1080

gaccctataa agaatcgaaa tgctctggat aaaatggtgg gtgattacca ctttacgtgt 1140

ggagtgaacg aatttgcgca tcgttatgca gagactggaa acaatgtttt cacatattat 1200

tacaagcatc ggagcaagaa caacccctgg ccctcgtgga caggagtgat gcacgctgac 1260

gaaatcaatt acgtattcgg agaacccttg aacccaggga agaattattc tcccgaggaa 1320

gtggaattta gtaagcgact aatgagatat tgggcgaact tcgcgagaag cggaaaccca 1380

tctataaacc cgagtggaga ctcaacgaag atcaattggc cggtgcacac ggcgtccggg 1440

cgtgaatacc tgtccttagc agtcaactcc agctccatag gccacggg 1488

<210> 2

<211> 834

<212> DNA

<213> MS2

<400> 2

ggccttaaga tggcttctaa ctttactcag ttcgttctcg tcgacaatgg cggaactggc 60

gacgtgactg tcgccccaag caacttcgct aacggggtcg ctgaatggat cagctctaac 120

tcgcgttcac aggcttacaa agtaacctgt agcgttcgtc agagctctgc gcagaatcgc 180

aaatacacca tcaaagtcga ggtgcctaaa gtggcaaccc agactgttgg tggtgtagag 240

cttcctgtag ccgcatggcg ttcgtactta aatatggaac taaccattcc aattttcgct 300

acgaattccg actgcgagct tattgttaag gcaatgcaag gtctcctaaa agatggaaac 360

ccgattccct cagcaatcgc agcaaactcc ggcatctacg caagcaattt cacacaattt 420

gtactggtgg ataacggagg ttatggcagg aagaagcgga gacagcgacg aagaggtacc 480

ggggatgtaa cggtagctcc tagtaatttt gcaaatggcg tagcagagtg gataagtagc 540

aatagtagat ctcaagcgta taaggttacg tgcagtgtaa ggcaatcaag tgcacaaaac 600

aggaagtata ctattaaggt agaagttccg aaggtcgcga ctcaaacagt cggaggcgtg 660

gaattgccag tggctgcctg gagaagctat ttgaacatgg agcttacgat acctatattt 720

gcgaccaata gcgattgtga actcatagtc aaagctatgc agggactgct gaaggacggt 780

aatccaatcc caagcgcgat agctgcgaat tcagggattt attaagggcc cgct 834

<210> 3

<211> 298

<212> DNA

<213> HaAce1

<400> 3

caatgcaata tagagtagcg tctcttggtt ttctattctt tgatactccc gacgttccag 60

gcaatgccgg tctttttgat cagcttatgg cattgcaatg ggtaaaagat aacatagctt 120

acttcggagg aaatccccat aacataactt tattcggtga gtcggctggg gcagcatcag 180

tatctttaca tctattgtcc cctattgtcc cctctgtcaa ggaacttgtt ttctcaagcg 240

ataatgcaat caggagcggc taccgcacct tgggctatta tatcaagaga ggaaagta 298

<210> 4

<211> 203

<212> DNA

<213> GA20

<400> 4

cctatataat tttaagtgga aaaaaaaggt taactcattt acatatataa tcgagaatat 60

gtatatatat agtgcctcta tatcaaattg tttatctggt tttgagtgac acaaaattta 120

aaataataaa gaaatttttg aatcttgcag tcagctgaaa caaataaata tattgaaacg 180

aatagagtag tacggtccgt acc 203

Claims

1. A method of producing a transgenic plant transformed by a nucleus expressing a virus-like particle, comprising: performing recombinant expression on the virus capsid protein and the hpRNA of the pest-inhibiting key gene in a plant by an agrobacterium-mediated cell nucleus transformation technology to obtain a transgenic plant for expressing recombinant virus-like particles; the Ace1 gene of the key gene for inhibiting the cotton bollworm is shown as SEQ ID NO. 3; the viral capsid proteins include the MS2 bacteriophage capsid protein and the transmembrane peptide TAT; the virus capsid protein is MS2 capsid protein with 2 copies, and a transmembrane peptide sequence TAT is fused in the AB loop structural domain of the MS2 capsid protein with the second copy, and the whole sequence is shown in SEQ ID NO. 2.

2. A method of making a cotton bollworm resistant plant as claimed in claim 1 wherein: the recombinant expression of viral capsid protein and hpRNA of key gene for inhibiting cotton bollworm in plant is carried out by agrobacterium mediated cell nucleus transformation technology.

3. A method of producing a cotton bollworm resistant plant as claimed in claim 1, characterized in that: the plant comprises tobacco.

4. A method of producing a cotton bollworm resistant plant as claimed in claim 1, characterized in that: the method for introducing the target gene into Agrobacterium includes any one of an electric transformation method and a freeze-thaw method.

5. A method of producing a cotton bollworm resistant plant as claimed in claim 1, characterized in that: the plasmid pBl121 is used as an expression vector to construct a plant vector for expressing hpRNA of Ace1 gene shown in SEQ ID NO.3 and MS2 virus capsid protein shown in SEQ ID NO.2, and the plant vector is transformed into tobacco leaves to be cultured to obtain the cotton bollworm resistant plant.

6. Use of a transgenic plant produced by the method of any one of claims 1 to 5 for producing a plant resistant to Helicoverpa armigera.