KR101519077B1 - Transformed Plants with Resistance to Cucumber mosaic virus - Google Patents

Abstract

The present invention relates to a transgenic plant having resistance to cucumber mosaic virus (CMV) and a method for producing the same.
The present invention induces RNA interference targeting the 3 ' terminal untranslated region, which is highly homologous between the CMV segmental genomes RNA 1, 2 and 3 and is important for viral replication, resulting in higher specificity for the target virus And can be used as an effective CMV resistance-enhancing composition that inhibits expression more broadly.
The cucumber mosaic virus (CMV), which is a resistant target of the present invention, has the broadest host range among plant viruses and can cause systemic infection of about 800 kinds of plants in a non-permanent manner by aphids. The present invention relates to a broad range of flowers and representative food crops Can be greatly contributed to the improvement of the productivity.

Description

Transformed Plants with Resistance to Cucumber mosaic virus < RTI ID = 0.0 >

The present invention relates to a method for imparting resistance to CMV by inducing RNA interference targeting a specific gene region of cucumber mosaic virus (CMV) and a CMV resistant transgenic plant produced using the method.

About 2,000 species of plant viruses have been reported worldwide, and about 120 species of plant viruses have been reported in Korea. Plant viruses cause disease in many plants and cause severe economic damage throughout agricultural production including degradation of various crops and crops, deterioration of quality and degradation of varieties. In recent years, as international trade volume of food and various plants has increased, foreign plant viruses that have not existed in the country have been infiltrated and the damage caused by them has been increasing. Therefore, the prevention, treatment and quarantine of viruses on cultivated plants is an important task in agriculture.

Cucumber mosaic virus (Cucumber mosaic virus, CMV) is representative of a flower or vegetable in the world as pathogens sikilsu systemic infection in the plant of about 800 species of a non-persistent manner by aphids as a virus having the widest host range of plant viruses It is one of the important viruses that cause economic loss to crops. CMV is a representative virus belonging to the genus Bromoviridae and Cucumovirus. It is in the form of segmental genomes of RNAs 1, 2 and 3, and the 3 'terminal untranslated region is highly homologous in particular among virus isolates.

RNAi using siRNA (small interfering RNA) is one of the common defense systems for viruses, and siRNA is a fragment of 21-23 nucleotides that allows recognition and destruction of specific sequences of infecting viral genes. This mechanism is also used to identify gene function by transiently silencing specific target mRNA by injecting synthetic siRNA into mammalian cells. Recently, a method of expressing siRNA in mammalian cells using plasmid DNA has been developed, but stable siRNA-mediated gene silencing has not yet been actively performed in plants. Thus, an effective strategy for the specific and stable regulation of gene expression in plants is highly desired in agriculture.

In the present invention, siRNA (short interfering RNA) containing a partial sequence of CMV was prepared using RNA interference (RNA interference), and a method for CMV-resistant plant breeding was developed. In particular, since the present invention targets CMV having the widest host range, it has an advantage that it can be applied to the production of transgenic plants for all crops that can be infected with CMV.

Numerous papers and patent documents are referenced and cited throughout this specification. The disclosures of the cited papers and patent documents are incorporated herein by reference in their entirety to better understand the state of the art to which the present invention pertains and the content of the present invention.

The present inventors have made extensive efforts to produce transgenic plants resistant to cucumber mosaic virus (CMV), which have a wide host range and cause enormous economic losses by infecting various edible crops. As a result, it has been found that when siRNA (small interfering RNA) that causes RNA interference targeting a specific gene sequence of a CMV gene is used, CMV is highly efficiently suppressed in the plant, thereby completing the present invention.

Accordingly, an object of the present invention is to provide a nucleotide encoding siRNA (short interfering RNA) that induces RNA interference against cucumber mosaic virus (CMV).

Another object of the present invention is to provide a nucleic acid encoding a nucleic acid comprising (a) a nucleotide encoding an siRNA that induces RNA interference against said CMV; (b) a promoter that is operatively linked to the nucleotide and forms RNA molecules in plant cells; And (c) a recombinant vector for plant expression comprising a poly A signal sequence which acts on the plant cell to cause polyadenylation of the 3'-terminal of the RNA molecule, a plant cell and plant transformed with the recombinant vector for plant expression .

It is another object of the present invention to provide a method for producing cucumber mosaic virus (CMV) resistant transgenic plants.

Other objects and advantages of the present invention will become more apparent from the following detailed description of the invention, claims and drawings.

According to one aspect of the present invention, there is provided a nucleic acid comprising (a) a nucleotide sequence consisting of the nucleotide sequence of SEQ ID NO: 1; (b) a nucleotide consisting of an inverted repeat sequence of SEQ ID NO: 1; And (c) coding for short interfering RNA (siRNA) inducing RNA interference against cucumber mosaic virus (CMV) comprising a nucleotide consisting of a loop sequence located between the nucleotide of (a) and the nucleotide of (b) Nucleotides.

The present inventors have made extensive efforts to produce transgenic plants resistant to cucumber mosaic virus (CMV), which have a wide host range and cause enormous economic losses by infecting various edible crops. As a result, we found that CMV is highly efficiently suppressed in plants when siRNAs (small interfering RNAs), which cause RNA interference by targeting specific gene sequences of CMV genes, are used.

As used herein, the term " RNA interference " refers to a phenomenon in which double-stranded RNA (double-strand RNA) injected into a cell is cleaved to decompose complementary intracellular RNA to ultimately inhibit gene expression. According to the present invention, the sequence of the 5 'terminal untranslated region of the CMV gene (target sequence) and the inverted repeat sequence of the same sequence and the loop sequence located between these sequences A hairpin structure is created. The target sequence discovered by the present inventors is the CMV strain, which is an IR (intercistronic region) region between the MP (movement protein (MP) and CP (coat protein) And all or a portion of the subgenomic promoter for expressing the CP encoded by RNA 4.

The target sequence includes a region of 1039-1175 bp, specifically 120-150 bp, more specifically 130-140 bp, and most specifically, 137 bp in length. This hairpin structure creates a partially double-stranded RNA and produces a 21-23 bp siRNA by an enzyme (dicer) that cleaves double-stranded RNA in the cytoplasm. These siRNAs cause RNA interference by degrading the intracellular RNAs in a sequence-specific manner.

As used herein, the term " loop sequence " refers to a sequence which is located between the nucleotide sequence of the first sequence of SEQ ID NO: 1 and the inverse repeat sequence thereof and induces the formation of a hair- Means the sequence at the site corresponding to the loop in the structure.

In the nucleotide sequence encoding the siRNA of the present invention, the sequence that can be used as a loop sequence may be any sequence that can form a loop structure to form a partial double bond in the nucleotide sequence of SEQ ID No. 1 and its inverse repeat sequence May be included. (I) not complementary to the nucleotide sequence of SEQ ID No. 1 and its inverse repeat sequence; (Ii) it will not be intrastrand hybridized by itself. The loop sequence of the present invention may be used without limitation for a variety of sequences commonly used in the art for the above-mentioned purposes, for example, the nucleotide sequence of pK7GWIWG2 (I), the binary sequence of Arabidopsis Approximately 644 bp corresponding to the intron nucleotide sequence (Arabidopsis database, ac007123.em_pl) can be used.

According to another aspect of the present invention, the present invention provides a method for producing cucumber mosaic virus (CMV) comprising: (a) a nucleotide encoding siRNA (short interfering RNA) inducing RNA interference against the cucumber mosaic virus (CMV) (b) a promoter that is operatively linked to the nucleotide and forms RNA molecules in plant cells; And (c) a poly A signal sequence that acts in plant cells to cause polyadenylation of the 3'-end of the RNA molecule.

As used herein, the term " operably linked " refers to a functional linkage between a nucleic acid expression control sequence (e.g., an array of promoter, signal sequence, or transcription factor binding site) and another nucleic acid sequence, The sequence will control the transcription and / or translation of the different nucleic acid sequences.

The vector system of the present invention can be constructed through various methods known in the art, and specific methods for this can be found in Sambrook et al. Molecular Cloning, A Laboratory Manual , Cold Spring Harbor Laboratory Press (2001).

The promoter suitable for the present invention may be any of those conventionally used in the art for the gene introduction of a plant, and examples thereof include SP6 promoter, T7 promoter, T3 promoter, PM promoter, corn ubiquitin promoter, A CaMV 35S promoter, a nopaline synthase (nos) promoter, a Piguet mosaic virus 35S promoter, a water crane basiliform virus promoter, a combellinella yellow mothball virus promoter, a ribovirus-l, 5-bis- (TPI) promoter, adenine phosphoribosyl transferase (APRT) promoter of Arabidopsis, and the tryptophan synthase promoter of the Arabidopsis thaliana promoter and the tryptophan synthase promoter of the Arabidopsis thaliana .

According to a specific embodiment of the present invention, the poly A signal sequence causing 3'-terminal polyadenylation according to the present invention is derived from the nopaline synthase gene of Agrobacterium tumefaciens (nos 3 'end (Bevan et al. Nucleic Acids Research , 11 (2): 369-385 (1983)), derived from the Octopine synthase gene of Agrobacterium tumefaciens, protease inhibitor I or II gene of tomato or potato , The CaMV 35S terminator and the OCS terminator (octopine synthase terminator) sequence. Most specifically, the 3'-terminal poly A signal sequence which results in polyadenylation according to the invention is the CaMV 35S terminator sequence.

According to a specific embodiment of the invention, a recombinant vector for plant expression of the invention is Agrobacterium (Agrobacterium) binary vector.

As used herein, the term " binary vector " is intended to include a plasmid having a LB (left border) and RB (right border) necessary for movement in a Ti (tumor inducible) plasmid and a plasmid having a gene necessary for transferring the target nucleotide Vector illustration. Agrobacterium tumefaciens LBA4404 can be used, for example, as long as it is suitable for expression of the nucleotide sequence of the present invention.

Methods for introducing the recombinant vectors of the present invention into Agrobacterium can be carried out through various methods known to those skilled in the art and include, for example, particle bombardment, electroporation, transfection ), Lithium acetate method, and heat shock method.

According to another aspect of the present invention, there is provided a plant cell transformed with a recombinant vector for plant expression of the present invention.

According to another aspect of the present invention, there is provided a plant transformed with a recombinant vector for plant expression of the present invention.

( Methods of Enzymology , Vol. 153, (1987)) generally known in the art in order to produce transformed cells and transgenic plants of the present invention. Plasmids can be transformed by inserting the exogenous polynucleotide into a carrier such as a plasmid, a virus, etc., and Agrobacterium bacteria can be used as a mediator (Chilton et al. Cell 11: 263: 271 (1977)), Direct exogenous polynucleotides can be introduced into plant cells to transform plants (Lorz et al. MoI Genet. 199: 178-182; (1985)).

As used herein, the term " plant (sieve) " is understood to mean not only mature plants but also plant cells, plant tissues and plant seeds that develop into mature plants.

The transgenic plants of the present invention are specifically Nicotiana and Capsicum transgenic plants, and more specifically Nicotiana benthamiana , Nicotiana tabacum and Nicotiana tabacum . Capsicum annuum transgenic plant, most specifically Nicotiana bentamiana transgenic plant.

According to another aspect of the present invention, there is provided a method of producing a cucumber mosaic virus (CMV) resistant transgenic plant comprising the steps of:

(a) introducing a recombinant vector for plant expression of the present invention into a plant cell; And

(b) obtaining a CMV resistant transgenic plant from the plant cell.

The method for introducing the recombinant vector for plant expression of the present invention into plant cells can be carried out by various methods known in the art, and specifically, it is a method of vacuum infiltration using Agrobacterium for plant transformation.

Specifically, various chemical regulators such as benzothiadiazole, isonicotinic acid, and salicylic acid are used to induce the expression of nucleotides contained in the recombinant vector in plants. .

The features and advantages of the present invention are summarized as follows:

(a) The present invention provides a transgenic plant having resistance to cucumber mosaic virus (CMV) and a method for producing the same.

(b) The present invention relates to a method for inducing an RNA interference phenomenon targeting a 3 'terminal untranslated region having high homology between RNA 1, 2 and 3, which is a segmental genome of CMV, And can be used as an efficient CMV resistance-enhancing composition that suppresses expression more broadly with high specificity.

(c) Cucumber mosaic virus (CMV), which is a resistant target of the present invention, is a pathogen that has the widest host range of plant viruses and can cause systemic infection of about 800 kinds of plants by aphids non-permanently. It can contribute greatly to productivity improvement of representative edible crops.

FIG. 1 is a schematic diagram showing the nucleotide sequence of the IR site of fny-CMV genomic RNA 3, compared with six other CMV strains, and showing the positions of the genes and primers used for the present study. In particular, the upstream primer (UP, 1039-1059nt) and the downstream primer (DN, 1153-1175nt) were selected among the nucleotide sequences of fny-CMV RNA3 and used in the present invention.
FIG. 2 is a schematic diagram of a CMV-RNAi vector (pCIR) using a CMV-IR gene and a hair pin structure predicted therefrom.
3 is a diagram showing a vector (pK7GWIWG2 (I), 0) used in the present invention.
Figure 4 is a representation of transformed T1 line # 5 showing CMV resistance (28 dpi). When CMV was inoculated into Wt-SamsunNN, severe mosaic symptoms were observed in the upper leaves (no arrows), but CMV-induced symptoms were not observed in other transgenic tobacco.
FIG. 5 is a graph showing the results of assaying CMV resistance by RT-PCR (A), Western blotting (B), and Northern blotting (C). RT-PCR (A) and Western blotting (B) were performed on transgenic tobacco and wt-tobacco leaves using CMV specific primers and antibodies. EF1a was used as a loading control and a 1 kb (+) DNA ladder was used as a DNA marker. In addition, Northern blotting was performed to isolate siRNA from plants and confirm RNA degradation (C).

Hereinafter, the present invention will be described in more detail with reference to Examples. It is to be understood by those skilled in the art that these embodiments are only for describing the present invention in more detail and that the scope of the present invention is not limited by these embodiments in accordance with the gist of the present invention .

Example

Experimental Method

 Virus source

Fny-CMV, a representative species of CMV, was purchased from the PVGB (Plant Virus GenBank, accession number PV-0001) of Seoul Women's University and purchased from Nicotiana tabacum cv. Seven days after inoculation of SamsunNN tobacco virus, CMV symptoms were confirmed. The CMV thus grown was used as a virus source of the present invention.

 Primer production

CMV has segmented genomic RNAs 1, 2 and 3 in the form of positive-sense genomic RNA, specifically IR (intercistronic region), which is a non-translated region between RNA (MP) and CP (coat protein, CP) IR) region is highly homologous to the nucleotide sequences of virus isolates (FIG. 1). In order to express CP, sub-genomic RNA is transcribed from RNA 3, where IR is a site containing a promoter for CP expression and is an important site for viral pathogenicity. The upstream primer (attCMVIR-F) used in this study contained 1039-1059nt (NC_001440, fny-CMV RNA3) of the RNA3 IR portion as 5'- GGGGACAAGTTTGTACAAAAAAAGCAGGCTAT ACAGTAGACATCTGTGACGCG-3 ', and the downstream primer attCMVIR-R ) Contains 1153-1175nt (NC_001440, fny-CMV RNA3) as the 5'- GGGACCACTTTGTACAAGAAAGCTGGGTT CGCGGAGAAGCAT CCATGAGAA-3 ', which is designed to amplify a gene of about 137 bp in size. In order to facilitate cloning, a gateway sequence was inserted at both ends (the gateway sequence is italicized and underlined) (Table 1). CMV-specific primers and internal control primers for RT-PCR for CMV resistance assays in transgenic plants are shown in Table 1 below.

 RT-PCR

Fny-CMV infected N. tabacum cv. Total RNA was extracted from 1 g of SamsunNN tobacco leaf using a Trizol reagent (Invitrogen, USA) and reacted with SuperScript ^TM III reverse transcriptase (Invitrogen, USA) and designed downstream primer for 1 hour at 42 ° C using 100 ng of RNA 1 ^st cDNA was synthesized. For the 2 ^nd PCR, 10 pM upstream primer and downstream primer, 0.2 mM dNTP mix, 1 u Ex-Taq polymerase and the buffer solution were added and denatured at 95 ° C for 2 min. 20 sec, 55 캜 for 20 sec, and 68 캜 for 1 min, and the reaction was terminated at 68 캜 for 10 min to complete RT-PCR. A PCR product of about 198 bp was amplified and sequenced to further verify it. As a result, the nucleotide sequence of CMV containing the gpu sequence of about 198 bp was confirmed (additional sequence of CMV-specific sequence 137 bp + additional sequence for gateway-forward direction + additional sequence 30 bp for gateway-reverse direction)

 Cloning

The pK7GWIWG2 (I), 0 vector used at this time was purchased from Invitrogen Co., USA. And the kanamycin antibiotic resistance gene in the LB (left border) and the RB (right border), and the CMV gene was cloned in the inverted repeat structure in the direction of the intron centering on the intron (FIGS. 2 and 3) . For cloning, the IR gene of CMV RNA3 was cloned into the pDONR207 vector with a gateway system (Invitrogen Co.), and an entry vector was created. Using this vector, the destination vector pK7GWIWG2 (I) Lt; / RTI > RT-PCR was performed to confirm that the gene was cloned in each position. Finally, an RNAi vector of inverted repeat structure was constructed and named pCIR (Fig. 2).

 Transgenic Tobacco Production

For transformation, the pCIR vector was transformed into Agrobacterium tumefacience 'LBA4404' and co-cultured with the leaf tissue of N. tabacum 'SamsunNN' to insert the target gene into the plant. The co-cultivated plant tissues were then seeded on callus and seeds in MS medium containing kanamycin (100 ug / ml), Cefotaxime (250 ug / ml), NAA (0.1 mg / Shooting was induced and MS medium for rooting (0.00875 mg / l of IAA, 0.03 mg / l of kinetin, 0.001 mg / l of folic acid, 250 ug / ml of cytotoxicity, 100 μg / ml of kanamycin Each transformant was taken out of the cabin and maintained in a greenhouse maintained at 26 ° C and seeded with T1 seeds. In this experiment, resistance to CMV was evaluated using T1 lines.

 Northern blotting

Total RNA was extracted from 1 g of transformed T1 cigarette inoculated with Trizol reagent (Invitrogen, USA) and the same amount of 10% PEG8000 and 1M NaCl was added to separate and purified the siRNA. These siRNAs were electrophoresed with 1X TBE on a 15% PAGE containing 7M Urea, and then transferred the siRNAs to the nylon membrane in the gel. Cross-linking was performed to immobilize the siRNAs in the membrane and the membrane was allowed to stand at 45 ° C for 1 hour with 10 mL of pre-heated hybridization buffer (Ambion, USA), followed by CMV specific probe, Hybridization. After washing the membrane, the membrane was washed with DIG-specific antibody and incubated with CSPD solution (Roche, USA) after incubation at room temperature with DIG-labeled antibody. And

Experiment result

Evaluation of resistance to CMV in transgenic tobacco

The CMV RNAi vector (pCIR) developed in this study was tested for resistance to CMV. For this purpose, eight transgenic tobacco line T1 lines were selected on MS medium containing kanamycin, and four transgenic tobacco plants showed no disease or delayed symptom of CMV. Among them, CMV No symptoms were seen. In the wild - type tobacco ( N. tabacum cv. SamsunNN), symptoms were observed in the upper leaves from the 7th day of CMV inoculation, and thereafter severe mosaic symptoms were found in the upper leaves. However, in the transgenic tobacco T1 line (# 5), no significant symptoms were observed by CMV after 4 weeks of inoculation (FIG. 4).

Cause of resistance: CMV RNA degradation due to induction of sequence-specific inhibition by hairpin RNA

In order to investigate the cause of resistance, RNA was extracted from the tops of three lines of transformed tobacco that were resistant to CMV infection as described above. RT-PCR was performed using CMV specific primers (Table 1). As a result, PCR products were confirmed by CMV in Wt-SamsunNN plants, while no band was observed in transgenic tobacco (left side in FIG. 5). In addition, Western blotting using CMV antibody did not detect CMV in the transgenic tobacco (right side (B) of FIG. 5). These results suggest that CMV can not be transmitted to CMV resistant transformed tobacco. In order to confirm the resistance by degradation of RNA through hairpin RNA, siRNA was isolated from virus inoculated leaves and Northern blotting was performed using CMV specific probe. As a result, CMV specificity of 21-24 nt in transgenic tobacco SiRNAs were detected (right side (C) in Fig. 5). These results suggested that CMV RNA was degraded by RNA interference induced by sequence specific silencing by hairpin RNA.

The results of the studies described above show that the RNA interference effect through hairpin RNA is effective for the growth of plant virus resistance plants and the pCIR carrier for CMV which directly or indirectly damages many flower, vegetable crops, fruit and high value- , It is thought that one vector will have a complete resistance effect on CMV in various plants. The system constructed in the above study suggests a new possibility approach to the development of various plant virus resistant crops by using RNAi vectors with low controversial risk of transformation.

While the present invention has been particularly shown and described with reference to exemplary embodiments thereof, it is to be understood that the same is by way of illustration and example only and is not to be construed as limiting the scope of the present invention. Accordingly, the actual scope of the present invention will be defined by the appended claims and their equivalents.

references

1. RT-PCR detection and identification of three species of cucumoviruses with a genus-specific single pair of primers: Choi SK, Choi JK, Park WM and Ryu KH. J. Virol. Methods. 83 (1-2): 67-73 (1999).

2. Duan CG, Wang CH, Fang RX and Guo HS, Artificial MicroRNAs. J. Virol. 82 (22): 11084-95 (2008).

3. Hu Q., Niu Y., Zhang K., Liu Y. and Zhou X., Virus-derived transgenes expressing hairpin RNA to give imuunity to Tobacco mosaic virus and Cucumber mosaic virus. Virol J. 27: 8-41 (2011).

4. Karimi M., Inze D. and Depicker A., GATEWAY vectors for Agrobacterium-mediated plant transformation. Trends Plant Sci. 7: 193-195 (2002).

<110> Seoul Women's University Industry-University Cooperation Foundation <120> Transformed Plants with Resistance to Cucumber Mosaic Virus <160> 2 <170> Kopatentin 1.71 <210> 1 <211> 137 <212> DNA <213> cucumber mosaic virus <400> 1 acagtagaca tctgtgacgc gatgccgtgt tgagaaggga acacatctgg ttttagtaag 60 cctacatcat agttttgagg ttcaattcct cttactccct gttgagcccc ttactttctc 120 atggatgctt ctccgcg 137 <210> 2 <211> 644 <212> DNA <213> Artificial Sequence <220> <223> loop sequence <400> 2 gctgttatgt tcagtgtcaa gctgacctgc aaacacgtta aatgctaaga agttagaata 60 tatgagacac gttaactggt atatgaataa gctgtaaata accgagtata aactcattaa 120 ctaatatcac ctctagagta taatataatc aaattcgaca atttgacttt caagagtagg 180 ctaatgtaaa atctttatat atttctacaa tgttcaaaga aacagttgca tctaaacccc 240 tatggccatc aaattcaatg aacgctaagc ttaatatgac tctcaataaa gtctcatacc 300 aacaagtgcc accttattca accatcaaga aaaaagccaa aatttatgct actctaagga 360 aaacttcact aaagaagacg atttagagtg ttttaccaag aatttctgtc atcttactaa 420 acaactaaag atcggtgtga tacaaaacct aatctcatta aagtttatgc taaaataagc 480 ataattttac ccactaagcg tgaccagata aacataactc agcacaccag agcatatata 540 ttggtggctc aaatcataga aacttacagt gaagacacag aaagccgtaa gaagaggcaa 600 gagtatgaaa ccttacctca tcatttccat gaggttgctt ctga 644

Claims (6)

(a) a nucleotide consisting of the nucleotide sequence of SEQ ID NO: 1; (b) a nucleotide consisting of an inverted repeat sequence of SEQ ID NO: 1; And (c) coding for short interfering RNA (siRNA) inducing RNA interference against cucumber mosaic virus (CMV) comprising a nucleotide consisting of a loop sequence located between the nucleotide of (a) and the nucleotide of (b) Nucleotides.
(a) a nucleotide encoding siRNA (short interfering RNA) that induces RNA interference against the cucumber mosaic virus (CMV) of the first paragraph; (b) a promoter that is operatively linked to the nucleotide and forms RNA molecules in plant cells; And (c) a poly A signal sequence that acts on plant cells to cause polyadenylation of the 3'-end of the RNA molecule.
3. The recombinant vector according to claim 2, wherein the plant expression vector is an Agrobacterium binary vector.
A plant cell transformed with the recombinant vector for plant expression according to claim 2 or 3.
delete A method for producing a cucumber mosaic virus (CMV) resistant transformant plant comprising the steps of:
(a) introducing a recombinant vector for plant expression according to the above item 2 or 3 into a plant cell; And
(b) obtaining a CMV resistant transgenic plant from the plant cell.

Images