CN113045631B - Preparation method of plastid-transformed transgenic plant expressing virus-like particles and application of plastid-transformed transgenic plant in cotton bollworm resistance - Google Patents

Abstract

The invention belongs to the technical field of biology, and particularly relates to a preparation method of a plastid-transformed transgenic plant expressing virus-like particles and application of the plastid-transformed transgenic plant in cotton bollworm resistance. Firstly, a plastid transformation tobacco expression vector is constructed, transgenic tobacco is obtained through plastid transformation, southern Blot detects the positive of the transgenic tobacco and achieves homogenization, and then Western Blot successfully detects that the MS2 bacteriophage capsid protein is efficiently expressed in the tobacco. The technical scheme of the invention effectively improves the resistance of the plant to the cotton bollworm, inhibits the growth and pupation of the cotton bollworm, and obviously reduces the target gene Ace1 in a treatment group, thereby indicating that the successful application of the virus-like particle mediated RNAi can effectively improve the resistance of the plant to the cotton bollworm. The successful application of the VLP mediated RNAi molecule delivery technology in plants lays a solid foundation for the prevention and control of the cotton bollworm and provides an effective way for the prevention and control of the cotton bollworm.

Description

Preparation method of plastid-transformed transgenic plant expressing virus-like particles and application of plastid-transformed transgenic plant in cotton bollworm resistance

Technical Field

The invention belongs to the technical field of biology, and particularly relates to a preparation method of a plastid-transformed transgenic plant expressing virus-like particles and application of the plastid-transformed transgenic plant in cotton bollworm resistance.

Background

The cotton bollworm is a worldwide pest and is one of agricultural pests which are the most harmful to China. More than 200 plants are harmed, and bacillus thuringiensis (Bt) is widely used in the world to prevent and control cotton bollworms, so that the method is an environment-friendly method for preventing and controlling cotton bollworms. But also brings new problems with its widespread planting, such as emergence of resistance of pests to Bt, accelerated evolution of cotton bollworms, and the like. The insect-resistant technology developed based on RNAi gene silencing has the advantages of high sequence specificity, environment friendliness and the like, and provides a new thought and direction for pest control.

RNAi is a phenomenon of gene silencing induced by dsRNA in eukaryotes, the dsRNA is cut into 21-24nt siRNA by endonuclease Dicer, then the siRNA and some AGO protease in vivo form RNA-induced silencing complex (RISC), and then complementary mRNA is cut, resulting in the degradation of mRNA, and the gene silencing is induced. In the field of pest control, RNAi technology affects the growth of pests or kills pests by inhibiting the expression of key genes of the pests. The technology has sequence specificity, is harmless to crops, human beings and livestock aiming at a specific target site, and has great application potential.

In the past decade, significant efforts have been made to control Helicoverpa armigera using plant-mediated RNAi technology. In 2007, mao et al expressed dsRNA aiming at cytochrome P450 gene (CYP 6AE 14) in plant cell nucleus to feed cotton bollworm, detected that the transcript of CYP6AE14 gene in midgut of cotton bollworm is reduced and the growth of cotton bollworm is delayed, in the research of cotton bollworm resistance through plant-mediated RNAi, different subject groups also reported that aiming at different target genes, the expression of corresponding genes can be inhibited, and the transgenic plant has a certain degree of resistance to cotton bollworm; in addition, ni et al report that the plant resistance to insects can be further improved and the rate of evolution of resistance to Bt by cotton bollworms can be delayed by polymerizing RNAi and Bt in cotton.

Although plant nuclear transgene-mediated RNAi technology has achieved significant success in pest management, its pest-resistance is less than ideal for Bt-based crops. The possible reasons for this are: (1) since insects lack RNA-dependent RNA polymerase (RdRP), RNAi anti-insect effect will depend on uptake of dsRNA dose, however the amount of dsRNA expressed by nuclear transformation is not high enough to elicit a significant RNAi response by the target pest. (2) As the plant has an RNAi pathway, dsRNA expressed in the plant can be processed into siRNA by Dicer of the plant, and the siRNA produced by the plant has poor effect on resisting insects. Thus reducing the insect-resistant effect as a whole. Therefore, increasing the expression level of the insecticidal dsRNA in plants and improving the stability thereof in plants would be a strategy to effectively improve the insect-resistant effect.

In 2015, zhang et al proposed an insect-resistant technology through plastid-mediated RNAi, which bypassed traditional nuclear genetic transformation and achieved ideal insect-resistant effect by transforming plant plastids to express insecticidal dsRNA against essential genes of pests. Provides a new thought and direction for the research of plant insect-resistant biotechnology. The plastid is a special organelle of the plant and is a general term of plastids such as proplast, chloroplast, leucoplast, amyloplast and the like, wherein the chloroplast is an important production source for photosynthesis of the plant, the plastid genome is relatively small, the size is 120-200kb, and the plastid mainly encodes genes related to photosynthesis, transcription, translation and the like. Plastid gene expression has obvious prokaryotic characteristics, and the genes are arranged in clusters and co-expressed in a polycistronic form. The genetic manipulation (plastid genetic engineering) of plastid genome was started in the early 90 s, and the genetic manipulation (plastid genetic engineering) of plastid genome was firstly successful in tobacco, which is different from the traditional plant cell nuclear transformation mode (general agrobacterium-mediated, random insertion of T-DNA into the nuclear genome of plants), and plastid transformation is realized by site-specific integration of exogenous genes into plastid genome by means of homologous recombination and a particle gun method. The utilization of aadA as a screening marker gene can greatly improve the plastid transformation efficiency. The advantages over conventional nuclear transformation techniques are: (1) the expression quantity of the exogenous gene is high. The plastid genome exists in a plant cell in a multi-copy mode, 1900-5000 parts of plastid genome can be contained in a mature plant mesophyll cell, and the plastid genome is the main reason for over-expressing a target gene; (2) and (3) co-transformation of multiple genes. The structure and the expression mode of the plastid gene are similar to those of prokaryotes, and the plastid genome is small, so that the genetic operation is facilitated, and the common expression of multiple genes can be realized; (3) the environmental safety is high. Most angiosperm plastid inheritance is inherited to offspring through a maternal line, the pollen (male gamete) of the transformed plant does not contain transgenic ingredients, and plastid transgenes cannot be spread along with the pollen, so that the risk of field diffusion of the transgenic plant pollen is reduced, and ecological stability is facilitated; (4) the plastid gene expression has no gene silencing phenomenon. Exogenous genes are integrated in a specific genome position of a plastid at a fixed point through homologous recombination, and the exogenous genes have no gene expression position effect caused by random insertion of T-DNA, and can be uniformly expressed in a plastid transgenic system because epigenetic regulation such as methylation, acetylation, histone modification and the like does not exist in the expression of the plastid genes and the gene silencing phenomenon is not generated; (5) the gene expression product is regionalized. The plastid has a relatively independent genetic system, has complete inner membrane and outer membrane barriers, and the expression product of the target gene is regionalized in the plastid, so that the high-level gene expression product has small influence on the physiological functions of other organelles of the plant.

In summary, the problems of the prior art are as follows:

the cotton bollworm is a lepidoptera pest and is not sensitive to RNAi. The possible factors of influence are currently considered to be: firstly, the method comprises the following steps: the stability of dsRNA/AmiRNA is related to the activity of RNase and physiological pH, and is quickly degraded in the midgut of cotton bollworm. Secondly, the method comprises the following steps: dsRNA/AmiRNA is difficult to efficiently enter Helicoverpa armigera midgut tissue cells. Thirdly, the steps of: after entering midgut tissue cells, dsRNA/AmiRNA is captured by lysosomes in large quantities and cannot effectively trigger systemic RNAi. Fourthly: RNAi efficiency is limited by the insufficient systemic transmission of RNAi and insufficient transmission of silencing signals among cells. Thus, the expression of dsRNA/AmiRNA in plants against Helicoverpa armigera by means of RNAi is greatly restricted.

Disclosure of Invention

Aiming at the problems in the prior art, the invention provides a preparation method of a plastid-transformed transgenic plant expressing virus-like particles and application thereof in resisting cotton bollworm, aiming at resisting the cotton bollworm by expressing virus-like particles MS2 and insecticidal amiRNA aiming at insect essential genes in plastid. Provides a new effective method for plant protection and prevention and control of lepidoptera pests.

Against the possible influencing factors mentioned in the background, we constructed a complex of MS2-TAT-RNA co-expression, thereby protecting RNA from nuclease degradation and enhancing the transmembrane efficiency of RNA. And the high-efficiency expression of the complex in the plant is enhanced through plastid transformation so as to enhance the insect-resistant effect of RNAi in the plant.

The invention is realized by a preparation method of a plastid-transformed transgenic plant for expressing virus-like particles, which is obtained by recombining and expressing virus capsid protein and AmiRNA of a target gene in the plant through plastid transformation.

The invention also provides the application of the preparation method in preparing cotton bollworm resistant plants.

The invention also provides a preparation method of the plant for resisting the cotton bollworm, which is obtained by recombining and expressing the virus capsid protein and the AmiRNA of the key gene for inhibiting the cotton bollworm in the plant through plastid transformation.

Further, the key gene for inhibiting the cotton bollworm comprises an Ace1 gene.

Further, the viral capsid proteins include the MS2 bacteriophage capsid protein and the transmembrane peptide TAT.

Furthermore, the virus capsid protein sequence is an MS2 capsid protein sequence with 2 copies, and a transmembrane peptide sequence TAT is fused in the AB loop structural domain of the MS2 capsid protein with the second copy, and the whole sequence is shown in SEQ ID NO. 4.

Further, the plant comprises tobacco.

Further, the transformation comprises plastid transformation mediated by a gene gun.

Further, a plant vector expressing the AmiRNA of the Ace1 gene and the MS2 virus capsid protein shown in SEQ ID No.4 is constructed by taking plasmid pYY as an expression vector, and is transformed into tobacco leaves through a gene gun, and the cotton bollworm resistant plant is obtained through culture.

The invention also provides application of the transgenic plant prepared by the preparation method of the cotton bollworm resistant plant in cotton bollworm resistance.

A method of protecting a plant against cotton bollworm by expression of a virus-like particle mediated RNAi delivery system in the plant comprising: the preparation of plasmid transformed related technology and transgenic tobacco for expressing recombinant virus-like particle;

the recombinant virus-like particle protein expression comprises: cloning a capsid protein sequence CP of an MS2 virus, a transmembrane peptide TAT, a packaging sequence pac site of an MS2 bacteriophage and an AmiRNA sequence of a key gene for inhibiting pests into YY12 by taking YY12 as a vector framework to construct a series of plant expression vectors; expression of the recombinant protein in plants by plastid transformation;

further, the transformation method of the transgenic plant is as follows:

the transgenic plant is tobacco (Nicotiana tabacum), and tobacco seeds are cultured under the aseptic condition. The culture conditions are as follows: the temperature is 25 ℃/20 ℃, the illumination period is 16h illumination/8 h darkness, and the light intensity is 50-150 muE. Then, 2-4 tender tobacco leaves are taken and laid on a culture medium plate. After pretreatment of gold powder and DNA wrapping, the tobacco leaves were bombarded with a gene gun. Cutting and decomposing the leaf blade until the regeneration bud is generated, then only using a selective medium to carry out positive bud screening, and detecting the positivity and homogenization by Southern Blot to obtain the transformed tobacco.

Further, the preparation method of the bollworm Ace1 gene AmiRNA comprises the following steps: amiRNA is obtained by nested PCR from the skeleton of pre-miR159 of Arabidopsis thaliana, an expression cassette is formed by combining a Prrn-SD promoter and a TrrnB terminator, the expression cassette is connected to a plasmid pYY12 with a spectinomycin expression cassette, and the AmiRNA of the Ace1 gene is expressed in a plant through plastid transformation.

The use of a method for the resistance of transgenic tobacco to Helicoverpa armigera, which is plastid transformed to express RNAi mediated by virus-like particles as described above, for the resistance to Helicoverpa armigera.

Further, the application is manifested by the growth and development delay and/or death of the cotton bollworm.

Further, the use is manifested by inhibition of the growth and/or pupation and/or lethality of cotton bollworms.

Further, the use appears to be effective in protecting plants to some extent.

In summary, the advantages and positive effects of the invention are:

the Escherichia coli MS2 bacteriophage belongs to positive single-stranded RNA spherical virus, the genome has a full length of 3659bp, 4 protein molecules such as coded mature enzyme protein, coat protein, replicase protein, cracking protein and the like are encoded, each MS2 bacteriophage contains 180 copies of coat protein, one copy of mature protein and a positive icosahedron wrapping one molecule of RNA. In early phage studies, it was found that 5' end of phage replicase gene has a stem-loop region (pac) consisting of about 21 nucleotides, and binding of phage coat protein dimer to this stem-loop structure not only initiates the assembly of coat protein itself, but also the process of coating whole phage genome RNA with coat protein. The TAT polypeptide is a nucleotide sequence derived from the transduction domain of the HIV virus, and its display on the surface of the phage particle helps to cross the cell membrane. The mature virus-like particle can prevent degradation of the dsRNA by dnase and RNase by encapsulating the RNA into the phage particle via the pac site. TAT helps the virus-like particles to cross the cell membrane thereby ensuring that the dsRNA enters the bollworm cell, causing an effective RNAi response.

According to the invention, a plastid transformation tobacco expression vector is firstly constructed, transgenic tobacco is obtained through plastid transformation mediated by a gene gun, the positive property of the transgenic tobacco is detected through Southern Blot, homogenization is achieved, and then the efficient expression of MS2 bacteriophage capsid protein in the tobacco is successfully detected through Western Blot. The technical scheme of the invention effectively improves the resistance of the plant to the cotton bollworm, inhibits the growth and pupation of the cotton bollworm, detects the obvious down-regulation of the objective gene Ace1 in a treatment group through qRT-PCR, and shows that the successful application of virus-like particle mediated RNAi can effectively improve the resistance of the plant to the cotton bollworm. The successful application of the VLP-mediated RNAi molecule delivery technology in plants lays a solid foundation for the prevention and control of cotton bollworms and provides an effective way for the prevention and control of cotton bollworms.

Drawings

FIG. 1 is a vector diagram of a plant expression vector provided by the present invention;

FIG. 2 is a structural diagram of southern blot detection;

FIG. 3 is a graph of Southern Blot positive for detection of plastid transformed plants and homogeneity;

FIG. 4 is a western blot of plastid transformation plant expression vectors induced expression of the MS2 phage capsid protein;

FIG. 5 is a diagram showing the structure of Northern hybridization experiments;

FIG. 6 is a Northern Blot of plasmid-transformed plant expression vector induced expression of AmiAChE 1;

FIG. 7 is a graph showing weight changes of cotton bollworms;

FIG. 8 is a phenotype plot of Heliothis armigera on day seven;

FIG. 9 is a diagram of pupation of cotton bollworm at day 14;

FIG. 10 is a graph showing the Ha-Ace1 gene expression level in Helicoverpa armigera detected by qRT-PCR;

FIG. 11 shows the construction of pYY plasmid and the structure of the vector.

Detailed Description

In order to make the objects, technical solutions and advantages of the present invention more apparent, the present invention is further described in detail below with reference to examples, and the equipment and reagents used in the examples and test examples are commercially available without specific reference. The specific embodiments described herein are merely illustrative of the invention and are not intended to be limiting.

Various modifications to the precise description of the invention will be readily apparent to those skilled in the art from the information contained herein without departing from the spirit and scope of the appended claims. It is to be understood that the scope of the invention is not limited to the procedures, properties, or components defined, as these embodiments, as well as others described, are intended to be merely illustrative of particular aspects of the invention. Indeed, various modifications of the embodiments of the invention which are obvious to those skilled in the art or related fields are intended to be covered by the scope of the appended claims.

For a better understanding of the invention, and not as a limitation on the scope thereof, all numbers expressing quantities, percentages, and other numerical values used in this application are to be understood as being modified in all instances by the term "about". Accordingly, unless expressly indicated otherwise, the numerical parameters set forth in the specification and attached claims are approximations that may vary depending upon the desired properties sought to be obtained. At the very least, each numerical parameter should at least be construed in light of the number of reported significant digits and by applying ordinary rounding techniques. In the present invention, "about" means within 10%, preferably within 5% of a given value or range.

The genes, proteins or fragments thereof involved in the present invention may be naturally purified products, or chemically synthesized products, or produced from prokaryotic or eukaryotic hosts (e.g., bacteria, yeast, plants) using recombinant techniques.

The invention screens lethal gene Ace1 gene based on cotton bollworm transcriptome data, MS2 armored RNA technology and transmembrane property of TAT polypeptide, designs plant expression vector, develops a preparation method of plastid transformed transgenic plant expressing virus-like particles and application thereof in resisting cotton bollworm, and is concretely shown in the following embodiment. The strains involved in the invention comprise: escherichia coli (Escherichia coli) XL10-Gold. Vector for MS2 capsid protein expression: plasmid pYY which contains NtaccD promoter and has spectinomycin resistance is an expression vector as a plant vector for expressing MS2 protein and RNA. Example 1 obtaining of the bollworm Ace1 Gene

1. Design of specific primer of bollworm Ace1 gene

An upstream primer F:5'-acccatgtaagcttCAATGCAATATAGA-3', SEQ ID No.1;

a downstream primer R:5'-cgtaccagatctTACTTTCCTCTCT-3', SEQ ID No.2.

2. Obtaining of Cotton bollworm mRNA

2.1. Obtaining materials: and selecting the cotton bollworm adults with good growth, and immediately freezing the cotton bollworm adults by liquid nitrogen.

2.2. Total RNA extraction: the total RNA of the cotton bollworm is extracted by adopting an RNAioso Plus reagent of TaKaRa, and the main steps are as follows:

1) One adult is taken and put in liquid nitrogen for quick freezing, and ground in a proofing machine.

2) Adding 1ml takara RNAioso Plus, shaking up quickly, vortexing for about 18s, and standing at room temperature for 10min for full lysis.

3) Add 200. Mu.l chloroform, mix well, stand on ice, centrifuge at 12000rpm for 15min at 4 ℃.

4) About 400. Mu.l of the upper colorless aqueous phase was transferred to a new tube.

5) Repeat 4-5 times, extract several times with chloroform.

6) Adding equal volume of isopropanol, mixing gently, standing at-20 deg.C for 10min, centrifuging at 12000rpm for 10min, and discarding supernatant.

7) The precipitate was washed with 1ml of 75% ethanol, allowed to stand on ice for 2min, centrifuged at 7500rpm for 5min at 4 ℃ and the supernatant was discarded.

8) And (4) carrying out microcentrifugation, sucking away residual alcohol by using a gun head, and drying.

9) Drying the precipitate at room temperature, adding 30-50 μ l DEPC water or (RNase free H in kit) ₂ 0) And dissolving at room temperature, and measuring the concentration by using an enzyme-free gun head.

3. Reverse transcription reaction

3.1 residual genomic DNA removal

Prepare the following mixture in RNase free centrifuge tube, gently blow and mix with a pipette. Incubate at 42 ℃ for 2min.

3.2 preparation of reverse transcription reaction System (20. Mu.L System)

2 xHifair was directly added to the reaction tube in the step 1 ^TM II Supermix plus, gently pipetting and mixing.

3.3 reverse transcription Programming

The above mixture was incubated according to the following procedure.

After reaction, the mixture can be stored at the temperature of minus 80 ℃ for a long time after being split and packaged.

4. Specifically amplified Ace1 gene and validation thereof

The cotton bollworm cDNA is taken as a template, the designed primers are used for forming a pairing primer, and PCR reaction is carried out, wherein the reaction system is as follows:

after mixing, PCR reaction was carried out:

94 ℃ for 3min;95 ℃,15s,58 ℃,15s,72 ℃,30s (1 min/kb), 35 cycles; and (3) carrying out sampling and electrophoresis at 72 ℃ for 5min, and observing a target band in an ultraviolet gel imaging system.

And recovering the target fragment, and sending the PCR product to a company for sequencing to obtain a cotton bollworm cDNA sequence shown in SEQ ID NO. 3.

EXAMPLE 2 construction of plant expression vectors

In this example, plasmid pYY12 containing prrn promoter and having ampicillin resistance was used as an expression vector, and as a plant vector for expressing MS2 gene and RNA. Plasmid pYY is a previous scientific research In our laboratory, published In 2017 as In vivo Assembly In Escherichia coli of Transformation Vectors for Plastic Genome Engineering In journal Frontiers In Plant Science, the construction and vector structure of which are shown In FIG. 11 and can be obtained according to the general methods In the art shown In FIG. 11.

The plasmid pYY12 is used as a vector skeleton, and the synthesized capsid protein sequence (SEQ ID NO. 4) of the Escherichia coli MS2 bacteriophage is cloned into the plasmid pYY to construct a series of plant expression vectors. The adopted MS2 sequence is two identical copies of capsid protein sequences of Escherichia coli, and a TAT sequence is fused in the AB loop structural domain of the second copy of the MS2 capsid protein (the protein translated by the sequence is used for protecting in vitro synthesized RNA, maintaining the stability of the RNA and helping the RNA to pass through a cell membrane to enter cells to participate in RNAi reaction due to the property of resisting nuclease and the property of passing through the cell membrane); the TAT sequence is an amino acid sequence from the transduction domain of the HIV virus (SEQ ID NO. 5) which is thought to have a membrane-penetrating function; haace1 is the acetylcholinesterase gene of Helicoverpa armigera. A series of plant expression vectors were constructed: pYY12+ MS2; pYY12+ amiHaAce1; pYY12+ amiHaAce1+ MS2. The Haace1 gene sequence is shown in SEQ ID NO.6. As shown in fig. 1. The specific construction process is as follows:

first, the vector pYY12 was digested simultaneously with restriction enzymes XbaI and XhoI at 37 ℃ for 3 hours, and the linear vector backbone was recovered, and this fragment was named fragment 1. The enzyme digestion system is as follows: pYY12:10.0 mu L; xbaI and XhoI each 0.5. Mu.L; 10 × buffer 5.0 μ L; ddH2O 34.0. Mu.L.

5363 construction of a plant expression vector of pYY + amiHaace 1: haace1 uses the skeleton of pre-miR159 of Arabidopsis thaliana, and the 113bp recombinant pre-miRNA (SEQ ID NO. 19) is achieved by overlap extension PCR.

The system and procedure for overlap extension PCR was as follows:

after mixing, PCR reaction was carried out: 94 ℃ for 3min;95 ℃,15s,58 ℃,15s,72 ℃,30s (1 min/kb), 35 cycles; and (3) carrying out loading and electrophoresis at 72 ℃ for 5min, observing a target band in an ultraviolet gel imaging system, recovering a target fragment and naming the target fragment as a fragment 2.

Wherein, the specific volume dosage of the target fragment in the system is calculated according to the concentration of the sample, so that the dosage of the sample is in accordance with the molar ratio.

The primers are as follows:

AmiAce-F1(SEQ ID NO.7，5’CCCTCTAGAACATGAGGATCACCCATGTGGGTGAGAATCTGCATGTTTAAGCTGAT3’)

AmiAce-R1(SEQ ID NO.8，5’CGGATTTCGTGTTTGTTGGTTCGGTCTTTTTGATCAGCTTAAACATGCAGA 3’)

AmiAce-F2(SEQ ID NO.9，5’AACCAACAAACACGAAATCCGTCTCATTTGCTTATTCGGT 3’)

AmiAce-R2(SEQ ID NO.10，5’CTCGAGGGGTGAAGAGCTGATGTTTAAGCTGTACAATAAGACCGAATAAGCAAAT3’)

fragment 2 is a fragment which has a pac site and a restriction enzyme site Xba I at the front end and a restriction enzyme site Xho I at the rear end. Fragment 1 was double-digested with restriction enzymes Xba I and Xho I to give a digested product with sticky ends which was recovered and named fragment 3. Mixing the fragments 1 and 3 according to the molar ratio of 1 to 10, using Solution I enzyme to connect, transforming escherichia coli XL10-gold, screening on a plate containing ampicillin, preliminarily identifying the recon through enzyme digestion verification, finally verifying the recon through sequencing, and naming the recon verified to be correct as pJQ.

5363 construction of plant expression vector pYY + MS 2: firstly, double enzyme digestion is carried out on pYY12 plasmid DNA by restriction enzymes NcoI and Hind III by a general enzyme digestion method, a linear vector skeleton is recovered and named as a fragment 4, a section of 834bp codon optimized MS2 phage capsid protein sequence is synthesized by a third party company, and a primer is designed

MSF (SEQ ID NO.11, 5'-GGATCCGCTTCTAACTTTACTCAGTTCGTTCTCGTCGACAATGGCGGAACTG-3') and

the MSR (SEQ ID NO.12, 5'-AAGCTTacatgggtgatcctcatgtCCTATAGTGAGTCGTATTATTAGTAGATGCCGGA-3') was amplified (as before) to obtain a fragment with NcoI at the front end, T7 promoter and pac site at the rear end, and HindIII at the rear end, and the desired fragment was recovered by double digestion with NcoI and HindIII and named fragment 5. The fragment 4,5 was mixed in an amount of 1 in terms of molar ratio, ligated with Solution I enzyme, transformed into E.coli XL10-gold, screened on a plate containing ampicillin, preliminarily identified by enzyme digestion verification, and finally verified by sequencing, and the correctly verified recombinant was named pJQ.

Construction of pYY + AmiHaAce1+ MS2 plant expression vector: first, pYY + MS2 plant expression vector was digested simultaneously with Hind III and XhoI, and the large fragment backbone was recovered and named fragment 6. Then, a fragment having a restriction site HindIII at the front end of Haace1-preami RNA and a restriction site XhoI at the rear end thereof was amplified using primers Ami-Ace-F1 (SEQ ID NO.13,5 'CCCAAGCTGGGTGAGAACTGCATGTTTTA3') and Ami-Ace-R1 (SEQ ID NO.14,5 'CCCTCGAGGGTGAAGAGCTGAT3') as a template. After recovering the PCR product, the PCR product was digested with HindIII and XhoI, and the digested product was recovered and named fragment 7. Mixing the fragments 6 and 7 according to the molar ratio of 1.

EXAMPLE 3 preparation of plastid transformed plants

1. Preparing plant materials:

culturing tobacco seeds in sterile environment at 25 deg.C/20 deg.C for 16 h/8 h dark with light intensity of 50-150 μ E. When the plants reached a height of 1/2 to 1/3 of the bottle, 2-4 of the youngest leaves were taken and placed on RMOP (antibiotic free) plastic plates (plates are thinner approximately 30ml of medium) with stomatal side up.

2. Preparing a gene gun: the gene gun is adopted, and the main steps are as follows:

1) The vacuum pump of the particle gun was turned on half an hour before use (the gas pressure was adjusted to 1350 psi);

2) A large glass plate after sterilization; absolute ethyl alcohol; each gun: 1 rupturable membrane (1100 psi) and 7 microslips; 1 barrier net per plasmid;

3) The splittable membrane (no more than 1 min), the microlaborder (5 min), the arresting net and the gene gun parts (5 min) were washed with absolute ethanol and then allowed to air dry.

3. Gold powder pretreatment and DNA wrapping (n bombardment), the following operations were performed on ice:

3.1 materials and reagents: 2 ice bath boxes, absolute ethanol (GR or chromatographic grade), sterile ultrapure water, n × (1.4-1.5) mg gold powder (n × 175 μ l) 2.5M CaCl2, (n × 35 μ l) 0.1M spermidine (free base, tissue culture grade, split-packed, -20 ℃ storage), sterilized tips (3 sizes) and 1.5ml EP tubes.

3.2 gold powder treatment:

1) Adding 600-1150 μ l of anhydrous ethanol into the weighed gold powder, and vortexing for 1min;

2) Microcentrifugation at 5000rpm, and ethanol was aspirated with a 200. Mu.l gun;

3) 1ml of sterile ultrapure water is added for resuspension;

4) Microcentrifuge at 5000rpm and aspirate water with a 200. Mu.l gun.

3.3 DNA encapsulation:

1) Add nx175 ul water, resuspend gold powder with 200ul gun;

2) Subpackaging into 1.5ml EP tube nx172 mul;

3) After adding 20. Mu.g of DNA thereto, vortex;

4) 175 μ l 2.5m CaCl2, vortex;

5) 35 μ l 0.1M spermidine, vortex; (addition in the above order, not to be reversed);

6) Resuspend on ice for 10min every 1min;

7) Micro-centrifuging at 3500rpm, and removing supernatant by using a 200-microliter gun;

8) Washing with 600 μ l of anhydrous ethanol, centrifuging at 5000rpm, removing supernatant with 200 μ l of gun, and washing again;

9) Resuspend with 50. Mu.l absolute ethanol.

3.4 bombardment with a Gene gun:

1) Putting into a breakable membrane;

2) Placing a barrier net;

3) Placing the micro-slide into a red plastic cup for fixing;

4) Uniformly coating the DNA-coated gold powder on the center of each micro-slide, and coating 6.5 mu l of each micro-slide;

5) Assembling a gene gun;

6) Putting the flat plate paved with the tobacco leaves into a gene gun, and closing a plastic door;

7) Turn on the vacuum button (middle button, press to top) until the pressure reaches 27.5inches Hg, press the vacuum button quickly to bottom (not to pause in the middle);

8) Press fire key (third button) quickly, do not loose hand, until the breakable membrane breaks;

9) Pressing the vacuum button to the middle to restore the air pressure to 0 and taking out the flat plate;

10 Plasmid name, pressure, marked on the plate. If the same plasmid is bombarded again, the same arresting net can be used again, as long as it is switched to the opposite side. At the end of bombing: closing the helium pressure valve to reduce the pressure to 0; the gene gun and vacuum pump were turned off.

3.5 screening of Positive shoots

The bombarded tobacco leaf sample can be stored for 0-2 days before cutting.

1) Place 2-3 sheets of sterile filter paper on a thin plate without antibiotic, move the leaves onto sterile filter paper, cut She Ziqie into 5mm long strips with a sterile scalpel, then cut into 5x 5mm, place the cut in RMOP plate (MS +0.1mg/L NAA +1 mg/L6-BA +500mg/L spec) containing spectinomycin (stomatal facing down) using sterile forceps, ensure complete contact of the sample with the medium, take care of the labeling (including plasmid name and date).

2) And (3) culture environment:

culturing tobacco seeds in a sterile environment: 25 ℃/20 ℃; the illumination period is as follows: 16h of light/8 h of dark; light intensity: 25 muE; there is no moisture in the lid.

3) After the regenerated shoots were produced, the shoot-bearing parts were transferred to rooting medium containing spectinomycin (MS +0.1mg/L NAA +500mg/L spec), and the leaves were cut and placed on RMOP plates containing spectinomycin (additional 2-4 screens to achieve homogenization) and containing spectinomycin and streptomycin (MS +0.1mg/L NAA +500mg/L spec +500mg/L strep), respectively (to identify positive shoots).

Example 4 Southern blot detection of plastid transformed transgenic plants for positivity and homogenization

1. Reagent preparation:

SouthernⅠ：0.25mol/L HCl；

SouthernⅡ：0.5mol/L NaOH；

SouthernⅢ：0.5mol/L NaOH，1.5mol/L NaCl；

southern IV: 1mol/L Tris-HCl,3mol/L NaCl, and adjusting the pH value to 6.5 by using concentrated hydrochloric acid;

20 XSSC: 3mol/L NaCl,0.3mol/L sodium citrate (sodium citrate), adjusting pH to 7.0 with concentrated hydrochloric acid;

cold washing liquid: 2 XSSC, 0.1% SDS;

hot washing liquid: 0.1 XSSC, 0.1% SDS;

maleic acid buffer: 0.1mol/L Maleic acid,0.15mol/L NaCl, pH adjusted to 7.5 with NaOH (S) (about 8g NaOH per liter of buffer) (20 ℃);

washing buffer solution: adding 0.3% (V/V) Tween20 (20 ℃ C.) to the maleic acid buffer;

detection buffer solution: 0.1mol/L Tris-HCl,0.1mol/L NaCl, pH adjusted to pH =9.5 (20 ℃) with concentrated hydrochloric acid;

southern kit: DIG High Prime DNA Labeling and Detection Starter Kit I (Roche);

tube No. 1: DIG-High prime (dispensed 2. Mu.L each and stored at-20 ℃ C.).

Tube No. 4: anti-Digoxigenin-AP Conjugate (antibody capable of binding digoxin and coupled with alkaline phosphatase which can catalyze a substrate (first generation: fifth tube) to turn into blue, (second generation: fifth tube) to be developed under AI 600) is taken out of the No.4 tube, centrifuged at 4 ℃ for 5min at 10000g, subpackaged and stored in a refrigerator at 4 ℃;

tube No. 5: generation: NBT/BCIP (substrate) (stored at-20 ℃ C.). The second generation: subpackaging and storing at 4 deg.C refrigerator.

Tube No. 6: 10 × Blocking Solution (stored at-20 deg.C) (i.e., 10 × Blocking Solution). It was diluted 1 x with maleic acid buffer before use.

Tube No. 7: DIG Easy Hyb (stored at-20 ℃ C.). 64mL ddH2O was added to the mixture in two portions and shaken at 37 ℃.

2. Preparation of digoxin-labeled probe:

2.1 PCR amplification was carried out using the total DNA of tobacco as a template and probe-specific primers, and PCR products were recovered from the gel (note that the concentration recovered was at least 70 ng/. Mu.L).

The PCR procedure was as follows:

step (ii) of	Temperature of	Time
			Denaturation of the material	94℃	45S
Annealing
		60℃	45S
Extension				72℃	90S

The PCR reaction was run for 30 cycles.

The primers are as follows:

pasb-F：cccagaaagaggctggccc，SEQ ID NO.20；psab-R:gcagttcccgccccttggg，SEQ ID NO.21。

2.2 taking about 0.5-1 mu g of recovered PCR product, and supplementing ddH2O to 8 mu L; then, the mixture was boiled in a water bath for 10min and immediately transferred to an ice-water mixture.

2.3 transferring the mixture into a PCR tube filled with 2 mu L of DIG-High prime, mixing uniformly, carrying out microcentrifugation, and carrying out warm bath at 37 ℃ for 10-20h; heating at 65 deg.C for 10min to terminate the reaction, and storing in-20 deg.C refrigerator for use.

3. Extraction of plant Total DNA

3.1 reagent preparation:

CTAB-Extraction Buffer(100ml)：

and finally, adding beta-ME when in use, and adding the mixture according to the proportion of 1:100 (100 mL buffer added 1 mL. Beta. -ME).

3.2, operation steps:

1) About 100mg of tobacco lamina (thumb size) was placed in a 2ml EP tube containing three sterilized steel beads, snap frozen in liquid nitrogen, ground in a proof press, soaked in liquid nitrogen, symmetrically set out, 55HZ 40S, ground thoroughly (RNase may be in insufficiently ground samples) to prevent thawing.

2) Add 500. Mu.L CTAB extract, vortex, warm bath at 60 ℃ for 30min (mix every ten minutes).

3) Add 200 μ L chloroform/isoamyl alcohol (24).

4) Centrifuge at 12000rpm,10min at 4 deg.C, and put 400. Mu.L of the supernatant into a new 1.5ml EP tube, add 360. Mu.L of isopropanol (0.8-0.9 vol.) and mix well.

5) Centrifugation was carried out at 12000rpm at 4 ℃ for 30min.

6) The supernatant was discarded, and the precipitate (0.5-1 mL) was washed 1-2 times with 70% ethanol.

7) And (4) performing microcentrifuge, removing supernatant, naturally drying, adding about 40 mu L of ddH2O for dissolution, measuring the concentration, and storing at-20 ℃.

Southern blot detection

4.1 the extracted DNA was digested overnight with the selection of the appropriate restriction enzyme.

4.2 Electrophoresis on 1% agarose gel; the sample was allowed to run out of the loading well at 30V and then continued at 50V until bromophenol blue ran to the bottom of the gel.

4.3 Wash glue

1) Washing with Southern I for 15min until bromophenol blue becomes yellow, and washing with deionized water; (depurination);

2) Washing with Southern II for 30min until bromophenol blue is completely restored to original blue, and washing with deionized water; (denaturation of DNA);

3) Washing with Southern III for 30min, and washing with deionized water;

4) Washing with Southern IV for 15min; (neutralizing the residual alkali to precipitate DNA for membrane transfer).

4.4 transfer film

Nylon membrane cut into 11.6 x 12cm size, quickly in deionized water soaking, then in 20 x SSC soaking 15min (and Southern IV washing glue). Separately, 6 sheets of 11.6X 12 cm-sized filter paper, a stack of absorbent paper of the same size, and a long filter paper were prepared.

Placing according to the sequence shown in figure 2, paying attention to the salt bridge and the glue, no air bubbles are needed between the glue and the nylon membrane and between the nylon membrane and the filter paper, arranging Parafilm around the gel to prevent short circuit, and rotating the membrane for more than 12 h.

4.5 UV crosslinking

After the film transfer is finished, the nylon film is taken out (note that the front and back sides of the nylon film are marked, and the front side is the side with DNA), and after the nylon film is dried, the nylon film is placed in a hybridization instrument for ultraviolet hybridization for 0.5min. The membrane after completion of crosslinking can be stored at 4 ℃.

4.6 prehybridization

Preheating hybridization solution (prepared by No. 7 tube) in 42 ℃ water bath, adding 10mL of the hybridization solution into the hybridization tube, and paying attention to avoid foaming as much as possible; placing the reverse side wall of the crosslinked membrane into a hybridization tube, and screwing a tube opening to prevent liquid leakage;

placing the hybridization tube in a hybridization instrument for hybridization for 12-24h at 42 ℃;

4.7 hybridization

Newly configured hybridization solution:

immediately transferring the probe into an ice bath after boiling water bath for 5min, carrying out microcentrifugation, and adding the probe into 10mL of prehybridization liquid (the probe does not touch a membrane, is carefully mixed without bubbling) by using a gun to obtain hybridization liquid; putting the hybridization tube back into a hybridization instrument at 42 ℃ for hybridization for 10-12h;

used hybridization solution:

the hybridization solution can be stored at-15 ℃ to-25 ℃, can be repeatedly used for several times, needs to be denatured again for 10 minutes at 68 ℃ in advance before each use, and then is placed in a water bath at 42 ℃;

4.8 Wash Membrane

Washing the membrane with cold washing solution twice on a shaking table for 5min each time; preheating the hot washing liquid to 68 ℃, and washing the membrane with the hot washing liquid twice in a 68 ℃ water bath kettle for 15min each time; washing with washing buffer for 2min; finally soaking for 3min by using maleic acid buffer solution;

4.9 blocking plus antibody

Placing 20mL of 1 × Blocking Solution (diluted by No.6 tube) in a hybridization tube, placing the reverse side wall of the membrane in the hybridization tube, sealing in a hybridization instrument at normal temperature (25 ℃) for 1h;

adding 1 μ L antibody (number 4 tube after subpackaging, in a 4 deg.C refrigerator Wu Mengting grid) into hybridization tube, and hybridizing at room temperature for 30min in hybridization instrument;

4.10 Wash antibody

Taking out the nylon membrane, and washing with washing buffer solution on a decolorizing shaker for three times, each time for 15min; after washing, soaking the membrane in a detection buffer solution for 2min;

4.11 addition of substrate

Generation: 100 μ L of substrate (i.e., tube 5) was diluted to 5mL with assay buffer and added to a large dish, and the membrane was also placed in the dish and treated overnight in the dark.

The second generation: 100 μ L of substrate (i.e., tube 5) was diluted to 5mL with assay buffer and added to a large dish, the membrane was also placed in the dish and treated in the dark for 30min (which may be prolonged).

FIG. 3 is a graph of Southern Blot showing the positive and homogeneous performance of this example in detecting plastid transformed plants.

Example 5 plant expression and detection of MS2 protein

5.1 reagent preparation:

Extraction buffer(500mL)

the pH was adjusted to 9.4 with KOH and the volume was adjusted to 500mL. Before use, every 500. Mu.L add: 2% beta-mercaptoethanol (10. Mu.L) 5. Mu.M and protease inhibitor (100mM, 10. Mu.L);

NH4Ac in methane (500 mL): 0.1M, i.e. 3.854g NH4Ac was dissolved in 500mLL methanol.

5.2 the operation steps are as follows:

1) About 100mg of tobacco plant leaf (big thumb cover size) is taken and put in liquid nitrogen for quick freezing, ground in a proofing machine, soaked by liquid nitrogen, symmetrically lofted, 55HZ 40S and fully ground.

2) Add 500. Mu.L of extraction buffer to the plant material and vortex for 30s (timed).

3) Add 500. Mu.L phenol, vortex 30s,4 ℃,13000rpm,10min.

4) Transfer supernatant to a new EP tube.

5) Add 1mL of 0.1M NH4Ac per 200. Mu.L of extract and vortex for 10s.

6) The protein was precipitated in the lowest layer of the refrigerator.

7)13000rpm，4℃，5min。

8) Washed twice with 50. Mu.L of 0.1M NH4Ac and then dried at room temperature.

9) The resulting mixture was dissolved in 100. Mu.L of 1% SDS (60 ℃ warm bath).

10 200 μ L of the suspension was centrifuged, resuspended in 80 μ L of 1% SDS solution, and 20 μ L of 5X protein loading buffer was added and heated at 100 ℃ for 10min to prepare a protein sample, and the protein expression (MS 2-specific antibody) was detected using western blot.

The results are shown in FIG. 4, MS2 protein with the size of about 28kDa is accurately detected in pYY + MS2, pYY + AmiHaAce1+ MS2, which indicates that the induced expression of the plant is successful.

Example 6 plant expression and detection of AmiRNA

6.1 reagent configuration:

the Northern Blot was performed using the following kit: DIG High Prime DNA Labeling and Detection Starter Kit II.

20 XSSC: 3M NaCl 175.5g,0.3M sodium citrate 88.23g, pH 7.0.

Maleic acid buffer: 0.1M maleic acid,0.15M NaCl (pH adjusted to 7.5,1L with about 8g solids added with NaOH).

Washing buffer solution: maleic acid buffer +0.3% tween20, which acts to remove unbound antibody.

Detection buffer solution: 0.1M Tris-HCl,0.1M NaCl, pH9.5.

DEPC H2O: after stirring overnight, sterilization (decomposition of DEPC water into carbon dioxide and water) was performed. 0.03% DEPC water was prepared by adding 0.3mL of DEPC to 1L of ultrapure water.

10 × MOPS electrophoresis buffer: after MOPS preparation, DEPC is added and stirred overnight before sterilization.

20 XSSC: after the preparation, 1L of DEPC was added to the 1L, and the mixture was stirred overnight and then sterilized.

10% SDS: it can be directly prepared, because SDS reacts with DEPC, and SDS has protein denaturation function, and can denature RNA. SDS prevents inhalation of dust and contact with skin and eyes.

Maleic acid buffer: after the preparation, DEPC is added, 1L +1mL DEPC.

Washing buffer solution: since Tween was present in the wash buffer, it was not possible to treat DEPC, and Tween was added to the sterilized maleic acid buffer.

Detection buffer solution: tris-HCl is contained in the detection buffer solution, DEPC cannot be added, and the Tris-HCl and the DEPC react.

6.2 preparation of the test devices:

the glue plates, combs and glue troughs for glue running were treated overnight with 0.5% SDS.

Sterilizing articles such as measuring cylinder, glass rod of tweezers, etc.

The plastic plates for the transfer were treated with 0.4N NaOH and washed 3 times with previously sterilized DEPC water.

The filter paper for the experiment was soaked with DEPC water and sterilized.

The method comprises the following steps: beaker, triangular flask (mixing with glue), measuring cylinder, large culture dish, glass rod, sterilized filter paper, EP tube, yellow white gun head, etc. 6.3 preparation of Formaldehyde containing gel (1.0%) and electrophoretic fluid.

1.0g agarose is weighed, added into 90mL 1 XMOPS, heated to melt, cooled to about 60 ℃, added with 10ml formaldehyde, shaken well and poured into a glue making tank.

20.9g of MOPS was dissolved in 350mL of DEPC-treated water, the pH was adjusted to 7.0 with 2M NaOH, 10mL of DEPC-treated 1M NaAc (4.10 g/50 mL) and 10mL of DEPC-treated 0.5M Na2 EDTA (9.03 g/50mL, PH8.0) were added, the volume was made 500mL with DEPC-treated water, and the mixture was filtered and sterilized.

6.4 Extraction of RNA by trizol method

1) About 100mg of plant leaves (big toe cap size) are taken and put in liquid nitrogen for quick freezing, ground in a proof press, soaked with liquid nitrogen first, and then symmetrically placed, 55HZ 40S, and fully ground (RNase may be in the insufficiently ground sample) to prevent unfreezing.

2) 1ml Trizol (takara RNAisso Plus in 4 ℃) was added, vortex 18s or so, and left on ice for 10min to lyse sufficiently, preventing thawing before adding Trizol, and taking several times a little.

3) Centrifuging, taking the supernatant, and removing large pieces which are not fully ground.

4) Adding 200ul chloroform (min), shaking slightly with force (removing protein), standing on ice, centrifuging at 4 deg.C and 12000rpm for 15min.

5) The upper colorless aqueous phase was transferred to a new tube at approximately 400ul (min). (chloroform centrifugation is divided into three layers, RNA is in the uppermost supernatant, the second thin layer is a DNA layer, and the layer is light when taken out of the centrifuge so as to prevent the substances in the tube from shaking to cause the lower layer to precipitate.

6) And (5) repeating the steps 4-5.

7) Adding equal volume of isopropanol, mixing, standing on ice for 10min, discarding supernatant

8) Washing the precipitate with 1ml 75% ethanol, bouncing the precipitate, allowing it to float in ethanol, standing for 1-2min, allowing the ethanol to contact the precipitate sufficiently, dissolving the organic reagent sufficiently, centrifuging, standing on ice for 2min, standing at 4 deg.C, centrifuging at 7500Xg for 5min, discarding the supernatant

9) Drying the precipitate at room temperature, adding 30-50ul DEPC water, dissolving at 60 deg.C, and measuring concentration.

6.5 preparation of Northern hybridization Membrane

1) RNA samples were treated for 2min at 80 ℃ before use (denaturation of normal mRNA, 10min for dsRNA).

2) Add loading buffer (2 volumes to loading), spot 30. Mu.L per lane, and run at 50V for about 2.5 hours.

3) And stopping electrophoresis when the bromophenol blue is 1-2 cm away from the front edge.

4) The loaded gel was soaked in 20 XSSC for 20 minutes, and the nylon membrane was first briefly soaked in DEPC water and then soaked in 20 XSSC for 5min.

5) The RNA was transferred to Hybond + nylon membrane by capillary elution using 20 XSSC as the membrane transfer buffer.

6) And (4) rotating the film for 16-18 hours, and after the end, reversing the film (the surface in contact with the glue), and marking the corners by using a pencil.

7) Air-drying at room temperature for more than 30 minutes, crosslinking twice with 254nm U.V after the membrane is dried, 30S each time, binding fixed RNA and the membrane, wrapping the membrane with a preservative film, and storing at-20 ℃ for later use. The block diagram is shown in fig. 5.

6.6 preparation of RNA Probe

1) Taking a target gene as an example, taking a PCR amplification target gene as a probe (the length is larger than 25bp, if the target gene is longer, one section of the PCR amplification target gene can be selected as the probe), paying attention to the recovery concentration of the gel, and taking a 1 mu g sample as a sample, wherein the sample is not more than 8 mu L;

2) Taking about 1 mu g of probe template recovered by the glue in a PCR tube;

3) Boiling water bath for 10min, and immediately transferring into ice-water mixture;

4) Adding 2 μ L of primer mixture Xin Gaoxiao (No. 1 tube), mixing, centrifuging, and bathing at 37 deg.C for 10-20h;

5) Heating at 100 deg.C for 10min to terminate the reaction, immediately cooling with ice bath, and reusing (when using second generation color development, the probe used for the first time can be slightly reduced, and the background is prevented from being too deep during color development).

6.7 Northern hybridization procedure

1) Immersing the RNA membrane in a prehybridization solution Church buffer preheated at 42 ℃ (the addition amount of the prehybridization solution is proper to just submerge the membrane), and prehybridization is carried out for 4 hours (generally, prehybridization is carried out in the morning to about 10 hours in the evening, and the purpose of prehybridization is to close the sites on the membrane which can be combined with DNA probes); adding the marked and denatured cDNA probe into the prehybridization solution, and hybridizing at 42 ℃ overnight; washing the membrane in sequence according to the following operations on the next day;

cold washing liquid 1L	Hot washing liquid 1L
		2×SSC(100ml 20×SSC)	0.1×SSC(5ml 20×X SSC)
0.1％SDS(10ml 10％SDS)	0.1％SDS(10ml 10％SDS)

(1) Cold washing: 2 XSSC/0.1% SDS (room temperature), 5 minutes X2 times.

(2) Hot washing: 0.1 XSSC/0.1% SDS (68 ℃), 15 minutes X2 times (warm washes are preheated beforehand).

(3) The buffer was washed 5min × 3 times.

(4) Soaking in maleic acid buffer solution for 3min.

2) Blocking antibodies

Sealing liquid: 10X Blocking solution was diluted to 1X with maleic acid buffer.

A20 mL of 1 Xblocking solution was placed in a hybridization tube, a nylon membrane was placed (right side up), and the tube was blocked in a hybridization apparatus at room temperature for 1 hour, and 1. Mu.l of antibody was added to 20mL of the blocking solution and the tube was left in the hybridization apparatus at room temperature for 30min.

3) Wash antibody

The nylon membrane was removed, washed with Washing buffer three times for 15min each time, and soaked in the detection buffer for 2min.

4) Adding substrate, developing

Preparing a proper amount of color developing solution according to the size of the film, wherein the preparation ratio is as follows: 100 μ L of substrate was diluted to 5mL with assay buffer. The nylon membrane is placed in a large culture dish, a developing solution is uniformly dripped on the membrane by using a 1ml gun, and the membrane is subjected to dark treatment for 30min and then developed by using a protein imager.

FIG. 6 is the Northern Blot image of AmiAChE1 expression induced by the plastid transformation plant expression vector in this example.

Example 7 determination of the Effect of plant expression vectors against Cotton bollworm

1. Effect of plant feeding on Cotton bollworms

The cotton bollworm is fed in vitro by the tobacco leaves in the embodiment, the leaves are changed every two days, the feed is kept fresh and the humidity is moderate, and the insects in the second instar are inoculated to the tobacco leaves of the semi-living body. Culturing at 28 deg.C, 60% humidity, 14h light/10 h dark environment, recording the weight of the insect every other day, replacing fresh tobacco leaf, and feeding to pupate. And recording the weight and pupation rate of the worm.

Bollworm weights fed plants expressing AmiAce1 encapsulated by MS2 were significantly lower than control (WT) (see fig. 7, p-but 0.001). Phenotypic analysis revealed that the bollworms feeding the plants expressing the targeted Ace1 gene AmiRNA grew significantly slower than the control group on day seven (see fig. 8), and the pupation rate of the bollworms feeding the plants expressing the targeted Ace1 gene AmiRNA was significantly lower than the control group on day 14 (see fig. 9).

2. Effect of plant feeding on bollworm Ace1 Gene expression

After feeding for 4 days, each group of worms was sampled for 5 times around the mean value, ground rapidly with liquid nitrogen, and RNA extracted, purified, reverse transcribed as described above to obtain cDNA. Actin gene (actin) was used as an internal reference gene. The quantitative fluorescent detection was carried out by SYBR Green method using fluorescent quantitative detection kit (TB Green Premix Ex Taq) from takara.

actin upstream primer F:5'-CCTGGTATTGCTGACCGTATGC-3', SEQ ID No.15;

actin downstream primer R:5'-CTGTTGGAAGGTGGAGAGGGAA-3', SEQ ID No.16;

the Ace1 gene upstream primer F is 5'-CAGTCAACTCCAGCTCCATAG-3', SEQ ID NO.17;

the downstream primer R of Ace1 gene is 5'-AATAAGCCAGAACCTCCGAAG-3', SEQ ID NO.18.

Then, PCR was performed using a fluorescent quantitative PCR apparatus (Bio-Rad), and the reaction system (10. Mu.L) was as follows:

after mixing, PCR reaction was carried out: at 95 ℃ for 30s;95 ℃,5s,60 ℃,30s,39cycles;95 ℃ for 5s;60 ℃ for 30s. When the Ace1 gene expression level is calculated, actin is used as an internal reference, and the expression level is calculated by using a standard curve method.

The Ace1 gene expression level of adults feeding MS2-AmiAce1 expressing plants is significantly lower than that of a control group (as shown in FIG. 10, P < -0.001), which indicates that the RNA delivery mode can significantly degrade the mRNA of the Ace1 gene.

The results show that feeding the transgenic plant expressing the targeted Ace1 gene AmiRNA can obviously inhibit the cotton bollworm Ace1 gene, and can effectively influence the growth of the cotton bollworm and inhibit the larva from pupating.

The above description is only for the purpose of illustrating the preferred embodiments of the present invention and is not to be construed as limiting the invention, and any modifications, equivalents and improvements made within the spirit and principle of the present invention are intended to be included within the scope of the present invention.

Sequence listing

<110> Hubei university

<120> preparation method of plastid-transformed transgenic plant expressing virus-like particle and application thereof in resisting cotton bollworm

<160> 21

<170> SIPOSequenceListing 1.0

<210> 1

<211> 28

<212> DNA

<213> Artificial sequence (F)

<400> 1

acccatgtaa gcttcaatgc aatataga 28

<210> 2

<211> 25

<212> DNA

<213> Artificial sequence (R)

<400> 2

cgtaccagat cttactttcc tctct 25

<210> 3

<211> 1488

<212> DNA

<213> Cotton bollworm cDNA (Cotton bollworm)

<400> 3

aagtcgacgc gtggttcggc attccttacg ctcaaaaacc tgtaggtgac ttgagattta 60

gacaccccag accagcggaa agttggggtg atgaaatact gaatactacg acactgccac 120

actcatgcgt ccaaattata gatactgtgt tcggtgattt tcctggagcg atgatgtgga 180

atcccaacac agatatgcag gaagactgtc tgtttattaa catagtgacg ccaagaccac 240

gacccaaaaa cgcagctgtt atgctttggg tcttcggtgg tggattttac tcaggaacgg 300

ctactttaga tgtttatgat ccgaaaattc ttgtgtcaga agagaaagtt gtttacgttt 360

caatgcaata tagagtagcg tctcttggtt ttctattctt tgatactccc gacgttccag 420

gcaatgccgg tctttttgat cagcttatgg cattgcaatg ggtaaaagat aacatagctt 480

acttcggagg aaatccccat aacataactt tattcggtga gtcggctggg gcagcatcag 540

tatctttaca tctattgtcc cctattgtcc cctctgtcaa ggaacttgtt ttctcaagcg 600

ataatgcaat caggagcggc taccgcacct tgggctatta tatcaagaga ggaaagtatt 660

ttgagaggaa ttcgtttagc cgaagctgtt cactgtccgc attctagaac agatatgggg 720

ccgatgatcg agtgcctcag gaagaagagt cctgatgaac tagtcaacaa cgagtggggc 780

actctcggca tttgtgaatt tcctttcgtc ccgataatag acggttcatt cttagacgag 840

ttacctgtta gatccttagt tcaccagaac tttaagaaga ccaatatttt gatgggatca 900

aacacagagg agggttatta ctttatactt tattacttaa ctgaattgtt ccccaaagag 960

gagaatgttg gaattagtag ggagcagtac ttgcaggcag tgagggaatt gaacccctat 1020

gtgaatgacg ctggacgaca agctattgtt ttcgagtaca ctgactggtt gaatcccgaa 1080

gaccctataa agaatcgaaa tgctctggat aaaatggtgg gtgattacca ctttacgtgt 1140

ggagtgaacg aatttgcgca tcgttatgca gagactggaa acaatgtttt cacatattat 1200

tacaagcatc ggagcaagaa caacccctgg ccctcgtgga caggagtgat gcacgctgac 1260

gaaatcaatt acgtattcgg agaacccttg aacccaggga agaattattc tcccgaggaa 1320

gtggaattta gtaagcgact aatgagatat tgggcgaact tcgcgagaag cggaaaccca 1380

tctataaacc cgagtggaga ctcaacgaag atcaattggc cggtgcacac ggcgtccggg 1440

cgtgaatacc tgtccttagc agtcaactcc agctccatag gccacggg 1488

<210> 4

<211> 834

<212> DNA

<213> MS2 phage capsid protein sequence (MS 2)

<400> 4

ggccttaaga tggcttctaa ctttactcag ttcgttctcg tcgacaatgg cggaactggc 60

gacgtgactg tcgccccaag caacttcgct aacggggtcg ctgaatggat cagctctaac 120

tcgcgttcac aggcttacaa agtaacctgt agcgttcgtc agagctctgc gcagaatcgc 180

aaatacacca tcaaagtcga ggtgcctaaa gtggcaaccc agactgttgg tggtgtagag 240

cttcctgtag ccgcatggcg ttcgtactta aatatggaac taaccattcc aattttcgct 300

acgaattccg actgcgagct tattgttaag gcaatgcaag gtctcctaaa agatggaaac 360

ccgattccct cagcaatcgc agcaaactcc ggcatctacg caagcaattt cacacaattt 420

gtactggtgg ataacggagg ttatggcagg aagaagcgga gacagcgacg aagaggtacc 480

ggggatgtaa cggtagctcc tagtaatttt gcaaatggcg tagcagagtg gataagtagc 540

aatagtagat ctcaagcgta taaggttacg tgcagtgtaa ggcaatcaag tgcacaaaac 600

aggaagtata ctattaaggt agaagttccg aaggtcgcga ctcaaacagt cggaggcgtg 660

gaattgccag tggctgcctg gagaagctat ttgaacatgg agcttacgat acctatattt 720

gcgaccaata gcgattgtga actcatagtc aaagctatgc agggactgct gaaggacggt 780

aatccaatcc caagcgcgat agctgcgaat tcagggattt attaagggcc cgct 834

<210> 5

<211> 33

<212> DNA

<213> TAT sequence (TAT)

<400> 5

tatggcagga agaagcggag acagcgacga aga 33

<210> 6

<211> 298

<212> DNA

<213> HaAce1 Gene sequence (HaAce 1)

<400> 6

caatgcaata tagagtagcg tctcttggtt ttctattctt tgatactccc gacgttccag 60

gcaatgccgg tctttttgat cagcttatgg cattgcaatg ggtaaaagat aacatagctt 120

acttcggagg aaatccccat aacataactt tattcggtga gtcggctggg gcagcatcag 180

tatctttaca tctattgtcc cctattgtcc cctctgtcaa ggaacttgtt ttctcaagcg 240

ataatgcaat caggagcggc taccgcacct tgggctatta tatcaagaga ggaaagta 298

<210> 7

<211> 56

<212> DNA

<213> Artificial sequence (AmiAce-F1)

<400> 7

ccctctagaa catgaggatc acccatgtgg gtgagaatct gcatgtttaa gctgat 56

<210> 8

<211> 51

<212> DNA

<213> Artificial sequence (AmiAce-R1)

<400> 8

cggatttcgt gtttgttggt tcggtctttt tgatcagctt aaacatgcag a 51

<210> 9

<211> 40

<212> DNA

<213> Artificial sequence (AmiAce-F2)

<400> 9

aaccaacaaa cacgaaatcc gtctcatttg cttattcggt 40

<210> 10

<211> 55

<212> DNA

<213> Artificial sequence (AmiAce-R2)

<400> 10

ctcgaggggt gaagagctga tgtttaagct gtacaataag accgaataag caaat 55

<210> 11

<211> 52

<212> DNA

<213> Artificial sequence (MSF)

<400> 11

ggatccgctt ctaactttac tcagttcgtt ctcgtcgaca atggcggaac tg 52

<210> 12

<211> 59

<212> DNA

<213> Artificial sequence (MSR)

<400> 12

aagcttacat gggtgatcct catgtcctat agtgagtcgt attattagta gatgccgga 59

<210> 13

<211> 30

<212> DNA

<213> Artificial sequence (Ami-Ace-F1)

<400> 13

cccaagcttg ggtgagaatc tgcatgttta 30

<210> 14

<211> 23

<212> DNA

<213> Artificial sequence (Ami-Ace-R1)

<400> 14

ccctcgaggg gtgaagagct gat 23

<210> 15

<211> 22

<212> DNA

<213> Artificial sequence (actin)

<400> 15

cctggtattg ctgaccgtat gc 22

<210> 16

<211> 22

<212> DNA

<213> Artificial sequence (actin)

<400> 16

ctgttggaag gtggagaggg aa 22

<210> 17

<211> 21

<212> DNA

<213> Artificial sequence (Ace 1)

<400> 17

cagtcaactc cagctccata g 21

<210> 18

<211> 21

<212> DNA

<213> Artificial sequence (Ace 1)

<400> 18

aataagccag aacctccgaa g 21

<210> 19

<211> 113

<212> DNA

<213> Artificial sequence (PRE-MI 164-ACE)

<400> 19

gggtgagaat ctgcatgttt aagctgatca aaaagaccga accaacaaac acgaaatccg 60

tctcatttgc ttattcggtc ttattgtaca gcttaaacat cagctcttca ccc 113

<210> 20

<211> 19

<212> DNA

<213> Artificial sequence (pasb-F)

<400> 20

cccagaaaga ggctggccc 19

<210> 21

<211> 19

<212> DNA

<213> Artificial sequence (psab-R)

<400> 21

gcagttcccg ccccttggg 19

Claims (2)

1. A method for preparing a plant resistant to cotton bollworm is characterized by comprising the following steps: recombinant expression is carried out on virus capsid protein and AmiRNA of key gene for inhibiting cotton bollworm in plants through plastid transformation to obtain the recombinant expression product; the key gene for inhibiting the cotton bollworm comprises an Ace1 gene; the virus capsid protein sequence is an MS2 capsid protein sequence with 2 copies, and a transmembrane peptide sequence TAT is fused in the AB loop structural domain of the MS2 capsid protein with the second copy, and the whole sequence is shown in SEQ ID NO. 4; plasmid pYY12 is used as an expression vector to construct a plant vector for expressing AmiRNA of Ace1 gene and MS2 virus capsid protein shown in SEQ ID NO.4, and the plant vector is transformed into tobacco leaves through a gene gun and cultured to obtain the cotton bollworm resistant plant.

2. Use of a transgenic plant produced by the method of making a cotton bollworm resistant plant of claim 1 for resisting cotton bollworms.

Images