CN110862973A - Rice thioredoxin gene OsNDU, protein, vector, host cell, molecular marking method and application - Google Patents

Abstract

The invention provides a rice thioredoxin gene OsNDU, a protein, a vector, a host cell, a molecular marking method and application. OsNDU has a nucleotide sequence shown in SEQ ID No.1, a cDNA sequence of the OsNDU is shown in SEQ ID No.2, and a protein sequence of the OsNDU is shown in SEQ ID No. 3. The scheme of the invention is a good example of the participation of the thioredoxin in the brown planthopper resistance of the rice, and has certain reference value for understanding the functions of the thioredoxin and controlling the resistance. The research of the OsNDU gene provides a good theoretical basis for the downstream molecular mechanism of the brown planthopper resistant gene of the rice, and has reference significance for researching the molecular function of the gene and breeding.

Description

Rice thioredoxin gene OsNDU, protein, vector, host cell, molecular marking method and application

Technical Field

The invention relates to the field of plant genetic engineering, in particular to a rice thioredoxin gene OsNDU, a protein, a vector, a host cell, a molecular marking method and application.

Background

Rice (Oryza sativa) is an important food crop, the planting area of which is the top of the world, Nilapavata lugens (BPH)

) Is a migratory insect pest in rice planting areas in Asian regions, and is also a main insect pest in the rice planting areas in Yangtze river basin in China and vast rice areas in the southwest and south China. The brown planthopper is harmful to rice in three ways: one is direct harm caused by sucking phloem sap of rice through a mouth needle (Wang et al, 2008; Cheng et al, 2012). And secondly, eggs are damaged, and the egg laying device is inserted into the vascular tissue of the rice by the brown planthopper to damage the transportation system of the rice. Third, rice disease is induced, such as transmission of straw dwarf and ragged stunt virus (river CT et al, 1966). Since the 21 st century, the frequency and scale of planthopper outbreaks in entire Asian rice production areas have gradually expanded, and the outbreaks have gradually become the biggest threat in rice production and are considered as the first big pests of rice (Heong)&Hardy,2009；IRRI,Annual report2011)。

In recent decades, farmers mainly rely on pesticides to control outbreaks of brown planthoppers, which cause drug resistance of the brown planthoppers and damage ecological environment. Therefore, the method for exploring the brown planthopper resistant gene of the rice, clarifying the insect-resistant mechanism and cultivating the rice variety containing the brown planthopper resistant gene is the most economic, effective and environment-friendly method for preventing and controlling the brown planthopper which is a major agricultural pest.

Thioredoxin (Trx) is a redox regulator widely found in prokaryotes and eukaryotes. They can regulate the cellular reduction/oxidation state as well as various important cellular functions such as oxidative stress defense, cell proliferation, signal transduction and transcriptional regulation, etc. (Potters G et al, 2010). To date, various studies have found that Trxs is involved in resistance responses in plants. Knocking out NTRC in Arabidopsis results in lighter leaf color and shorter plant, and mutant plants become more sensitive to oxidative stress, high salt, drought and high temperature. Arabidopsis thaliana is infected with pathogenic bacterium p.syringae, causing the expression level of Trx-h5 to be continuously up-regulated (Laloi C et al, 2004). The arabidopsis thaliana Trx-h5 protein can interact with NPR1 in cytoplasm and break disulfide bonds between NPR1 molecules to dissociate into monomers, and the monomeric form of NPR1 has the ability to enter the nucleus and interact with TGA transcription factors in the nucleus to regulate the expression of downstream PR genes (Yasuomi Tada et al, 2008). OsNDU contains a TRX-like domain, but the function of OsNDU in rice is unclear if the OsNDU has disulfide bond reductase activity.

The rice brown planthopper resistant gene Bph6 is a novel insect resistant gene, and the coded protein has no obvious structural domain and is not homologous with the protein with known functions (Guo et al, 2018). The Bph6 has broad-spectrum insect resistance, high resistance to all biotypes of brown planthopper and white-backed planthopper, and no negative effect on agronomic traits. Therefore, the Bph6 gene has important application value in brown planthopper resistant breeding of rice. OsNDU is an interacting protein of BPH6, and the function of the OsNDU in brown planthopper resistance of rice is not researched.

Disclosure of Invention

The invention aims to provide a rice thioredoxin gene OsNDU and a functional research thereof in brown planthopper resistance of rice. The gene of the present invention is derived from the genome and cDNA of Nipponbare.

In order to achieve the purpose, the technical scheme of the invention is as follows:

in a first aspect, the invention provides a rice thioredoxin gene OsNDU, according to the sequence analysis of Nipponbare in NCBI, the nucleotide sequence of the gene is shown as SEQ ID NO.1, the total length of the gene is 3291bp, and the total length of ORF is 825 bp.

It will be understood by those skilled in the art that the amino acid sequence having the same function can be obtained by substituting, deleting and/or adding one or more nucleotides to the nucleotide sequence shown in SEQ ID No.1, for example, in the context of different rice, by substituting or deleting one or more nucleotides, and the encoded amino acid sequence has no frame shift mutation, and only partial amino acid deletion or point mutation occurs. Therefore, the gene also comprises a nucleotide sequence which is obtained by replacing, deleting and/or adding one or more nucleotides in the nucleotide sequence shown in SEQ ID No.1 and has the same function.

Preferably, the cDNA sequence of the gene is shown in SEQ ID NO.2, and 275 amino acids are coded.

In a second aspect, the invention provides a protein encoded by the rice thioredoxin gene OsNDU, and the amino acid sequence of the protein is shown as SEQ ID No. 3.

It is understood that the amino acid sequence shown in SEQ ID NO.3 can be variously substituted, added and/or deleted by one or several amino acids by those skilled in the art to obtain an amino acid sequence having equivalent functions without affecting the activity of the OsNDU protein (i.e., without being in the active center of the protein).

Also encompassed within the scope of the present invention are sense or antisense sequences based on said polynucleotides, including cloning or expression vectors containing said polynucleotide sequences or fragments thereof, host cells containing said vectors, transformed plant cells and transgenic plants containing said nucleotide sequences or fragments thereof.

In a third aspect, the present invention provides a vector containing the above-mentioned rice thioredoxin gene OsNDU, characterized in that: the vector includes a cloning vector or an expression vector containing the polynucleotide sequence or a fragment thereof.

In a fifth aspect, the present invention provides a host cell containing the above-mentioned rice thioredoxin gene OsNDU, characterized in that: the host cell is a plant cell transformed with the nucleotide sequence or a fragment thereof.

In a sixth aspect, the present invention provides a transgenic material containing the rice thioredoxin gene OsNDU vector, which is characterized in that: the phenotype of the transgenic material includes a change in resistance to brown planthopper.

In a seventh aspect, the present invention provides a molecular assay method for the above-mentioned rice thioredoxin gene OsNDU, characterized in that: the screening primers are as follows:

Hyg-L, the sequence of which is shown in SEQ ID NO. 4;

Hyg-R, the sequence of which is shown in SEQ ID NO. 5;

amplifying the transgenic rice genome DNA to be detected through the primer pair, and detecting an amplification product, wherein the primer is a carrier primer: if the primers Hyg-L and Hyg-R are used for amplifying a 728bp amplified fragment, the transgenic positive plant is indicated, and if the fragment is not amplified, the transgenic negative plant is indicated.

In an eighth aspect, the invention provides an application of the molecular detection method of the rice thioredoxin gene OsNDU in brown planthopper resistant rice breeding.

Aspects of the invention also encompass a method of breeding OsNDU-overexpressing plants, comprising:

1) transforming a plant cell with the polynucleotide; the polynucleotide contains ORF of rice thioredoxin gene OsNDU, and the nucleotide sequence is shown in SEQ ID NO. 2;

2) regenerating the transformed plant cell into a plant;

3) cultivating the regenerated plant and overexpressing the polynucleotide.

Wherein the plant is a monocot; preferably, the monocot is rice.

The discovery and experiment progress of the OsNDU gene:

1) and (3) a discovery process: a rice thioredoxin gene NDU is found by screening interacting protein in a rice 9311 library against the brown planthopper resistant protein BPH 6.

2) And (3) genetic transformation verification function: the ORF full length of OsNDU is connected into a vector PCXUN containing ubi promoter, and an overexpression vector is introduced into Nipponbare by adopting an agrobacterium EHA105 mediated genetic transformation method, and finally 15 OsNDU transgenic plants are obtained.

The screening primers are respectively

Hyg-L: GCTCCATACAAGCCAACCAC (5'-3'), shown in SEQ ID NO. 4;

Hyg-R: GAAAAAGCCTGAACTCACCG (5'-3'), shown in SEQ ID NO. 5;

similarly, the RNAi vector of OsNDU is transformed into a near isogenic line of Bph6 in a Nipponbare background to obtain 18 transgenic plants. Selection was also performed with hygromycin primers.

For T₂And carrying out insect-resistant identification on transgenic plants of generations, and finding that the resistance of OsNDU overexpression plants to brown planthopper is up-regulated. The resistance of the OsNDU inhibition plant to brown planthopper is obviously reduced.

The invention has the following advantages and beneficial effects:

(1) the scheme of the invention is a good example of the participation of the thioredoxin in the brown planthopper resistance of the rice, and has certain reference value for understanding the functions of the thioredoxin and controlling the resistance.

(2) The research of the OsNDU gene provides a good theoretical basis for the downstream molecular mechanism of the brown planthopper resistant gene of rice, and has important significance for molecular breeding.

Drawings

FIG. 1 is subcellular localization, localized in mitochondria.

OsNDU carries a GFP tag, has a green fluorescent signal, and is completely coincident with the red fluorescent signal of the mitochondrial dye Mito tracker.

FIG. 2 and FIG. 3 are the group method insect resistance identification of transgenic plant in seedling stage;

wherein:

FIG. 2OsNDU overexpresses the insect-resistant phenotype of transgenic plants and recipient material;

FIG. 3 insect-resistant phenotype of OsNDU-RNAi transgenic plants and recipient material.

BPH was photographed four days after ingestion. NDU4-12 and NDU7-4, individual OsNDU overexpressing transgenic plants; ndu-5-8 And ndu-7-9, OsNDU-RNAi transgenic plants aloneStrain; nipponbare or Nip, a sensory control and an overexpressed transgene A factor receptor; Nip-Bph6-NIL, Bph6 near isogenic lines, insect-resistant controls and RNAi transgene receptors in a japanese sunny background.

FIG. 4 shows the pest resistance of transgenic plant brown planthopper honeydew and the method of insect weight gain;

wherein:

(ab) honeydew volume and insect weight gain of OsNDU overexpressing transgenic plants and recipient material;

(cd) honeydew amount and insect weight gain of OsNDU-RNAi transgenic plants and recipient material. BPH is taken two days later And (6) collecting data. Values are expressed as mean ± standard deviation. NDU4-12 and NDU7-4, OsNDU alone overexpressing transgenic plants Strain; ndu-5-8 and ndu-7-9, OsNDU-RNAi transgenic plants alone; nipponbare or Nip, sensory control and overuse An expressed transgenic receptor; Nip-Bph6-NIL, Bph6 near isogenic lines, insect-resistant controls and RNAi transgenes in the Nippon sunny background A gene receptor.

Detailed Description

The following examples further illustrate the present invention but are not to be construed as limiting the invention. Modifications or substitutions to methods, procedures, or conditions of the invention may be made without departing from the spirit and scope of the invention.

Unless otherwise specified, the technical means used are conventional means well known to those skilled in the art; the experimental procedures used are conventional and can be carried out according to the recombinant techniques already described (see molecular cloning, A laboratory Manual, 2 nd edition, Cold spring harbor laboratory Press, Cold spring harbor, N.Y.); the materials, reagents and the like used are all commercially available.

[ example 1 ] obtaining of OsNDU Gene in Rice

A thioredoxin OsNDU is found by screening interacting protein in a rice 9311 library against the brown planthopper resistant gene Bph6, and an ORF sequence and a genome sequence of the gene are obtained by amplifying cDNA of Nipponbare through a designed primer.

Example 2 subcellular localization of OsNDU Gene in Rice

Designing primers at two ends of the full-length ORF of the OsNDU gene, adding a BamHI restriction site and a protective base, recovering an amplified fragment, then carrying out restriction by using BamHI enzyme, connecting the amplified fragment into a vector PCXUN cut by using the same enzyme, wherein in GFP, a positive clone is sequenced, and plasmid extraction is carried out to determine that the positive clone is a forward connection plasmid without mutation, and the plasmid is transformed into a protoplast. The specific process is as follows:

the rice seeds are sown in 1/2MS culture medium and cultured in dark incubator at 28 deg.C for 10-12 days. Cutting about 100 seedlings into 0.5mm segments with blade, balancing in 0.6M mannitol for 10min, transferring into enzymolysis solution, dark culturing at 28 deg.C and 80rpm for 4-5 h. The reaction was terminated by adding 10ml of W5 solution to the enzymatic hydrolysate, and the protoplast suspension was obtained by filtration. Centrifuging the filtrate at 1500rpm for 3min to obtain protoplast precipitate, suspending the precipitate with W5 solution, and centrifuging at 1500rpm for 3 min. The supernatant was aspirated off, and the precipitate was suspended by adding an appropriate amount of MMG solution. Add 10 μ g plasmid, 100 μ l protoplast and 110 μ l PEG solution into 2ml centrifuge tube in turn, mix gently, place in dark culture at 28 ℃ and transform for 15-20 min. The conversion reaction was stopped by adding 440. mu.l of W5 solution to the tube, followed by centrifugation at 1500g for 3min and aspiration of the supernatant. 1ml of W5 solution was added to each tube and placed in an incubator at 28 ℃ for 16-20 hours in the dark. Cells cultured overnight were observed under a confocal laser microscope. (FIG. 1)

Example 3 construction of OsNDU Gene overexpression vector and Agrobacterium-mediated genetic transformation

Construction of OsNDU overexpression vector

The inventor designs primers by intercepting two ends of ORF of OsNDU respectively, and the sequences are as follows:

OEV-F: ATGCTGCCGCCGGCCGCC (5'-3'), shown in SEQ ID NO. 6;

OEV-R: GCAAGCATCTAGATCCCT (5'-3'), shown in SEQ ID NO. 7;

the vector used was pCXUN (provided by professor Wangganggu of Ohio State University, USA), and pCXUN vector was digested with XcmI, and the foreign fragment was added with A and ligated directly. According to the series conditions of SEQ ID No.2, ORF is directly amplified by a PCR method, and is connected with a vector after A is added. After the sequencing verification is correct, the obtained vector is the OsNDU gene overexpression vector, and the OsNDU gene overexpression vector is electrically transferred into the agrobacterium tumefaciens EHA 105. Selecting monoclonal for amplification culture, performing PCR verification, adding equal volume of 50% glycerol, mixing, and storing at-80 deg.C.

RNAi vector construction of OsNDU

Selecting a specific segment 436bp on a target gene, designing a primer for amplification, and simultaneously amplifying a PDK segment about 800 bp. The sequence of the target fragment is shown as SEQ ID NO. 8:

TTCCAATGCTTGATCTTGCCCAGCAGCAGCATGGTGGATGGGTGCCAGTTGCAGCAATGAATGCTATTGCTAAGATCGTTGAAGTTGCACCAATCAGAGTATATGAAGTTGCTACATTTTACACAATGTTTAACCGGACTAAGGTGGGTAAATATCACCTTTTGGTGTGTGGAACCACACCTTGCATGATTCGTGGTTCACGTGAAATTGAAGAAGCCTTGTTAGAACATCTTGGAGTTAAACGGAATGAGGTGACCAGTGATGGTTTATTTTCTGTTGGAGAAATGGAGTGCATGGGCTGCTGTGTGAATGCTCCCATGATTGCTGTGGCCGATTATTCTAAAGGTTCAGAGGGTTACACATACAACTATTATGAGGACCTCACTCCTAAACGAGTTGTTGAGATCGTCGAGATGCTGAAAAGAGGAGAAACCCC

the amplified target fragments are used as two arms of a stem-loop structure, and PDK is used as a loop of the stem-loop structure. An overlapping PCR reaction of the three fragments was performed. The PCR procedure was as follows:

PCR procedure: 1.94 ℃ for 3 min; 2.94 ℃ for 45 s; 3.50 ℃ for 1 min; 4.72 ℃ for 1 min; 2 to 410 cycles; 5.72 ℃ for 10 min; and adding a primer and high-fidelity enzyme.

PCR procedure: 1.94 ℃ for 3 min; 2.94 ℃ for 45 s; 3.55 deg.C for 1 min; 4.68 ℃ for 1 min; 2 to 430 cycles; 5.68 ℃ for 10 min.

And cutting the overlapped fragments into gel, recovering, adding A reaction, connecting with a PCXUN vector and transforming, extracting plasmids from positive clones which are correctly sequenced, and electrically transferring into agrobacterium EHA105 α for subsequent genetic transformation experiments.

1. Genetic transformation

The OsNDU gene overexpression vector was introduced into Nipponbare by the Agrobacterium EHA 105-mediated genetic transformation method (Hiei et al, 1994, efficiency transformation of rice (Oryza sativa L.), mediated by Agrobacterium and sequencing analysis of the nucleic acids of the T-DNA plant Journal 6:271-282), and the repression expression vector was introduced into the near isogenic line of Bph6 in Nipponbare background.

And (3) detecting the transgenic offspring by using hygromycin primers Hyg-L and Hyg-R to obtain 15 over-expression transgenic plants and 18 suppression expression transgenic plants.

Example 4 phenotypic analysis of OsNDU Gene overexpression and RNAi-inhibited expression plants

1. Seedling stage group method

About 60 seeds of the materials to be identified (OsNDU over-expression plants, OsNDU-RNAi plants, Nipponbare and a near isogenic line of Bph6 under the background of Nipponbare) are cleared, the seeds are soaked for accelerating germination and then sowed in plastic cups with the diameter of 10cm, about 20 seeds are sowed in each cup, and three cups are sowed in each material. When the seedlings grow to the three-leaf stage, seedlings with bad growth state are removed, each cup of material is respectively sleeved with a gauze bag, and 2-3-year brown planthopper nymphs are inoculated into the bags according to the number of 8 brown planthoppers per seedling. When more than 90% of the sensory controls died, the resistance rating was read for each cup of material.

When the sensory control Nipponbare had died, NDU4-12 and NDU7-4 were still alive, indicating that OsNDU overexpression increased Nipponbare (transgenic recipient) resistance (FIG. 2). When the sensory control nipponica had died, ndu-5-8 and ndu-7-9 also had approached death compared to the transgenic recipient (the near isogenic line of Bph6 in the background of nipponica), indicating that inhibition of OsNDU expression decreased the resistance of the near isogenic line (fig. 3). The results show that the OsNDU has insect resistance in positive and negative aspects.

2. Brown planthopper honeydew amount and weight gain determination

The sealing film is made into bags with proper size, each wax bag is numbered and weighed by a balance, and the wax bags are tied on the rice stems. And simultaneously, catching the newly emerged brown planthopper female adults, numbering and weighing by using a balance, and then putting into wax bags with corresponding numbers. And weighing the brown planthopper and the wax bag respectively by using balance after the brown planthopper eats for 48 hours. The difference between the two weighed weights of the wax bag was recorded as the honeydew amount of the brown planthopper, and the difference between the two weighed weights of the brown planthopper nymph was recorded as the weight gain of the brown planthopper. Each material was subjected to 30 independent biological replicates.

The feed intake of brown planthopper is inversely related to the resistance of rice, and the larger the feed intake, the weaker the resistance. The more brown planthopper takes feed, the more honeydew is excreted, the more weight is increased, and the higher the percentage of body weight is. NDU-4-12 and NDU-7-4 had reduced honeydew and insect weight gain compared to the transgenic recipient Nipponbare, indicating that OsNDU overexpression increased resistance in Nipponbare (transgenic recipient) (FIG. 4 ab). Compared with the transgenic receptor NIP-Bph6-NIL (the near isogenic line of Bph6 in the Nipponbare background), the honeydew amount and the insect weight gain of ndu-5-8 and ndu-7-9 are increased, which shows that the inhibition of the expression of OsNDU reduces the resistance of NIP-Bph6-NIL (figure 4 cd). The results show that the OsNDU has insect resistance in two aspects.

Sequence listing

<110> Wuhan university

<120> rice thioredoxin gene OsNDU, protein, vector, host cell, molecular marking method and application

<160>8

<170>SIPOSequenceListing 1.0

<210>1

<211>3291

<212>DNA

<213> Rice (Oryza sativa)

<400>1

aactccgctc ccctcccccc tcttcgcctg agtcgagtcg cctcccccac cgccggccaa 60

ccatgctgcc gccggccgcc cgcctcgcgg cccgccgcct cctagggctc gcgacctcct 120

ccgcctcgga atcggccgcg gcgcgacgct tgtcccgttc tccggtcagt gcccccctcc 180

ccctcctcca aatgcctctg tatctcctcg ctgttcgtcg gcggagcttt gccgtcctga 240

tctctccctc cgggggcaac gtctcgttgc agatctccta cgccgccgcg ggctgctcct 300

ccaggctgtt ctccacggcg cttaactacg tacgtgaggc gcctccccct tccctcggat 360

ccacccccta ccctcttccc tgatctgtct gttttgtctg aggatgataa tgagtcggat 420

ttgtgggttt gcttgttgtg cagcacctcg attcgccgga aaacaacccc gacatgccgt 480

gggagttcac ggaggccaac atgaagaagg tgctgttgtt cgtctcgttc attcatttcc 540

ctgtgattta tgttttggat tggaacagtg gctggttttg gagtagttgt ggcagaattt 600

gttcagtttt gttttcggat gttcagaaat ggctgttagg gtaccatttt attcaggact 660

attagataat aatataatct tacgttggaa ctggttgctg gttatttgag aaggggaaac 720

gttatctgtc atgtaaaacc tttagaaatg tgcaaatctg caaatgtcca aatgtaatag 780

agacgtgggg tatagtgttc tattcctttg acatgggatt taggttttgt gaatacggtt 840

tatatcaatt gtatcagcta ttttggttat ctggcctaaa atctctattt caataactaa 900

ttcaggttaa tgagatattg tctcactatc caagcaacta caagcagtct ggtattattc 960

caatgcttga tcttgcccag cagcagcatg gtggatgggt gccagttgca gcaatgaatg 1020

ctgtaagtcc cttttttatg agctttcgat gatcaactgt tttccgcctt taatgtgcta 1080

tatcctgttt tcaatacttc aattttcaga aagtgatgta cctcaacatt tgttagttgt 1140

tacaacccac gttagctata gttatattgg acttgcttag cagacattca taaatcaaaa 1200

ccttattgca ctggccttgt ttctgttcac ttcttcgtcc tactgaagat gggtgacact 1260

aggaaattag gagccttaat agtaagaggc attggagaat gggggttggc aatcacaaaa 1320

gaaaaagttc ttgtcagcat atcagttgac atatttatat aattataatt acaattgagt 1380

taatctcctc aggactagga ctattacaat aacattgcta ctgggagtgt tatagcttat 1440

gttacatttt agatattttg tacatagacc caaccaccat tccaccacca ctgtgctcac 1500

aaaaagcatt tctgacaata ctattttcat gtcttggact ttcagattgc taagatcgtt 1560

gaagttgcac caatcagagt atatgaagtt gctacatttt acacaatgtt taaccggact 1620

aaggtatctt tgcatgactt agtattttgt acttgttaat ccctccacta gcatcttttc 1680

accctatttt gccatgtagg tgggtaaata tcaccttttg gtgtgtggaa ccacaccttg 1740

catgattcgt ggttcacgtg aaattgaaga agccttgtta gaacatcttg gagttaaacg 1800

gaatggtttg tattattcac ataacttatc ctatcaacta agaataacac ttcctgattt 1860

gttaccacaa acggtcttcg agcatgtgtt tctcttgcta tctctgtgat agcattaaca 1920

tttttctttc atttgcagag gtgaccagtg atggtttatt ttctgttgga gaaatggagt 1980

gcatggtaac ttcgagatct ataattttct gtcattttgg atgcttgcaa ataggtgttc 2040

tagttgagtt aagtgtttaa ctatagccaa taggaatggt ctgtaggatt ttgtcagtga 2100

atgattcagt actctaatga aaaaacataa gtacaaggca actttttatt cagctttctg 2160

ttatatgttc acagggctgc tgtgtgaatg ctcccatgat tgctgtggcc gattattcta 2220

aaggttcaga gggttacaca tacaactatt atgtaagtat acacattgat gcatccgatt 2280

atctattgtt gatgacttat gctagtacac gcggtggaaa ttttagtaga aacatcacag 2340

cattagtaag aattagcagc tggtgcccac tcgtgttagt tcatgtttat gcacaaaatg 2400

aaacattgtc aactgaagaa tataaacttg catgttatag gatgctgggc ccctgggttt 2460

ctatacttcttagcaggcgt ctttggagaa ataatgctaa catagctaca tttttttgct 2520

aaacttccat gctatagcag tactgtggca ctgaaagcac taatgccaac agagtaacaa 2580

aagacgagtg gataaaactt aacaaaacct gcctgccttt tgctgagaga ggaagaaaag 2640

acttatttgt gtactgtaac tgagcatttc catttcccct tttcaggagg acctcactcc 2700

taaacgagtt gttgagatcg tcgagatgct gaaaagagga gaaacccctc ctgtaagctt 2760

tgctcttgaa cgaaataatt cttttgatat ttctagcgac aagttttact cagtttgatg 2820

ttatagatat caagccccac cattggttta ggttgcgaac tgattttgat gattgtgatg 2880

atttttgcag cgcggcacac aacacccaga gcggaaaaac tgtggccctg ctggagggaa 2940

taccaccttg cacggtgagc cgaaacctcc tccgtgcagg gatctagatg cttgctaggt 3000

ttgctttgaa ttacaggcac acaaataagt tgggccacac tatgattata tggtgtggaa 3060

actggaacaa agcaaggcga tgtgttgttt gtattttgat cttgttttgt ttacctctgc 3120

ccgcatcttt tttctctcct tttgcaccat cagagaaatg gtacattgat aatgacgata 3180

tgttattttg tcagctgaca tgaggcggca gtggtaaaaa gatttgtatt cgtctttcgg 3240

caaagataaa actcttggac attctctttt tgggcattcc ttttcagctt c 3291

<210>2

<211>1180

<212>DNA

<213> Rice (Oryza sativa)

<400>2

aactccgctc ccctcccccc tcttcgcctg agtcgagtcg cctcccccac cgccggccaa 60

ccatgctgcc gccggccgcc cgcctcgcgg cccgccgcct cctagggctc gcgacctcct 120

ccgcctcgga atcggccgcg gcgcgacgct tgtcccgttc tccgatctcc tacgccgccg 180

cgggctgctc ctccaggctg ttctccacgg cgcttaacta ccacctcgat tcgccggaaa 240

acaaccccga catgccgtgg gagttcacgg aggccaacat gaagaaggtt aatgagatat 300

tgtctcacta tccaagcaac tacaagcagt ctggtattat tccaatgctt gatcttgccc 360

agcagcagca tggtggatgg gtgccagttg cagcaatgaa tgctattgct aagatcgttg 420

aagttgcacc aatcagagta tatgaagttg ctacatttta cacaatgttt aaccggacta 480

aggtgggtaa atatcacctt ttggtgtgtg gaaccacacc ttgcatgatt cgtggttcac 540

gtgaaattga agaagccttg ttagaacatc ttggagttaa acggaatgag gtgaccagtg 600

atggtttatt ttctgttgga gaaatggagt gcatgggctg ctgtgtgaat gctcccatga 660

ttgctgtggc cgattattct aaaggttcag agggttacac atacaactat tatgaggacc 720

tcactcctaa acgagttgtt gagatcgtcg agatgctgaa aagaggagaa acccctcctc 780

gcggcacaca acacccagag cggaaaaact gtggccctgc tggagggaat accaccttgc 840

acggtgagcc gaaacctcct ccgtgcaggg atctagatgc ttgctaggtt tgctttgaat 900

tacaggcaca caaataagtt gggccacact atgattatat ggtgtggaaa ctggaacaaa 960

gcaaggcgat gtgttgtttg tattttgatc ttgttttgtt tacctctgcc cgcatctttt 1020

ttctctcctt ttgcaccatc agagaaatgg tacattgata atgacgatat gttattttgt 1080

cagctgacat gaggcggcag tggtaaaaag atttgtattc gtctttcggc aaagataaaa 1140

ctcttggaca ttctcttttt gggcattcct tttcagcttc 1180

<210>3

<211>274

<212>PRT

<213> Rice (Oryza sativa)

<400>3

Met Leu Pro Pro Ala Ala Arg Leu Ala Ala Arg Arg Leu Leu Gly Leu

1 5 10 15

Ala Thr Ser Ser Ala Ser Glu Ser Ala Ala Ala Arg Arg Leu Ser Arg

20 25 30

Ser Pro Ile Ser Tyr Ala Ala Ala Gly Cys Ser Ser Arg Leu Phe Ser

35 40 45

Thr Ala Leu Asn Tyr His Leu Asp Ser Pro Glu Asn Asn Pro Asp Met

50 55 60

Pro Trp Glu Phe Thr Glu Ala Asn Met Lys Lys Val Asn Glu Ile Leu

65 70 75 80

Ser His Tyr Pro Ser Asn Tyr Lys Gln Ser Gly Ile Ile Pro Met Leu

85 90 95

Asp Leu Ala Gln Gln Gln His Gly Gly Trp Val Pro Val Ala Ala Met

100 105 110

Asn Ala Ile Ala Lys Ile Val Glu Val Ala Pro Ile Arg Val Tyr Glu

115 120 125

Val Ala Thr Phe Tyr Thr Met Phe Asn Arg Thr Lys Val Gly Lys Tyr

130 135 140

His Leu Leu Val Cys Gly Thr Thr Pro Cys Met Ile Arg Gly Ser Arg

145 150 155 160

Glu Ile Glu Glu Ala Leu Leu Glu His Leu Gly Val Lys Arg Asn Glu

165 170 175

Val Thr Ser Asp Gly Leu Phe Ser Val Gly Glu Met Glu Cys Met Gly

180 185 190

Cys Cys Val Asn Ala Pro Met Ile Ala Val Ala Asp Tyr Ser Lys Gly

195 200 205

Ser Glu Gly Tyr Thr Tyr Asn Tyr Tyr Glu Asp Leu Thr Pro Lys Arg

210 215 220

Val Val Glu Ile Val Glu Met Leu Lys Arg Gly Glu Thr Pro Pro Arg

225 230 235 240

Gly Thr Gln His Pro Glu Arg Lys Asn Cys Gly Pro Ala Gly Gly Asn

245 250 255

Thr Thr Leu His Gly Glu Pro Lys Pro Pro Pro Cys Arg Asp Leu Asp

260 265 270

Ala Cys

<210>4

<211>20

<212>DNA

<213> Rice (Oryza sativa)

<400>4

gctccataca agccaaccac 20

<210>5

<211>20

<212>DNA

<213> Rice (Oryza sativa)

<400>5

gaaaaagcct gaactcaccg 20

<210>6

<211>18

<212>DNA

<213> Rice (Oryza sativa)

<400>6

atgctgccgc cggccgcc 18

<210>7

<211>18

<212>DNA

<213> Rice (Oryza sativa)

<400>7

gcaagcatct agatccct 18

<210>8

<211>436

<212>DNA

<213> Rice (Oryza sativa)

<400>8

ttccaatgct tgatcttgcc cagcagcagc atggtggatg ggtgccagtt gcagcaatga 60

atgctattgc taagatcgtt gaagttgcac caatcagagt atatgaagttgctacatttt 120

acacaatgtt taaccggact aaggtgggta aatatcacct tttggtgtgt ggaaccacac 180

cttgcatgat tcgtggttca cgtgaaattg aagaagcctt gttagaacat cttggagtta 240

aacggaatga ggtgaccagt gatggtttat tttctgttgg agaaatggag tgcatgggct 300

gctgtgtgaa tgctcccatg attgctgtgg ccgattattc taaaggttca gagggttaca 360

catacaacta ttatgaggac ctcactccta aacgagttgt tgagatcgtc gagatgctga 420

aaagaggaga aacccc 436

Claims (8)

1. A rice thioredoxin gene OsNDU is characterized in that: the nucleotide sequence of the gene is shown in SEQ ID NO. 1.

2. The rice thioredoxin gene OsNDU according to claim 1, wherein: the cDNA sequence of the gene is shown in SEQ ID NO. 2.

3. A protein encoded by the rice thioredoxin gene OsNDU according to claim 1 or 2, wherein: the amino acid sequence of the protein is shown as SEQ ID NO. 3.

4. A vector comprising the rice thioredoxin gene OsNDU of claim 1 or 2, characterized in that: the vector includes a cloning vector or an expression vector containing the polynucleotide sequence or a fragment thereof.

5. A host cell containing the rice thioredoxin gene OsNDU of claim 1 or 2, characterized in that: the host cell is a plant cell transformed with the nucleotide sequence or a fragment thereof.

6. The transgenic material according to claim 4, which comprises the rice thioredoxin gene OsNDU vector, characterized in that: the phenotype of the transgenic material includes a change in resistance to brown planthopper.

7. A molecular assay method for the rice thioredoxin gene OsNDU according to claim 1 or 2, characterized in that: the screening primers are as follows:

Hyg-L, the sequence of which is shown in SEQ ID NO. 4;

Hyg-R, the sequence of which is shown in SEQ ID NO. 5;

amplifying the transgenic rice genome DNA to be detected through the primer pair, and detecting an amplification product, wherein the primer is a carrier primer: if the primers Hyg-L and Hyg-R are used for amplifying a 728bp amplified fragment, the transgenic positive plant is indicated, and if the fragment is not amplified, the transgenic negative plant is indicated.

8. The application of the molecular detection method of the rice thioredoxin gene OsNDU as claimed in claim 7 in the breeding of brown planthopper-resistant rice.

Images