CN112899299A

CN112899299A - Method for changing soybean flower color by modifying GmW1 gene through CRISPR-Cas9

Info

Publication number: CN112899299A
Application number: CN202110135853.6A
Authority: CN
Inventors: 侯文胜; 陈莉; 袁珊; 孙�石
Original assignee: Institute of Crop Sciences of Chinese Academy of Agricultural Sciences
Current assignee: Institute of Crop Sciences of Chinese Academy of Agricultural Sciences
Priority date: 2021-02-01
Filing date: 2021-02-01
Publication date: 2021-06-04

Abstract

The invention discloses a method for changing soybean flower color by modifying GmW1 gene with CRISPR-Cas 9. The invention provides application of a substance for reducing the activity or content of protein W1 in changing plant flower color; or, the application of the substance for inhibiting the expression of the nucleic acid molecule for coding the protein W1 in the change of the flower color of the plants; the protein W1 is obtained by encoding a DNA molecule shown in a sequence 1 in a sequence table. Experiments prove that the W1 gene of 3 ', 5' -hydroxylase of daidzein is related to flower color, and the gene is edited to stop expression, so that purple flower can be changed into white flower, and plant flower color can be changed.

Description

Method for changing soybean flower color by modifying GmW1 gene through CRISPR-Cas9

Technical Field

The invention belongs to the technical field of biology, and relates to a method for changing soybean flower color by modifying GmW1 gene with CRISPR-Cas 9.

Background

In recent years, gene editing technologies such as CRISPR/Cas9 and the like show great application prospects. The soybean is used as an important crop, important character genes of the soybean are edited, a specific mutant material is created, and a new material can be provided for soybean genetic breeding. The CRISPR/Cas 9-based soybean mutant is mainly created by an agrobacterium tumefaciens-mediated soybean cotyledon node transformation method, most of T0 transgenic plants obtained by the method are chimeras, and homozygous transgenic plants are obtained at least from T1 generations.

Soybean gene editing plants are mainly identified through sequencing, and a large amount of gene editing and detecting work is time-consuming and labor-consuming and has high cost.

Disclosure of Invention

It is an object of the present invention to provide the following uses.

The invention provides an application of a substance for reducing the activity or content of the protein W1 or a substance for inhibiting the expression of a nucleic acid molecule for coding the protein W1 in A-E;

A. changing the flower color of the plant;

B. screening for gene editing plants;

C. used for visually screening other exogenous gene editing plants;

D. as a visual report tag;

E. preparing a visual gene editing and screening system;

the protein W1 is coded by the nucleic acid molecule shown in the following 1) or 2) or 3):

1) the coding region is a DNA molecule shown as a sequence 1 in a sequence table;

2) DNA molecules which hybridize under stringent conditions with the DNA sequences defined in 1) and which code for proteins having the same function;

3) a DNA molecule having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% homology with the DNA sequence defined in 1) and encoding a protein having the same function.

In the application, the plant flower color is changed into a white flower color from a plant flower color with a purple flower color;

the substance is a CRISPR/Cas9 system;

the CRISPR/Cas9 system includes the following 1) or 2):

1) the sgRNA, wherein the target point of the sgRNA is sequence 1 position 633-655;

2) a CRISPR/Cas9 vector expressing the sgRNA.

Another object of the present invention is to provide a method for breeding plants with altered flower color.

The method provided by the invention is 1) or 2) or 3):

1) comprises the following steps: firstly, reducing the activity or content of protein W1 in an original plant to obtain a transgenic plant; breeding the offspring of the transgenic plant to obtain the target plant with changed flower color;

2) comprises the following steps: firstly, inhibiting the expression of a nucleic acid molecule of a coded protein W1 in an original plant to obtain a transgenic plant; breeding the offspring of the transgenic plant to obtain the target plant with changed flower color;

3) comprises the following steps: firstly, carrying out gene editing on a nucleic acid molecule for coding the protein W1 in a starting plant to terminate the translation of the protein in advance to obtain a transgenic plant; breeding the offspring of the transgenic plant to obtain the target plant with changed flower color;

In the above method, the reduction of the activity or content of the protein W1 in the starting plant, the inhibition of the expression of the nucleic acid molecule encoding the protein W1 in the starting plant, or the gene editing of the nucleic acid molecule encoding the protein W1 in the starting plant is carried out by: introducing the CRISPR/Cas9 system into the plant of interest;

the CRISPR/Cas9 system includes the following 1) or 2):

2) a CRISPR/Cas9 vector expressing the sgRNA.

Or the plant flower color is changed into a target plant with a white flower color from an original plant flower color with a purple flower color.

It is still another object of the present invention to provide a method for identifying a gene-edited plant by flower color.

The method provided by the invention comprises the following steps: firstly, carrying out gene editing on a nucleic acid molecule for coding the protein W1 in a starting plant to obtain a plant after gene editing, and screening plants with changed flower colors from the progeny of the plant after gene editing to obtain the plant after gene editing;

The plants with changed flower colors are selected from the descendants of the plants after the gene editing as follows: detecting the offspring colors of the plants after the gene editing, and if the offspring colors are white flowers, the offspring colors are the plants after the gene editing; if the plant is purple flower, the plant is not a gene editing plant.

It is still another object of the present invention to provide a substance for changing flower color of a plant.

The substance provided by the invention is a substance for reducing the activity or content of the protein W1 in the original plant or a substance for inhibiting the expression of the nucleic acid molecule for coding the protein W1 in the original plant.

In the above, the substance is a CRISPR/Cas9 system;

the CRISPR/Cas9 system includes the following 1) or 2):

2) a CRISPR/Cas9 vector expressing the sgRNA.

Or changing the plant flower color into a white flower color.

In the above, the plant is a dicotyledonous plant or a monocotyledonous plant.

In the above, the plant is soybean.

In the above, the flower color is changed from purple flower to white flower.

Experiments prove that the W1 gene of 3 ', 5' -hydroxylase of daidzein is related to flower color, and the gene is edited to stop expression, so that purple flower can be changed into white flower, and plant flower color can be changed. The purple flower can be changed into white flower by knocking out the W1 gene of the soybean coding flavone 3 '5' -hydroxylase, and the method identifies and edits plants by visual flower color, thereby greatly saving the detection cost.

Drawings

FIG. 1 is a homozygous edit type.

FIG. 2 is a diagram of the sequencing peaks of homozygous mutants.

FIG. 3 shows that the flower color of the homozygous mutant turned white.

Detailed Description

The experimental procedures used in the following examples are all conventional procedures unless otherwise specified.

Materials, reagents and the like used in the following examples are commercially available unless otherwise specified.

The following examples are given to facilitate a better understanding of the invention, but do not limit the invention. The experimental procedures in the following examples are conventional unless otherwise specified. The test materials used in the following examples were purchased from a conventional biochemical reagent store unless otherwise specified. The quantitative tests in the following examples, all set up three replicates and the results averaged.

Cultivated soybean Jack, described in the following documents: chen L, Cai Y, Liu X, Yao W, Guo C, Sun S, Wu C, Jiang B, Han T, Hou W (2018), Improvement of microbial Agrobacterium-mediated transformation efficiency by addition of glutamine and antisense in the culture medium of International Journal of Molecular sciences19,3039), publicly available from the institute of crop science, China academy of agricultural sciences.

The purple-colored soybean variety Zhonghuang42, described in: chenpu, Chenli, Hantianfu, Dongfang, Houwensheng. Comparative study on traits related to genetic transformation efficiency of main cultivars of Chinese soybean, journal of Chinese oil crops, 2016, 38 (1): 027-033; the public is available from the institute of crop science, academy of agricultural sciences, china.

Agrobacterium tumefaciens EHA101, described in the following documents: chen L, Cai Y, Liu X, Yao W, Guo C, Sun S, Wu C, Jiang B, Han T, Hou W (2018), Improvement of microbial Agrobacterium-mediated transformation efficiency by addition of glutamine and agar in the culture medium of International Journal of Molecular Sciences19,3039 publicly available from the institute of crop science of the Chinese academy of agricultural Sciences.

MS salt: phyto Tech, catalog No.: and M524.

MS organic: phyto Tech, catalog No.: and M533.

B5 organic: photostech corporation, catalog No.: G219.

b5 salt: photostech corporation, catalog No.: G768.

the YEP solid culture medium consists of a solvent and a solvent; solutes and their concentrations in YEP solid medium were: NaCl 5g/L, yeast extract 5g/L, tryptone 10g/L, 15g/L agar; the solvent is water. YEP solid medium pH 7.0.

Germination medium (ph 5.8): 3.12g/L B5 salt, 1ml/L B5 organic, 20g/L sucrose, 7.5g/L agar, and the balance water.

Liquid medium (ph 5.4): 0.43g/L MS salt, 1ml/L B5 organic, 40mg/L acetosyringone, 150mg/L dithiothreitol, 100mg/L L-cysteine, 30g/L sucrose, 3.9 mg/L2-morpholine ethanesulfonic acid, and the balance of water.

Co-culture medium (ph 5.4): 0.43g/L MS salt, 1ml/L B5 organic, 40mg/L acetosyringone, 150mg/L dithiothreitol, 100mg/L L-cysteine, 30g/L sucrose, 7.5g/L agar, 3.9 mg/L2-morpholine ethanesulfonic acid, and the balance of water.

Recovery medium (ph 5.4): 3.1g/L B5 salt, 1ml/L B5 organic, 30g/L sucrose, 150mg/L cefuromycin, 150mg/L timentin, 1 mg/L6-BA, 0.98 g/L2-morpholine ethanesulfonic acid, 7.5g/L agar, 4ml/L Fe salt (200X), 50mg/L L-asparagine, 50mg/L L-glutamine, and the balance water.

Screening medium (ph 5.4): 3.1g/L B5 salt, 1ml/L B5 organic, 0.98 g/L2-morpholine ethanesulfonic acid, 30g/L sucrose, 150mg/L cefuroxime, 150mg/L timentin, 1 mg/L6-BA, 6mg/L glufosinate, 7.5g/L agar, 4ml/L Fe salt (200X), 50mg/L L-asparagine, 50mg/L L-glutamine, and the balance water.

Elongation medium (ph 5.6): 4.0g/L MS salt, 1ml/L B5 organic, 0.6 g/L2-morpholine ethanesulfonic acid, 30g/L sucrose, 150mg/L cefuromycin, 150mg/L timentin, 0.1mg/L IAA, 0.5mg/L GA, 1 mg/L6-BA, 6mg/L glufosinate-phosphine, 7.5g/L agar, 4ml/L Fe salt (200X), 50mg/L L-asparagine, 50mg/L L-glutamine, and the balance water.

Rooting medium (ph 5.7): 2.165g/L MS salt, 1ml/L B5 organic, 0.6 g/L2-morpholine ethanesulfonic acid, 20g/L sucrose, 7.5g/L agar, 50mg/L L-asparagine, 50mg/L L-glutamine, and the balance water.

Example 1 construction of GmW1 Gene knockout vector

The nucleotide sequence of the genome of soybean GmW1(Glyma.13G072100) is sequence 1 in the sequence table. GmW1 gene is located in chromosome 13, and the on-line web page tool of CRISPR-P (http:// cbi. hzau. edu. cn/cgi-bin/CRISPR) is used for selecting the GmW1 gene sgRNA target site sequence. The target is located in the first exon region of GmW1 gene, target sequence CTATCGCCAGAAACTCCCACCGG (sequence 1, position 633-655). After the target is designed, the target needs to be integrated into a vector, which is specifically as follows:

1. synthetic and annealing preparation of sgRNA

Synthesizing a target primer of the sgRNA, wherein the primer sequence is as follows:

W1-F：5′-TTGCTATCGCCAGAAACTCCCAC-3′

W1-R：5′-AACGTGGGAGTTTCTGGCGATAG-3′

(sgRNA with 20bp sequence underlined)

W1-F and W1-R primers of 5ul and water of 15ul are respectively added into a 25ul system, the temperature is 95 ℃ for 3min, the annealing is carried out at 0.1 ℃/s to 16 ℃, the temperature is 16 ℃ and the annealing is kept for 10min, thus finishing the annealing.

Obtaining an annealing product, namely double-stranded DNA fragment gRNA with a sticky end.

2. Construction of CRISPR/Cas9 vector

1ul of the double-stranded DNA fragment gRNA with a cohesive end obtained in the above 1 was taken to be T4-ligated to Cas9 vector (Beijing Weishangrid Biotech Co., Ltd., product number: VK005-15, which contains Cas9 protein expression unit) to obtain a ligated product.

The ligation product was transformed into E.coli DH 5. alpha. and spread on LB + Kan solid medium.

Single clones were picked and sequenced.

Sequencing primer SQ: TGAAGTGGACGGAAGGAAGGAGG, and returning a plasmid which is named W1-sgRNA and contains the target sequence CTATCGCCAGAAACTCCCACCGG after confirming that the correct fragment is inserted.

3. Construction of recombinant bacterium

And (3) electrically transferring the recombinant plasmid W1-sgRNA into an agrobacterium EHA105 strain to obtain a recombinant strain.

And (3) extracting a plasmid of the recombinant strain for sequencing verification, and naming the recombinant strain with correct sequencing verification as EHA-W1-sgRNA.

Examples 2, GmW1 knock-out Soybean and its phenotype

The constructed EHA-W1-sgRNA is transformed into a purple-flower soybean variety Zhonghuang42 (wild soybean) by utilizing an agrobacterium-mediated method, and the specific method comprises the following steps:

seed sterilization

1. Seeds of a soybean variety Zhonghuang42 (hereinafter, referred to as wild-type soybean) which is free from plant diseases and insect pests and spots, plump, uniform and dry were completely spread in a petri dish, and the petri dish was placed in a desiccator.

2. After the step 1 is finished, a beaker with the volume of 100ml is placed in a dryer, 80ml of 12M sodium hypochlorite aqueous solution is poured into the beaker, 4ml of concentrated hydrochloric acid is slowly added, then the dryer is quickly covered, the dryer is sealed by vaseline, and the dryer is placed for 12 to 16 hours to carry out chlorine sterilization.

Secondly, preparing infection bacterial liquid

1. Culturing EHA-W1-sgRNA agrobacterium liquid at 28 ℃, and re-suspending with a liquid culture medium to obtain OD_600nm0.6 of the infected bacterial liquid.

2. Placing the treated seed into a super clean bench, peeling off seed coat under a microscope, separating two cotyledons along a long axis, reserving the cotyledon with an intact hypocotyl, scratching the joint of the hypocotyl and the cotyledon, generally scratching one cotyledon for 3-5 times, and then dip-dyeing for 2 hours in an incubator at 28 ℃.

3. Spreading the inner surface (smooth surface) of cotyledon upwards on the co-culture medium paved with sterile filter paper, and culturing at 22 deg.C in dark for 5 days.

4. After co-cultivation for 5 days, the explant was elongated to 1-2cm, and the hypocotyl was cut off to 0.5 cm. The treated explants were placed in recovery medium and cultured for 7d at 28 ℃ under 16h light/8 h dark conditions.

5. And taking the explant out of the recovery culture medium, removing a new bud, cutting off a part of embryonic axis, reserving 0.5cm of embryonic axis, transferring the trimmed explant into a screening culture medium, and culturing for 21d under the conditions of 28 ℃, 16h of illumination and 8h of darkness.

6. After 21d screening induction, the explant generates a large amount of adventitious buds, the cotyledon and brown leaves are stripped, and the rest part is transferred into an elongation culture medium for culture at 28 ℃ under 16h light/8 h dark condition.

7. In an elongation culture medium, when 5-8cm of caulicles are extracted from the cluster buds, the base parts of adventitious buds are cut off; dipping the stem base in 1mg/L IBA solution for 1min, then transferring the stem base into a rooting culture medium for culture at 28 ℃, culturing for one week under the conditions of 16h of light/8 h of dark, transplanting the stem base into a pot after generating a large number of roots, and obtaining a T0 generation transformed plant.

Identification of transgenic plants

DNA of leaves of T0 transformed seedlings was extracted as a template for PCR, and wild type was used as a control. PCR primers were designed near the target site of GmW1 gene, amplified by PCR and sequenced.

And (3) primer F: 5'-AAATGTTGGTGGAGACGT-3' and R: 5'-GCTAAGGTGACATGAGGC-3' the GmW1 gene was amplified.

And (3) PCR reaction system: 2X Phanta Max Buffer 12.5ul, dNTP Mix (10mM)0.5ul, DNA (200ng/ul)1ul, F (10pmol/ul)1ul, R (10pmol/ul)1ul, Super-Fidelity DNA Polymerase 0.5ul, ddH₂O8.5 ul, total volume 25 ul.

An amplification reaction system: 3min at 95 ℃; 30sec at 95 ℃,30 sec at 50 ℃, 1min at 72 ℃ and 35 cycles; 5min at 72 ℃.

The PCR product was sent to the company for sequencing verification. And editing the plant when the peak appears at the target point. Sequencing results show that 25 of 33T 0 transformed seedlings are edited (the W1 gene has frame shift to terminate protein translation early), and the editing efficiency reaches 76%, which indicates that the sgRNA has strong editing efficiency.

The edited T0 generation transformed seedling is named as T0 generation GmW1 gene knockout soybean.

Example 2 knock-out W1 Soybean plant flower color identification

Sowing the T0 generation GmW1 gene knockout soybean (gene editing plant) to harvest seeds, sowing again to obtain the T1 generation GmW1 gene knockout soybean.

PCR was performed using DNA from T1 generation GmW1 knock-out soybean leaf as a template and wild type soybean as a control.

The primers for the above PCR were as follows:

The PCR reaction system comprises: 2X Phanta Max Buffer 12.5ul, dNTP Mix (10mM)0.5ul, DNA (2 mM)00ng/ul)1ul，F(10pmol/ul)1ul，R(10pmol/ul)1ul，Super-Fidelity DNA Polymerase 0.5ul，ddH₂O8.5 ul, total volume 25 ul.

The PCR amplification procedure described above: 3min at 95 ℃; 30sec at 95 ℃,30 sec at 50 ℃, 1min at 72 ℃ and 35 cycles; 5min at 72 ℃.

The obtained PCR product is sent to a company for sequencing verification.

98T 1 generation plants are detected to obtain 21 GmW1 gene knockout homozygous mutants which comprise w1 pure mutants and 6 editing types, wherein the 6 editing types are all frameshift mutations which cause gene function loss (figure 1), and the mutant is named as T1 generation GmW1 gene knockout homozygous mutant.

The 6 edit types include: -4bp, -2bp, -5bp, +1bp, +2bp (FIG. 1 and FIG. 2).

The GmW1 gene mutation type-4 bp (3 strains) in the T1 generation soybean mutant plant is characterized in that the 647 rd and 650 th positions of the sequence 1 in the GmW1 gene on two homologous chromosomes are deleted, and other nucleotides are kept unchanged.

The GmW1 gene mutation type-2 bp (2 strains) in the T1 generation soybean mutant plant is that the 649-650 site of the sequence 1 in the GmW1 gene on two homologous chromosomes is deleted, and other nucleotides are kept unchanged.

The GmW1 gene mutation type-5 bp (5 strains) in the T1 generation soybean mutant plant is deletion of the 646-650 th site of the sequence 1 in the GmW1 gene on two homologous chromosomes, and other nucleotides are kept unchanged.

The GmW1 gene mutation type-5 bp (7 strains) in the T1 generation soybean mutant plant is that the 645 th and 649 th position of the sequence 1 in the GmW1 genes on two homologous chromosomes are deleted, and other nucleotides are kept unchanged.

The GmW1 gene mutation type +1bp (1 strain) in the T1 generation soybean mutant plant is characterized in that a base T is inserted between the 649-650 th site of the sequence 1 in the GmW1 gene on two homologous chromosomes, and other nucleotides are kept unchanged.

The GmW1 gene mutation type +2bp (3 strains) in the T1 generation soybean mutant plant is characterized in that two bases T are inserted between 649-650 th position of sequence 1 in GmW1 genes on two homologous chromosomes, and other nucleotides are kept unchanged.

Observing the flower color of the T1 generation GmW1 gene knockout pure mutant (fig. 3, mutant is T1 generation GmW1 gene knockout pure mutant, WT is purple soybean variety ZHONGHUANG42), and the flower color is white, namely the flower color is a gene editing plant;

the middle part of 98 plants is T1 generation GmW1 gene knockout double-allelic heterozygous mutant (GmW 1 genes on two homologous chromosomes generate different mutation types), and the flower color is white, namely the gene editing plant;

the part of 98 plants is T1 generation GmW1 gene knockout heterozygous mutant (GmW 1 gene on 1 homologous chromosome is mutated, and the other homologous chromosome is an unmutated wild type), the flower color is purple, and the mutant is not a gene editing plant.

The results show that the GmW1 gene in wild soybean with the purple flower phenotype is subjected to gene editing, and the flower color of the obtained gene-edited plant is changed from purple flower to white flower.

And judging whether the plant is the gene editing plant or not by detecting the flower color of the progeny of the plant after gene editing, and determining the homozygous mutant by combining the sequencing result.

The step of judging whether the plant is the gene editing plant or not by detecting the flower color of the plant progeny after the gene editing comprises the following steps: detecting the offspring colors of the plants after the gene editing, and if the offspring colors are white flowers, the offspring colors are the plants after the gene editing; if the plant is purple flower, the plant is not a gene editing plant.

SEQUENCE LISTING

<110> institute of crop science of Chinese academy of agricultural sciences

<120> method for modifying GmW1 gene to change soybean flower color by using CRISPR-Cas9

<160> 1

<170> PatentIn version 3.5

<210> 1

<211> 5226

<212> DNA

<213> Glycine max

<400> 1

tcatttttat atatttattc ttaaacgaaa aatctaaact actatatttg attcatattc 60

tttatttatt ttttaaaatt tccccattgt ttaaattttt taaatcaaaa tcaaaatcat 120

ttaagtttac ttaattttaa tattgtatga aataattaaa attaaaaaaa aatgtttttt 180

taacaaagta aaaagaaatt ataatggtga tagaaccacg ggaaagtatt tgtgcaaaat 240

aattgaaatt acaagtatta ttttctatta caattttttt aattgtttct ttgctttttt 300

ttttttttaa cttctatttt gcaagcatgt attttatatt taatgtgtgt ggagggggac 360

ggagtacaaa ctcttttttg tctatattca gtaaaatgtt ggtggagacg tgccttgcgt 420

gatgaactac catttcaaac accacacgac accacacatc cattttaaat ataaccccat 480

catagatatc ccgaatcatc aaattattac ttcatagcaa ctagcaaatt aattagcttc 540

accatggact cattgttact tctaaaagaa attgccactt ccattttgat cttcttgatc 600

actcgtctct ccattcaaac attcctcaaa agctatcgcc agaaactccc accggggcca 660

aaagggtggc cagttgtggg tgcactccct ctcatgggaa gcatgcctca tgtcacctta 720

gcaaagatgg caaaaaaata tggacctata atgtacctca aaatgggcac taacaacatg 780

gttgtggcct ctactccagc tgctgctcgt gccttcctca aaacccttga tcaaaacttt 840

tcaaaccggc cctccaatgc tggtgcaacc catttggctt atgatgcacg ggtaggaatg 900

cagcaccttc atatttttat ttattttaaa cacaccatta atgtcactta ttatatataa 960

ctatactttc tttttgtttt tctctctcac taagtgctaa atagaaataa attaacttat 1020

gaagaggtta gattcggaga attcttataa attaacttta cataattaat tttaatttat 1080

aggagaaatt tatttatttt cttatttttt tctcctataa gtatttatta taattttatt 1140

caaattagcg cgtgtaaaaa aaaataaatg aactgatcca aaattgaaca aaactctgct 1200

tcgaaaaccg aaccttttta ataagaacgg ttaggtttta gagtggttca acttgtttct 1260

attcaattat ttaattagaa aaacctatcc atatacagta tagaatgaat aattgacact 1320

aatggaacca aaccgaagct aataaaatgt aaaccatttt gaaaaaaatt taactaactc 1380

actttataaa aaaaaaaatt gattaaccaa actgttttta tgaggtgatt tgtaaatgga 1440

ccggtttgga tttaaataca aaccaaatgt ttcagggtct taatccaaaa atgagattct 1500

taaaataagt gaattcttct cttcctctat ctatatgtaa taatttttct aatatattaa 1560

aatacgtagc tttataattt actaagataa taacatatgt atatcttttc acttttggct 1620

attttggatc cgtccttgtt gacaggatat ggtgtttgct cattacggat cacggtggaa 1680

gttgctaaga aaactaagta acttgcacat gcttggagga aaggcacttg atgattgggc 1740

ccaaattcga gatgaagaga tggggcacat gcttggtgca atgtacgatt gtaacaagag 1800

ggatgaggct gtggtggtgg cggagatgtt gacatattca atggccaaca tgattggcca 1860

agttatattg agtcgtcgag tgtttgagac aaagggttcg gagtctaacg agttcaagga 1920

catggtggtt gagctcatga ccgttgctgg ttacttcaac attggtgact tcataccctt 1980

tttggccaag ttggacttgc aaggcataga gcgtggcatg aagaagttgc acaagaagtt 2040

tgatgcgttg ttaacgagca tgattgagga gcatgttgct tctagtcaca agagaaaggg 2100

caagcccgat ttcttagaca tggtaatggc tcatcatagt gagaactccg atggggagga 2160

actatcgctc accaacatca aggcactact cttggtataa cgctttttat cttacttctc 2220

aaatgtgtca ttttctttct tcatttttat tagacaaaaa aaaaaaagta aaatatttgt 2280

tatatgagga taactaccat ggaggatcac ttatggtatc caacgttgtt aaataaccgt 2340

tataatccgc cttaacgtta taatgtggca tttttcaacc cctctgccca tagacagttt 2400

gtgagggagg cccgttatga cggcgccata gggtgcaatg gcttcctaat atggagaaat 2460

tttagccttc tgcatatgtc gtcatctgtc attgataact ttggtgtggt gttaacaaaa 2520

caacttatat agttaggata ggtagtaaaa agaaagtgtt atttccatat ttttcaaacc 2580

ccttgttata tatatatata gtggcggacc tacatgagtg ataaaaaaat ttattctctt 2640

cataaaaaag tgtaggaggg tacttgtacc tccttatttt ttaaaattta ttaaatttat 2700

aaataaaatt ttatattttt atattttatt ttatctatat ttatataatt gaattcatta 2760

attttatttt ttataattta aactccctaa tttaaaatct tggatccgcc tatatatata 2820

tatcaatcgt ttttttacat tttcaagaat tatattaaaa acttcaacat ctttaattca 2880

aaaatgctat acactttcta attcattctt ttaaacactt tctaattcat ttttttaaat 2940

atattattat tgactaaaat tgattgtaaa tcatacattg gttctatttt ttttattgaa 3000

tgagtctcac ttgttctgtg gtttctaaca tattttaact aatatcaaag agtaggtacg 3060

ttgagtgtat tgttggttca attcttttct ttttataaaa aattttgata tcataatatt 3120

tgaaagtttt gtttaaaata atcttccctc tatttgtaca taattatagc atgtttgttt 3180

tggcaaattg aataaaaagt gaaaaatttg gaagcaatat aaaacttcgt tagaaccatt 3240

aaaaaaacat aatcaatttc ccttcgccac ccccacacac atacatagta aatttagtcc 3300

tacacatcat aacttatttt gcctgaaaaa tgttgagtta atttttatga cttgaagtga 3360

caaaaatacg ttcaaaattt gtttatattg ttcaaactat aaatttacaa ttgaaccaca 3420

aagaaaaagg atttccgtat gacaaattaa aaattaattg cgatattgca tagttaactc 3480

tactatatct gaatttttat ttgttttaca agtacaactt gtttatgata taagtttagc 3540

tataagccaa gtaagtacac tttaaattta gccaaaaagg aaatgggcag tctgtatcat 3600

aaattttctt agacggaaat attaaagtac aagctacgaa tatatcgtat atattgtgtg 3660

agatcaactt aaattaatca tgatggaggt taaatgctgc aattaaatta aattcagcgg 3720

gcctctcccc caattattta taccaacttt ttgctgcatt tggaattggg gccacggaaa 3780

gtaatgtccc aactaagaaa atatcttctc atcatttggt attgtacgta gtgaatcaca 3840

ttgactatat atcatgtatt aaatctgata tgagaatatt tattttccat cttattttct 3900

atatgcataa taatattagt ttttgtctag tatatatatc acatttttaa tacataaata 3960

acaaatttag tcaacacttt ttttttaaaa aaaaaaagac ctaaaatttt gtttacacta 4020

gaaactaaat attaattgtt gtgactaaat tacaatgtga atataataat accatcataa 4080

tagtgttcaa ttttaacaaa aaaatctatg ttatatatag tgcaaattca acgaatcaat 4140

acaaatcata ttttatataa aaatttattg atgatgtaaa tgttagtgca agttattacg 4200

atgataattt aatccctcgc ctcataatca taccacacac caacattttc tagcttgaga 4260

ttttgttcta acaactatat atgctatttt gttccagaac ctattcaccg caggcaccga 4320

tacatcttca agtataatag agtggtcctt agccgagatg ttgaagaagc ccagcataat 4380

gaagaaggct catgaagaaa tggaccaagt cataggaagg gatcgccgtc tcaaagaatc 4440

tgacatacca aagcttccct acttccaagc catttgcaaa gagacctata gaaagcaccc 4500

ttcaacaccc ctaaacctgc ctcgaatctc atctgaaccg tgccaagtga atggttacta 4560

cattcccgag aacactaggc tgaatgtgaa catttgggcc ataggaagag accctgatgt 4620

gtggaacaat cctttggagt ttatgcccga gaggtttttg agtgggaaga atgccaaaat 4680

tgacccacgt gggaatgatt ttgagcttat tccatttggt gctgggagga ggatttgtgc 4740

agggactagg attttgagct tattccattt ggttcactac attttgggct tattccattt 4800

ttgagcttat tccatttggt tcactacatt ttgggcactt tggtgcattc gtttgattgg 4860

aagctaccca atggggtgag ggagttagac atggaggagt cctttgggct tgccttgcaa 4920

aaaaaggttc cacttgctgc tttggttacc cctaggttga acccaagtgc ttacatttct 4980

tagaattggt tgggttcgaa tattcaccag ctatgttctc tagccttatt ttgttgtcca 5040

atgattttgt ggctgtggct acataaataa gtaatgtttg ggttgcacaa cctatttgta 5100

tttgtaaggt tctatgttac ttggaaatcc gttaccccac cacctgcaag gcttagattt 5160

ttattcttca tggatctcta atttagctgt cttgttttgg tttaattata tttttaattc 5220

tcactc 5226

Claims

1. The use of a substance which reduces the activity or content of protein W1 or a substance which inhibits the expression of a nucleic acid molecule encoding said protein W1 in A-E as follows;

A. changing the flower color of the plant;

B. screening for gene editing plants;

C. used for visually screening other exogenous gene editing plants;

D. as a visual report tag;

E. preparing a visual gene editing and screening system;

2. Use according to claim 1, characterized in that:

the substance is a CRISPR/Cas9 system;

the CRISPR/Cas9 system includes the following 1) or 2):

2) a CRISPR/Cas9 vector expressing the sgRNA.

3. A method for cultivating a plant with an altered flower color is 1) or 2) or 3) as follows:

4. The method of claim 3, wherein:

the reduction of the activity or the content of the protein W1 in the starting plant, the inhibition of the expression of the nucleic acid molecule encoding the protein W1 in the starting plant or the genetic editing of the nucleic acid molecule encoding the protein W1 in the starting plant is achieved by: introducing the CRISPR/Cas9 system into the plant of interest;

the CRISPR/Cas9 system includes the following 1) or 2):

2) a CRISPR/Cas9 vector expressing the sgRNA.

5. A method of identifying a gene-editing plant by flower color, comprising the steps of: firstly, carrying out gene editing on a nucleic acid molecule for coding the protein W1 in a starting plant to obtain a plant after gene editing, and screening plants with changed flower colors from the progeny of the plant after gene editing to obtain the plant after gene editing;

6. A substance for changing plant flower color is a substance for reducing the activity or content of protein W1 in original plant or a substance for inhibiting the expression of nucleic acid molecule for coding said protein W1 in original plant.

7. The substance of claim 7, wherein:

the substance is a CRISPR/Cas9 system;

the CRISPR/Cas9 system includes the following 1) or 2):

2) a CRISPR/Cas9 vector expressing the sgRNA.

8. Use according to claim 1 or 2 or a method according to any one of claims 3-5 or a substance according to claim 5 or 6, characterized in that: the plant is a dicotyledonous plant or a monocotyledonous plant.

9. Use according to claim 1 or 2 or a method according to any one of claims 3-5 or a substance according to claim 5 or 6, characterized in that: the flower color is changed from purple flower to white flower.