CN112870270B

CN112870270B - Traditional Chinese medicine preparation for treating ulcerative colitis and preparation method thereof

Info

Publication number: CN112870270B
Application number: CN202110214423.3A
Authority: CN
Inventors: 闫昕; 贾永森; 朱亮; 齐峰; 江春花; 杜晨光; 王新月
Original assignee: North China University of Science and Technology
Current assignee: North China University of Science and Technology
Priority date: 2021-02-26
Filing date: 2021-02-26
Publication date: 2022-09-20
Anticipated expiration: 2041-02-26
Also published as: CN112870270A

Abstract

The invention belongs to the technical field of traditional Chinese medicine compositions, and discloses a traditional Chinese medicine preparation for treating ulcerative colitis and a preparation method thereof, wherein the traditional Chinese medicine preparation comprises, by mass, 15-20% of astragalus, 4-6% of liquorice, 15-20% of salvia miltiorrhiza, 6-10% of ligusticum wallichii, 25-30% of houttuynia cordata, 8-10% of scutellaria baicalensis and 8-10% of sophora flavescens. Cleaning Scutellariae radix, Glycyrrhrizae radix, Saviae Miltiorrhizae radix, rhizoma Ligustici Chuanxiong, herba Houttuyniae, Scutellariae radix, and radix Sophorae Flavescentis, and soaking in clear water for 30min respectively; mixing the soaked medicines, and adding 3 times of water for decoction; filtering and concentrating to obtain the traditional Chinese medicine preparation for treating ulcerative colitis. The invention uses astragalus root and liquorice to tonify lung qi, and angelica and salvia miltiorrhiza to activate blood and remove stasis; herba Houttuyniae, Scutellariae radix, and radix Sophorae Flavescentis have effects of clearing lung-heat, benefiting lung, eliminating dampness and removing toxic substance. The formula has the effects of reinforcing and treating both lung and intestine, and is helpful for improving qi and blood circulation of local lung and intestine and whole body, accelerating the repair of lung and intestine tissue injury and reducing recurrence.

Description

Traditional Chinese medicine preparation for treating ulcerative colitis and preparation method thereof

Technical Field

The invention belongs to the technical field of traditional Chinese medicine compositions, and particularly relates to a traditional Chinese medicine preparation for treating ulcerative colitis and a preparation method thereof.

Background

Ulcerative Colitis (UC) is a chronic Inflammatory and Ulcerative lesion of the mucosa of the large intestine and is one of the Inflammatory Bowel Diseases (IBD). In recent years, the incidence of UC in China is increasing year by year. Because the etiology is complex, the cure difficulty is high, the colon cancer is frequently recurrent, and the colon cancer is closely related to the onset of the colon cancer, the colon cancer is listed as one of the modern refractory diseases by the world health organization. The cause and pathogenesis of UC are not clear, and the Western medicine mostly adopts amino salicylic acids, corticosteroids and immunosuppressant for treatment, so that the symptoms can be quickly relieved, but the toxic and side effects of the medicine are large; the UC is treated by individuation syndrome differentiation of the traditional Chinese medicine, although the curative effect is reliable and the medication is relatively safe, the problems of chronic sustained attack, appearance of a plurality of extra-intestinal symptoms and the like are still the difficult points of UC treatment.

Through the above analysis, the problems and defects of the prior art are as follows: the existing western medicines for treating ulcerative colitis have large toxic and side effects, while the traditional Chinese medicines have slow and sustained onset, and both the western medicines and the western medicines fail to obviously inhibit a plurality of extra-intestinal symptoms of UC.

The difficulty in solving the above problems and defects is: according to the theory of traditional Chinese medicine, the lung governs qi, and qi is closely distributed with blood and body fluids. In 1976, Kraft first proposed the idea that IBD may involve the lungs, and in recent years, foreign scholars paid more attention to the respiratory symptoms of IBD, but this is not generally recognized in China. The early research team performs multi-center large sample epidemiological investigation in the Chinesian hospitals such as Beijing, Shanghai, Henan, Jiangsu and the like in China, and found that 58.6 percent of UC patients have pulmonary symptoms. Data of the Shanghai Longhua hospital in different centers show that 74.7% of 91 UC patients have obvious symptoms of shortness of breath and cough; 84.6 percent of patients have lung function change, which is manifested by abnormalities of different degrees of airflow limitation, dispersion amount reduction, residual capacity increase compared with the total lung amount and the like, and the ubiquitous property of UC combined lung injury is proved; the study by Aydin Yilmaz et al further showed that the degree of inflammatory injury in the gut in UC patients correlates with the severity of respiratory symptoms. In view of the deep research of the lung and large intestine exterior-interior theory of the traditional Chinese medicine and the objective existence of UC combined lung injury, the further search of the pathological mechanism of UC lung and intestine concordance and the search of effective treatment methods and medicaments are important subjects for treating UC and UC lung injury in the clinical traditional Chinese medicine.

The significance of solving the problems and the defects is as follows: according to the pathogenesis characteristics of UC such as long-term, stasis, stubborn and miscellaneous diseases, by combining with the intestinal collateral damage manifestations of mucous membrane congestion, swelling, erosion, blood vessel network blurring and the like under an enteroscope, the pathogenesis hypothesis of toxic damage intestinal collateral is put forward, the long-term damage of the intestinal collateral caused by damp-heat stasis and toxic is considered as the pathogenesis key of UC repeated attack and lingering and difficult healing, and the pathogenesis of UC lung damage is considered as' toxic damage intestinal collateral, and toxic pathogen attacks the lung; the damp-heat and blood stasis can affect the lung and impair the lung qi over time, affecting the dispersing, descending and descending of the lung. Failure of the lung to disperse and descend, failure of body fluids to distribute and function, and failure of qi and blood circulation, aggravate intestinal qi and blood stasis, which may cause recurrent UC attacks and persistent and difficult recovery due to improper diet and emotional distress, and may lead to various extra-intestinal manifestations. Aiming at the common pathogenic factors of UC and UC lung injury, namely lung qi deficiency and damp-heat toxin stasis, the administration of both purgation and tonification and the simultaneous treatment of lung and intestine can help to improve the qi and blood circulation of local lung and intestine and the whole body, accelerate the repair of lung and intestine tissue injury and reduce relapse and a plurality of UC extra-intestinal manifestations. Effective intervention measures are searched for aiming at targets, and a treatment method capable of protecting and repairing the lung-intestine barrier simultaneously is searched for, so that good news can be brought to patients suffering from UC.

Disclosure of Invention

Aiming at the problems in the prior art, the invention provides a traditional Chinese medicine preparation for treating ulcerative colitis and a preparation method thereof.

The traditional Chinese medicine preparation for treating ulcerative colitis is prepared from 15-20% of astragalus, 4-6% of liquorice, 15-20% of salvia miltiorrhiza, 6-10% of ligusticum wallichii, 25-30% of houttuynia cordata, 8-10% of scutellaria baicalensis and 8-10% of sophora flavescens according to mass percentage.

The invention also aims to provide a preparation method of the traditional Chinese medicine preparation for treating ulcerative colitis, which comprises the following steps:

step one, cleaning astragalus, liquorice, salvia miltiorrhiza, ligusticum wallichii, houttuynia cordata, scutellaria baicalensis and sophora flavescens, and respectively soaking the materials in clear water for 30 minutes;

step two, mixing the soaked astragalus, liquorice, salvia miltiorrhiza, ligusticum wallichii, houttuynia cordata, scutellaria baicalensis and sophora flavescens, and adding 3 times of water for decoction;

and step three, filtering and concentrating to obtain the traditional Chinese medicine preparation for treating ulcerative colitis.

Further, the cleaning of the astragalus, the liquorice, the salvia, the ligusticum wallichii, the houttuynia cordata, the scutellaria baicalensis and the sophora flavescens comprises the following steps: simultaneously supplying compressed air and dry powder, and blowing the surfaces of the traditional Chinese medicinal materials by using the compressed air carrying the dry powder to blow off attachments on the surfaces of the traditional Chinese medicinal materials; stopping supplying the dry powder, only supplying compressed air, and blowing the dry powder deposited on the surfaces of the Chinese medicinal materials by using the compressed air.

Further, the decocting specifically comprises:

1) putting and soaking medicinal materials: soaking radix astragali, Glycyrrhrizae radix, Saviae Miltiorrhizae radix, rhizoma Ligustici Chuanxiong, herba Houttuyniae, Scutellariae radix, and radix Sophorae Flavescentis; then taking the medicine decocting device, adding water to the surface of the medicinal materials, and soaking; squeezing and soaking the medicinal materials until there is no gap, adding purified water until the water level is higher than the upper surface of the medicinal materials, and soaking;

2) first decoction: decocting under slight pressure, and keeping boiling; stopping heating, collecting the liquid medicine while the liquid medicine is hot, squeezing the medicinal materials until no residual liquid medicine is left in the liquid medicine, and storing the liquid medicine separately;

3) adding water for the second decoction: measuring the temperature of the medicinal materials, and adding purified water not lower than the measured temperature into the medicinal materials until the temperature exceeds the upper surface of the medicinal materials;

4) second decoction: decocting under normal pressure, boiling, stopping heating, collecting the medicinal liquid, squeezing the medicinal materials until no residue is left, mixing the medicinal liquids, and mixing;

5) and (3) detection: detecting the content of the medicament, and packaging the medicament in divided doses if the medicament is qualified; and if not, concentrating until the medicament content is qualified.

Further, the medicinal materials are put in and soaked: soaking radix astragali, Glycyrrhrizae radix, Saviae Miltiorrhizae radix, rhizoma Ligustici Chuanxiong, herba Houttuyniae, Scutellariae radix, and radix Sophorae Flavescentis; then taking the medicine decocting device, adding water to the surface of the medicinal materials, and soaking for 10 minutes; squeezing and soaking the medicinal materials until no gap exists, adding purified water until the volume of the medicinal materials exceeds 3 cm of the upper surface of the medicinal materials, and soaking for 30 minutes.

Further, the first frying: decocting under 0.15Mpa, and boiling for 30 min; stopping heating, collecting the liquid medicine while it is hot, squeezing the medicinal materials until no residual liquid medicine is left in the liquid medicine, and storing separately.

Further, adding water for the second decoction: and (3) measuring the temperature of the medicinal materials, and adding purified water which is not lower than the measurement temperature into the medicinal materials until the temperature exceeds the upper surface of the medicinal materials by 2 cm.

Further, the second decoction: decocting under normal pressure and boiling for 30min, stopping heating, collecting the liquid medicine, squeezing the medicinal materials until no residue is left, mixing the two liquid medicines, and mixing.

Further, filtering the decocted water extract by a filter membrane with the membrane aperture of 0.02-1 mu m, and concentrating the obtained filtrate by a nanofiltration membrane with the molecular weight cutoff of more than 150 into an extract with the relative density of 1.02-1.15.

Further, the filter membrane with the membrane aperture range of 0.02-1 mu m is an inorganic ceramic membrane, a stainless steel tubular membrane or an organic membrane;

the filtration pressure is 0.01-0.8 MPa when the inorganic ceramic membrane or the stainless steel tubular membrane is adopted, the filtration temperature is 4-85 ℃, and the membrane flux is 20-300L/m ² ·h；

The organic membrane is a polysulfone membrane, a cellulose acetate membrane, a polyamide membrane, a polytetrafluoroethylene membrane, a polyvinylidene fluoride membrane or a polypropylene membrane, the adopted filtration pressure is 0.1-1.0 MPa, the filtration temperature is 4-45 ℃, and the membrane flux is 20-300L/m ² ·h；

The nanofiltration membrane is an aromatic polyamide composite membrane, a polypiperazine amide composite membrane, a polyether sulfone membrane or a cellulose triacetate membrane, the adopted operating pressure is 0.5-5 Mpa, and the flow rate is as follows: 1 to 3m ³ /h。

By combining all the technical schemes, the invention has the advantages and positive effects that: the invention relates to astragalus and liquorice, which can tonify lung qi, and the astragalus is recorded in the book of materia medica collection: for suppurative pus and blood ulceration of carbuncle and ulcer, yang qi deficiency can lead to muscle generation; for yin sores which cannot be initiated and yang qi deficiency which cannot be ulcerated, astragalus root can supposedly sepsis which is suitable for UC pathology, so it is used for the most part; radix Angelicae sinensis and Saviae Miltiorrhizae radix have blood circulation promoting and blood stasis dispelling effects; herba Houttuyniae, Scutellariae radix, and radix Sophorae Flavescentis have effects of clearing lung-heat, benefiting lung, eliminating dampness and removing toxic substance. The medicines are used for treating UC and UC lung injury common pathogenic factors of lung qi deficiency and damp-heat and blood stasis toxin, and have the effects of simultaneous treatment of both purgation and tonification and lung and intestine treatment, thus being beneficial to improving qi and blood circulation of local lung and intestine and the whole body and accelerating the repair of lung and intestine tissue injury.

The main monomer components of the invention, namely astragalus polysaccharide, diammonium glycyrrhizinate, sodium houttuyfonate and matrine, can play a protective role in different aspects of reducing inflammation, improving microcirculation, inhibiting apoptosis and the like on UC lung injury, and provide an early basis for further application of a compound.

The invention provides an action mechanism for treating UC and UC lung injury by using a Notch signal path and MIP-2 as entry points and a formula for tonifying qi, activating blood, clearing lung and detoxifying, so as to provide a basis for the application of the formula in the treatment of UC and promote the deep development of the formula.

The invention firstly searches the function of the Notch channel in the UC combined lung injury and provides experimental basis for determining the molecular target of the traditional Chinese medicine for resisting the UC and the UC lung injury; the UC treatment at home and abroad focuses on repairing damaged intestinal mucosa, and the qi-tonifying, blood-activating, lung-clearing and detoxifying prescription is effective in clinical application.

Drawings

In order to more clearly illustrate the technical solutions of the embodiments of the present application, the drawings required to be used in the embodiments of the present application will be briefly described below, and it is obvious that the drawings described below are only some embodiments of the present application, and it is obvious for those skilled in the art to obtain other drawings based on the drawings without creative efforts.

Fig. 1 is a flow chart of a preparation method of a traditional Chinese medicine preparation for treating ulcerative colitis provided by the embodiment of the present invention.

FIG. 2 is a schematic representation of HE staining (x 200) of colon tissue from various groups of rats provided by an embodiment of the present invention;

in fig. 2: (a) a normal group; (b) a model group; (c) a western medicine group; (d) low dosage group of Chinese medicinal materials; (e) high dosage group of Chinese medicinal materials.

FIG. 3 is a schematic representation of HE staining (x 200) of rat lung tissue from each group provided by an example of the present invention;

in FIG. 3: (a) a normal group; (b) a model group; (c) a western medicine group; (d) low dosage group of Chinese medicinal materials; (e) high dosage group of Chinese medicinal materials.

FIG. 4 is a graph 1 showing the expression of Notch-1mRNA in rat intestinal tissues of various groups according to the present invention.

FIG. 5 is a graph 2 showing the expression of Notch-1mRNA in lung tissues of rats in each group, according to the present invention.

FIG. 6 is an image of the Hes-1 protein in the intestinal tissues of various groups of rats provided by the example of the present invention;

in the figure: n: a normal group; m: a model group; x: a western medicine group; d: low dosage group of Chinese medicinal materials; g: high dosage of Chinese medicinal materials.

FIG. 7 is an image of the Hes-1 protein in lung tissue of various groups of rats provided by an embodiment of the present invention;

FIG. 8 is a graph showing MIP-2 protein expression and distribution (x 200) of lung tissues of rats in various groups according to an embodiment of the present invention;

in fig. 8: (a) a normal group; (b) a model group; (c) a western medicine group; (d) low dosage group of Chinese medicinal materials; (e) high dosage group of Chinese medicinal materials.

Detailed Description

In order to make the objects, technical solutions and advantages of the present invention more apparent, the present invention is further described in detail with reference to the following embodiments. It should be understood that the specific embodiments described herein are merely illustrative of the invention and are not intended to limit the invention.

Aiming at the problems in the prior art, the invention provides a traditional Chinese medicine preparation for treating ulcerative colitis, and the invention is described in detail with reference to the accompanying drawings.

The traditional Chinese medicine preparation for treating ulcerative colitis provided by the embodiment of the invention is prepared from 15-20% of astragalus root, 4-6% of liquorice, 15-20% of salvia miltiorrhiza, 6-10% of ligusticum wallichii, 25-30% of houttuynia cordata, 8-10% of scutellaria baicalensis and 8-10% of sophora flavescens.

Astragalus root, radix astragali, entering lung and spleen channels, can tonify qi, strengthen superficies, invigorate qi, activate blood, raise yang, arrest sweating, promote tissue regeneration, induce diuresis and alleviate edema. The "materia medica summary" records: for suppurative pus and blood ulceration of carbuncle and ulcer, yang qi deficiency can lead to muscle generation; for yin sores and yang deficiency without ulceration, Huang Qi can support sepsis. It mainly contains glycoside, polysaccharide and flavone compounds, and also contains various components of amino acid, protein, folic acid and trace elements, etc. and has the functions of resisting inflammation, raising immunity and resisting tumor, etc. According to clinical reports, intravenous drip of radix astragali injection is added on the basis of treatment of SASP or 5-ASA, cortical hormone, hemostasis, transfusion and the like, clinical symptoms of patients are obviously improved, hemoglobin has different degrees of rising, blood sedimentation is reduced, most of C-reactive protein turns negative, serum protein electrophoresis protein is obviously improved, the reduction of globulin alpha l and alpha 2 is also obvious, and UC can prevent relapse. Experimental research shows that astragalus polysaccharide can affect the content of IL-4, IL-5 and IL-13 and regulate immune balance, so that the inflammatory reaction of the colonic mucosa of UC rats is relieved.

The liquorice, which belongs to heart, lung, spleen and stomach channels, can tonify spleen and qi, clear away heat and toxic materials, eliminate phlegm and stop cough, relieve spasm and pain and harmonize the drugs. The glycyrrhizic acid and flavonoid contained in the composition are two main active ingredients of the liquorice for resisting ulcer. Decoction of radix Glycyrrhizae, glycyrrhizin, isoliquiritigenin, and total flavonoids of radix Glycyrrhizae can reduce intestinal canal tension and contraction, and has spasmolytic effect. Diammonium Glycyrrhizinate (DG) can inhibit the activation of NF-kB and the generation and expression of IL-6; scavenging oxygen free radicals, resisting oxidation injury, and inhibiting NO generation, and has therapeutic effect similar to that of 5-ASA. Meanwhile, the expression of monocyte chemotactic protein-1 (MCP-1) can be reduced, and the colonic inflammation degree of UC rats is reduced; the up-regulation of the expression of Foxp3 mRNA in peripheral blood mononuclear cells inhibits the proliferation of autoreactive T lymphocytes, and significantly improves rat UC. The DG substitute hormone for the Wang elegant animal experiment has obvious effect on treatment by combining SASP on the basis of a rat UC model, and the DG can substitute adrenocortical hormone to treat UC.

Dan Shen, which enters heart and liver meridians, can activate blood and resolve stasis, dredge meridians to alleviate pain, cool blood and cure abscess. Mainly contains tanshinone, salvianolic acid, danshensu and fatty acids. Zhang jin Zhuo et al found that the Dan Shen injection can significantly reduce the content of D-dimer in the serum of UC patients. Lixiangyong et al observe that the Salvia miltiorrhiza Bunge injection can obviously promote apoptosis of PMN in peripheral blood of UC patients in vitro, and simultaneously inhibit PMN of UC patients cultured in vitro from releasing O-2 and synthesizing NO, thus suggesting that Salvia miltiorrhiza Bunge has regulating effect on PMN apoptosis and active medium generation of UC patients. The salvia miltiorrhiza injection for the preventive intravenous administration of the cinnabar and the like to the rats can enhance the SOD activity of the intestinal tissues of the UC rats and reduce the MDA content, which shows that the salvia miltiorrhiza can enable the intestinal tissues to clear oxygen free radicals and greatly improve the oxidation resistance, thereby playing a role in protecting the mucous membranes. According to Chenshiwei experimental research, the danshensu can obviously reduce the levels of TNF-alpha and IL-1 beta of UC rats, and the danshensu and the tanshinone II-A have obvious improvement effects on the number of intestinal ulcer, the hyperemia index, the intestinal weight index and the histomorphology score.

Chuan Xiong enters liver, gallbladder and pericardium meridians. Activate blood and move qi, dispel wind and alleviate pain. Mainly contains volatile oil of ligustilide, alkaloid of ligustrazine, phenols of ferulic acid and organic acids. Clinical observation shows that the combination of the ligustrazine injection and the SASP for treating UC has obviously higher clinical efficacy evaluation than a control group which uses the SASP alone. Chenweixiong and the like find that P-selectin of UC mice treated by ligustrazine is obviously reduced, and DAI and pathological score are obviously improved. Can also up-regulate the plasma 6-Keto-PGF1 alpha of UC patients, reduce the ratio of TXB2 and TXB2/6-Keto-PGF1 alpha, show that the compound can resist platelet and protect the function of vascular endothelial cells, and has therapeutic effect on UC. It is found that ligustrazine has protective effect on UC colon mucosa, and the mechanism may be related to PPAR γ activation, NF- κ B inhibition, and reduction of inflammatory factor expression such as TNF- α.

Yu xing Cao enters lung meridian. Has the functions of clearing away heat and toxic material, eliminating carbuncle, expelling pus, promoting urination and treating stranguria. The contained sodium houttuyfonate has different degrees of inhibiting effects on various gram positive and negative bacteria such as staphylococcus aureus, diplococcus pneumoniae and the like; the non-volatile components have antiviral effect. Can enhance phagocytic ability of leukocyte and improve immunity. In addition, it can promote tissue regeneration and wound healing. Clinical observation shows that the cordate houttuynia distillate enema can enable a patient with active UC to obviously lower the colonic sensation threshold, the defecation threshold and the pain threshold to recover to normal, improve UC colonic motility disorder, relieve inflammation, and relieve diarrhea, mucopurulent bloody stool and tenesmus. After the houttuynia cordata injection is used for clysis of UC rats, the symptoms of congestion, edema, erosion, necrosis and the like of the intestinal mucosa of the rats are obviously relieved, and the treatment effect is not obviously different from that of the SASP group. The researches of Jingshan and the like find that the UC model group rats have obviously increased SP-A protein expression level at 0 and 4 weeks, possibly related to inflammatory injury, and the intestinal tissue SP-A protein expression is obviously reduced after the heartleaf houttuyniｃA herb sodium lavage treatment. Studies of the snow, the like prove that the sodium houttuyfonate can reduce the ratio of TXB2/6-Keto-PGF1 alpha of UC rat lung tissues, and the sodium houttuyfonate is prompted to effectively inhibit platelet aggregation and micro thrombus formation, improve the blood stasis state and inflammatory pathological change of the UC lung tissues and relieve the UC and lung injury caused by the UC.

Bai Qin enters lung meridian mainly for clearing lung heat, so it is the essential herb for treating cough due to lung heat, and can induce damp-heat in large intestine, so it is indicated for dysentery due to damp-heat. Mainly contains flavonoid components such as baicalin, baicalein, wogonin, etc. The scutellaria decoction has different degrees of inhibition effect on gram-positive bacteria such as staphylococcus aureus, hemolytic streptococcus, pneumococcus and the like and gram-negative bacteria such as escherichia coli, shigella dysenteriae, pseudomonas aeruginosa and the like in vitro. The experimental result shows that the UC rat is treated by the scutellaria baicalensis extract, the content of serum Malondialdehyde (MDA) is reduced, the SOD activity is increased, and the UC rat has a certain repairing effect on lesion colonic mucosa.

Ku Shen, entering heart, liver, stomach, large intestine and bladder meridians, can clear heat and dry dampness, kill parasites and relieve itching. Mainly contains alkaloids such as matrine and oxymatrine, and flavonoids such as kurarinol and kurarinone. The sophora flavescens decoction and the matrine have obvious inhibition effect on dysentery bacillus, escherichia coli and the like; matrine and oxymatrine have antiinflammatory and antiallergic effects. The kuh-seng can change clinical symptoms of abdominal pain, diarrhea and the like of patients with UC, and is one of the common traditional Chinese medicines for clinically treating UC. Research shows that the radix sophorae flavescentis can obviously improve the activity of the SOD of rats in the UC model, reduce the content of MDA and have dose-effect trend, which indicates that the radix sophorae flavescentis can interfere the UC pathogenesis by inhibiting oxygen free radical reaction.

Matrine can inhibit the release of inflammatory mediators, has similar anti-inflammatory effect to hydrocortisone, but has no toxic and side effects of hydrocortisone. Matrine can reduce capillary permeability and inhibit granulation tissue proliferation. In addition, matrine can balance the ratio of CD4+/CD8+ by increasing the number of CD8+ T cells, regulate the cellular immune function of an organism to achieve immune balance, and promote the recovery of UC lesion. Studies such as Jing et al found that after 4 weeks of gavage of UC model rats with matrine, SP-A precursor protein expression in rat intestinal tissues was significantly lower than that in the model group. Studies such as Yangxue prove that the matrine can effectively increase the content of 6-Keto-PGF1 alpha of a rat with a UC model, and can reduce the TXB2/6-Keto-PGF1 alpha ratio and the serum P-selectin level, which indicates that the matrine can effectively inhibit platelet aggregation and the formation of microthrombus, improve the blood stasis state and inflammatory pathological change of UC lung tissues, and reduce UC and lung injury caused by UC.

As shown in fig. 1, the preparation method of the traditional Chinese medicine preparation for treating ulcerative colitis provided by the embodiment of the present invention includes the following steps:

s101, cleaning astragalus membranaceus, liquorice, salvia miltiorrhiza, ligusticum wallichii, houttuynia cordata, scutellaria baicalensis and sophora flavescens, and respectively soaking the materials in clear water for 30 minutes;

s102, mixing the soaked astragalus, liquorice, salvia miltiorrhiza, ligusticum wallichii, houttuynia cordata, scutellaria baicalensis and sophora flavescens, and adding 3 times of water for decoction;

s103, filtering and concentrating to obtain the traditional Chinese medicine preparation for treating ulcerative colitis.

Further, the decocting specifically comprises:

1) putting and soaking medicinal materials: soaking radix astragali, Glycyrrhrizae radix, Saviae Miltiorrhizae radix, rhizoma Ligustici Chuanxiong, herba Houttuyniae, Scutellariae radix, and radix Sophorae Flavescentis; then taking the decocting device, adding water to the surface of the medicinal materials, and soaking; squeezing and soaking the medicinal materials until there is no gap, adding purified water until the water level is higher than the upper surface of the medicinal materials, and soaking;

4) second decoction: decocting under normal pressure, boiling, stopping heating, collecting the medicinal liquid, squeezing the medicinal materials until no medicinal liquid remains, mixing the medicinal liquids, and mixing;

Further, the first frying: decocting under 0.15Mpa, and boiling for 30 min; stopping heating, collecting the liquid medicine while the liquid medicine is hot, and extruding the medicinal materials until no residual liquid medicine is left in the liquid medicine.

the filtration pressure is 0.01-0.8 MPa when the inorganic ceramic membrane or stainless steel tubular membrane is adopted, the filtration temperature is 4-85 ℃, and the membrane flux is 20-300L/m ² ·h；

The organic membrane is polysulfone membrane, cellulose acetate membrane, polyamide membrane, polytetrafluoroethylene membrane, polyvinylidene fluoride membrane or polypropylene membraneThe filtration pressure is 0.1-1.0 MPa, the filtration temperature is 4-45 ℃, and the membrane flux is 20-300L/m ² ·h；

The technical effects of the present invention will be further described with reference to specific embodiments.

Example 1:

a, background

(I) pulmonary injury due to UC

In 1976, Kraft first proposed the idea that IBD may involve the lungs, and in recent years, foreign scholars paid more attention to the respiratory symptoms of IBD, but this is not generally recognized in China. The epidemiological investigation of multicenter large samples carried out by a team in the Chilo hospitals of Beijing, Shanghai, Henan, Jiangsu and the like in China shows that 58.6 percent of UC patients can have lung symptoms.

Secondly, lung inflammation caused by activation of Notch access after intestinal mucosa injury is probably an important pathological mechanism for UC combined lung injury

The UC takes the continuous injury of the colon epithelial mucosa as the main pathological change, the intestinal mucosa injury during the UC and the integrity destruction of the intestinal mucosa barrier lead to the displacement of bacteria, antigens and other substances in the intestinal cavity to the inherent layer of the mucosa to activate immune cells, and release antibodies, cytokines, inflammatory mediators and the like which can pass through the injured intestinal mucosa epithelium to enter the lymphatic system and blood circulation, thereby causing the extraintestinal inflammatory reaction and tissue injury of the lung and the like. The activation of the Notch signal pathway under physiological state keeps a balance and coordination relationship in the aspects of promoting the proliferation and regulating the differentiation of the colonic epithelial cells, and the moderate activation of the Notch signal pathway can effectively promote the renewal of the colonic epithelial cells and keep the normal differentiation balance between the absorbing cells and the secreting cells. Meanwhile, the Notch signal pathway controls the reticular balance among cytokines by regulating the proliferation and differentiation of T cells, and regulates the intestinal immune system. This balance is broken during the onset of UC, manifested by a change in the extent and area of activation of the Notch signaling pathway in the colonic mucosa and a disruption in the intestinal immune balance. The Notch signal pathway is regulated, and the target gene Hes-1 acts on downstream target genes to promote the proliferation of intestinal stem cells, regulate the differentiation of intestinal epithelial cells, promote the repair of colon mucosal barrier and the regeneration of intestinal epithelium, thereby achieving the purpose of treating UC. The Notch signaling pathway also plays an important role in many diseases of pulmonary injury. It is found that the lung tissue homogenate of UC rats at 2 and 4 weeks has obviously increased contents of inflammatory cytokines TNF-alpha and IL-1 beta (P is less than 0.01), and the lung tissue pathomorphology shows that inflammatory cell infiltration exists, so that the invention further judges whether UC lung tissue inflammation is caused by Notch pathway activation. Meanwhile, macrophages are important links of innate immunity, alveolar macrophages are resident cells in the lung and are the first innate immune barrier in the lung, and when the lung is invaded by pathogens or is harmfully stimulated, a Notch signal pathway is activated, alveolar macrophages are activated early, and inflammatory reaction is started. Therefore, the invention starts with a Notch signaling pathway and macrophage inflammatory protein-2 (MIP-2), and proposes a working hypothesis that 'the lung inflammation caused by activating the Notch pathway after the intestinal mucosa injury is probably an important pathological mechanism of UC combined with lung injury'.

At present, the main foundation for the correlation between the Notch signal pathway and the UC is mainly the basis, no means and drugs capable of effectively interfering the Notch signal pathway are found, the pathological mechanism of the UC is disclosed to help to search for effective intervention measures aiming at targets, and a treatment method capable of simultaneously protecting and repairing the lung and intestine injury is searched, so that the UC patient may be provided with good news.

(III) benefiting qi, activating blood circulation, clearing lung-heat, detoxicating and treating UC and UC lung injury

According to the theory of traditional Chinese medicine, the lung governs qi, and qi is closely distributed with blood and body fluids. Based on the deepening of the theory of 'exterior and interior of the lung and large intestine' and the objective existence of UC combined lung injury, the further search of the pathological mechanism of UC lung and intestine concordance and the search of effective treatment methods and medicaments are important subjects for treating UC and UC lung injury in clinical Chinese medical science.

The inventor considers the pathogenesis characteristics of long-term, blood stasis, stubborn and miscellaneous UC, combines the intestinal collateral damage expressions of congestion, swelling, erosion, blood vessel network blurring under enteroscope and the like of mucous membrane under enteroscope, and proposes the pathogenesis hypothesis of toxic damage of intestinal collateral, wherein the intestinal collateral damage caused by long-term damp-heat blood stasis toxin is considered as the pathogenesis key of repeated attack and lingering and difficult healing of UC, and the pathogenesis of UC lung injury is considered as' toxic damage of intestinal collateral, and toxic pathogen attacks lung upwards; the damp-heat and blood stasis can affect the lung and impair the lung qi over time, affecting the dispersing, descending and descending of the lung. Failure of the lung to disperse and descend, failure of body fluids to distribute and function, and failure of qi and blood circulation, aggravate intestinal qi and blood stasis, which may cause recurrent UC attacks and persistent and difficult recovery due to improper diet and emotional distress, and may lead to various extra-intestinal manifestations. The qi-tonifying, blood-activating, lung-heat-clearing and detoxifying prescription consists of 7 medicines of astragalus, liquorice, salvia miltiorrhiza, ligusticum wallichii, houttuynia cordata, scutellaria baicalensis and sophora flavescens, wherein the astragalus and the liquorice tonify lung qi, and the astragalus is recorded in the book of materia medica collection: for suppurative pus and blood ulceration of carbuncle and ulcer, yang qi deficiency can lead to muscle generation; for yin sores which cannot be initiated and yang qi deficiency which cannot be ulcerated, astragalus root can supposedly sepsis which is suitable for UC pathology, so it is used for the most part; the angelica and the salvia activate blood circulation to dissipate blood stasis; herba Houttuyniae, Scutellariae radix, and radix Sophorae Flavescentis have effects of clearing lung-heat, benefiting lung, eliminating dampness, and removing toxic substances. The medicines are used for treating UC and UC lung injury common pathogenic factors of lung qi deficiency and damp-heat and blood stasis toxin, and have the effects of simultaneous treatment of both purgation and tonification and lung and intestine treatment, thus being beneficial to improving qi and blood circulation of local lung and intestine and the whole body and accelerating the repair of lung and intestine tissue injury.

Second, content

Mechanism of Notch signaling pathway mediated UC lung injury

A rat UC model is established by adopting an immune composite method of colon mucosal tissue sensitization and TNBS-ethanol, and a regulation and control mechanism of a Notch signal path on UC lung injury is searched by observing related proteins and gene expression of a Notch path of rat lung and intestinal tissues and distribution and expression change of MIP-2 proteins of lung tissues.

2. Molecular mechanism for resisting UC and UC lung injury by inhibiting inflammatory reaction caused by activation of macrophages by Notch pathway

The common menstruation formula peony decoction for treating UC is used for intervening UC rats, and molecular action ways and targets of UC combined lung injury are searched from conventional pathological sections, Notch channels and MIP-2, so that a molecular mechanism for resisting UC and UC lung injury caused by the fact that the formula for tonifying qi, activating blood, clearing away lung heat and detoxifying activates macrophages by inhibiting the Notch channels is disclosed.

Third, the implementation conditions (including methods, steps, experimental means, key technologies, results, etc.)

Method (A)

1. Experimental animals: healthy male Wistar rats 60 with a body weight of 200 + -10 g. 1 male healthy New Zealand white rabbit weighing about 2.5 kg.

2. Experimental drugs: the prescription for tonifying qi, activating blood, clearing lung-heat and detoxifying is prepared by decocting in a laboratory of college of traditional Chinese medicine of North China university, wherein the crude drug amount is 5g/ml for intragastric administration and is 1 ml/day. The western medicine sulfasalazine enteric-coated tablet (SASP) is prepared into an aqueous solution after ultrasonic crushing treatment, and each milliliter of the aqueous solution contains 0.125g of SASP.

3. Establishment of animal model

Rat UC model was replicated by immune-complexing with colonic mucosal tissue sensitization plus TNBS-ethanol. Killing healthy male New Zealand rabbits by air embolism method, dissecting colon, cleaning colon contents for several times with physiological saline, scraping colon mucous membrane tissues with a disinfection blade, adding precooled physiological saline with the same amount to prepare homogenate, centrifuging at 4 ℃, 3000rpm for 30min, taking supernatant, using a small amount of supernatant for protein quantification by the biuret method, and adding Freund's adjuvant with the same volume to prepare antigen emulsion. Injecting antigen emulsion into the parts of toes, groin, etc. of rat at 1d, 15d, and 22d, respectively, each injection amount containing 8mg antigen. Preparing TNBS into a solution with the concentration of 120mg/ml, mixing the TNBS solution with 50% ethanol according to the volume ratio of 1: 1 and mixing. At 29d, after the rats were fasted for 24 hours without water deprivation, 10% chloral hydrate (0.35ml/100g) was anesthetized by intraperitoneal injection, and clystered with TNBS-50% ethanol at 100mg/Kg of TNBS body weight. The rats naturally revive after the anesthetic failure.

4. Experimental group design and administration

After 7 days of adaptive feeding of 60 rats, 10 rats were randomly selected as normal control group, and the remaining 50 rats replicated the UC model. (4 rats in the model group are randomly selected on the 3 rd day after model building, and if the pathological intestinal mucosa has obvious ulcerative manifestation and inflammatory cell infiltration under the microscope, the UC model building is marked to be successful). The model rats were randomly divided into four groups, namely a model group, a western medicine group, a traditional Chinese medicine low-dose group and a traditional Chinese medicine high-dose group, each group containing about 12 rats. The therapeutic groups are respectively administered with sulfasalazine tablets (SASP), the high and low doses of the formula for benefiting qi, activating blood circulation, clearing lung-heat and detoxifying are infused for 3 weeks, and the normal group and the model group are infused with the same volume of normal saline. The normal group of rats is not modeled, and is synchronously fasted and anesthetized with the other two groups, and synchronously fed and observed. The stomach-irrigation dosage of the qi-tonifying, blood-activating, lung-heat-clearing and detoxifying prescription is calculated according to 8 times of the dosage of an adult with the weight of 60 kg; the normal group and the model group were perfused with equal volume of drinking water for 1 time a day. Rats were sacrificed by abdominal aortic blood sampling at the time of 3w drug administration for sampling. During the drug intervention period, 1 rat in the model group died from the gastric lavage accident, 1 rat in the western medicine treatment group died from the bite wound, and 4 rats died from the UC intestinal flatulence.

5. Specimen collection and index detection

Before material taking, 10% chloral hydrate (0.35ml/100g) of a rat is subjected to intraperitoneal injection and anesthesia, the abdominal cavity is opened along the abdominal midline, blood is taken from an abdominal aorta, tissues of colon and upper lobe of right lung of a typical lesion part 5-15cm above the anus are rapidly stripped, part of tissues are fixed for morphological detection, and the rest tissues are frozen in a liquid nitrogen-80 ℃ refrigerator for preservation and are used for western blot, RT-PCR and immunohistochemical detection.

(1) And (3) HE staining pathological morphology observation: rat chloral hydrate (0.35ml/100g) is injected into abdominal cavity for anesthesia, the abdominal cavity is opened along the midline of the abdomen, the colon of a typical lesion part above the bellyband is cut approximately upwards, and the upper lobe tissue of the right lung is extracted. Flushing the colon with 4 ℃ physiological saline to remove intestinal contents, rinsing surface blood clots of lung tissues, putting the colon tissues into 10% neutral formalin for fixation, embedding the colon tissues in normal paraffin, dewaxing the sections with the thickness of 4 mu m, then performing hematoxylin and eosin staining, and observing pathological morphological changes of the lung and intestinal tissues under an optical microscope.

(2) Detecting the expression of the Notch-1 gene in UC rat lung and intestine tissues by an RT-PCR method;

a. primer sequence upstream primer: 5 'CACCCATGACCACTACCCAGTT 3'

A downstream primer: 5 'CCTCGGACCAATCA-GAGATGTT 3'

The amplified fragment is 186bp

RNA extraction: the operation is carried out according to the tissue cell RNA extraction kit.

c. Reverse transcription: the PrimeScript RT Master Mix perfect Real Time kit is adopted for carrying out the operation; reaction system: the reaction was repeated three times in a total volume of 20. mu.l/sample, three duplicate wells per sample.

Reaction conditions are as follows: 42 ℃ for 1 hour to 70 ℃ for 5min to 4 ℃ forever.

d.RT-PCR

Reaction system: the reaction was repeated three times in a total volume of 20. mu.l/sample, three duplicate wells per sample.

(3) Detecting the expression of the Hes-1 protein in UC rat lung and intestine tissues by a Western blot method;

a. protein extraction:

and (3) adding a proper amount of centrifuged cells into the ripa lysate and the 5X protein loading buffer solution, mixing, and performing ultrasonic treatment. And (4) preserving in a refrigerator at the temperature of minus 80 ℃.

The protein is boiled in boiling water for 5min before loading to prepare for loading.

b. Preparation of SDS-PAGE gels:

10% separating glue solution 12ml (two pieces glue)

5ml of 5% concentrated glue (two-piece glue)

c. Electrophoresis: voltage 80V

d. Electric conversion: cutting the PVDF membrane and the filter paper into PVDF membranes with the same size (5 multiplied by 8cm) as the gel, soaking the PVDF membranes required by membrane transfer in methanol in advance, and then transferring the PVDF membranes into a transfer buffer solution for soaking; soaking filter paper, sponge and gel in the transfer buffer solution;

100V-75 min-2h (according to different sizes of target strips), an ice band is placed inside, ice is buried outside, and a sandwich sequence is as follows: black-sponge + 5 pieces of filter paper + glue + membrane + 5 pieces of filter paper + sponge-white

1L of electrotransformation liquid: 100ml 10 Xelectrotransformation liquid, 200ml methanol and 700ml double distilled water are prepared in advance when in use and refrigerated at 4 DEG C

e. And (3) sealing: 5% skimmed milk powder (TBST configuration)

Add 10ml of blocking solution and block it on a shaker at room temperature for 1.5 hours.

f. Hybridization of

Primary antibody incubation: 1: 1000 (5% skimmed milk preparation), 4 deg.C overnight, afternoon the next day, 5 times TBST washing for 5min each, and secondary antibody

And (3) secondary antibody incubation: 1: 5000(PBS preparation), incubating at room temperature for 1h on a shaker, washing with TBST for 5 times, each time for 5min, and developing

g. Color development:

exposure and development: developing solution: 1: 1 ratio of 2ml each, and the amount was determined according to the size of the membrane.

The operation is as follows: and (3) placing the film on a preservative film, uniformly dripping a developing solution, and standing for 1 min. And (6) exposing the instrument.

(4) Detecting the MIP-2 expression and distribution of rat lung tissue by an immunohistochemical method.

Dewaxing and hydrating the tissue slices with xylene and gradient alcohol, incubating with 0.3% H2O2 at room temperature for 10min to remove peroxidase, sealing goat serum at 37 deg.C for 30min, and diluting with primary anti-MIP-2 to a concentration of 1: 1000. Incubate at 4 ℃ overnight. The secondary antibody incubations were performed with reference to the reagent instructions. DAB color development, hematoxylin counterstain, dehydration, transparency and neutral gum sealing. Each section was photographed at 400 x under a random selection of 5 fields and analyzed using Image Pro Plus 6.0 software.

(II) results

Pathological morphological observation of UC rat lung and intestine tissue

(1) Pathological morphological change of colon tissue of rats in each group

Normal group: the colon mucous epithelium is complete and continuous, has clear structure, regular gland arrangement, no inflammatory cell infiltration, and no congestion, edema and ulcer; model group: the colonic mucosa has the manifestations of congestion, edema, erosion and ulcer, a large amount of lymphocytes and neutrophil infiltration under the endoscope mainly invade mucosa, mucosal muscularis and withered submucosa, and severe cases show transmural necrosis, local mucosa deficiency or disorganization, goblet cell loss, gland atrophy and destruction, and vascular tension and congestion of the lamina propria, mucosa and serosa around or below the diseased part. Western medicine group: the infiltration of inflammatory cells of the mucous membrane and the submucosa is reduced compared with that of a model group, the vasculitis is obviously relieved, but the hyperplasia of glandular and granulation tissues is not obvious. The traditional Chinese medicine treatment group comprises: the colon tissue structure is complete, the glands are arranged tidily, the necrotizing property is obviously reduced compared with a model group, the ulcer is reduced, the inflammatory cell infiltration and the vasculitis are obviously reduced, and the granulation tissue hyperplasia is active. (see FIG. 2)

(2) Pathological morphological changes of lung tissue of rats in each group

Normal group: the lung tissue is light pink, the outline of the lung lobe is clear, and the lung lobe is smooth and has good elasticity. Under the microscope, the lung has clear structure without edema and fibrosis, and a few rat lung tissues can be subjected to mild inflammatory cell infiltration. The lung interstitium of the model group has a large amount of inflammatory cell infiltration, fibrous tissue hyperplasia and narrow alveolar space. Compared with the western medicine treatment group and the model group, the western medicine treatment group has no obvious improvement. The Chinese medicine lung tissue inflammatory cell infiltration is reduced to some extent, the thickening of the bronchial wall and the blood vessel wall is lighter than that of a model group, and the improvement is more obvious by using a Chinese medicine high-dose group. (see FIG. 3)

2. Expression of Notch-1mRNA in rat Lung and intestine tissues of various groups

(1) Expression of Notch-1mRNA in rat intestinal tissue of each group: compared with the normal group, the expression of the Notch-1mRNA in the intestinal tissue of the model rat presents an ascending trend, the drug groups are all reduced, and the difference has statistical significance (P is less than 0.01). (see FIG. 4, Table 1)

TABLE 1 Notch-1mRNA expression in rat intestinal tissue of each group: (

n＝6)

	N	M	X	D	G
						Notch-1	1.1±0.16 ^*	3.3±1.9	0.76±0.29 ^*	0.62±0.098 ^*	1.1±0.34 ^*

Note: in comparison with the set of models, ^* P＜0.01。

(2) expression of Notch-1mRNA in rat lung tissue of each group: compared with the normal group, the expression of the Notch-1mRNA in the intestinal tissue of the model rat is in an ascending trend, the western medicine treatment group and the traditional Chinese medicine low-dose group are in a descending trend, and the difference of the traditional Chinese medicine low-dose group has statistical significance (P is less than 0.05). (see FIG. 5, Table 2)

TABLE 2 Notch-1mRNA expression in rat Lung tissues of various groups: (

n＝6)

	N	M	X	G	D
						Notch-1	1.1±0.4 ^*	1.7±0.46	1.5±0.48	2±0.39	0.58±0.2 ^*

Note: in comparison with the set of models, ^* P＜0.01。

3. expression of Hes-1 protein in Lung and intestinal tissues of rats in various groups

(1) Expression of the Hes-1 protein in rat intestinal tissue of each group: western-blot detection shows that the expression of the Hes-1 protein in the intestinal tissues of the rats of the model group is obviously increased at 3 weeks. The expression of each treatment group is in a descending trend compared with that of a contemporary model group, the down regulation of the expression of the histone treated by high dosage of the traditional Chinese medicine is most obvious, and the difference has statistical significance (P is less than 0.05 or P is less than 0.01). (see FIG. 6, Table 3)

TABLE 3 quantitative analysis results of Hes-1 protein image in rat intestinal tissues of each group: (

n＝4)

	N	M	X	D	G
						Hes-1	0.67±0.23	1.4±0.22 ^**	1.2±0.15	0.93±0.34 ^△	0.55±0.02 ^△△

Note: in comparison with the normal group, ^** p is less than 0.01; in comparison with the set of models, ^△ P＜0.05， ^△△ P＜0.01。

(2) expression of the Hes-1 protein in the lung tissue of rats in each group: western-blot detection shows that the expression of the Hes-1 protein in the lung tissue of the rat of the model group is obviously increased at 3 weeks. The expressions of the western medicine group and the traditional Chinese medicine low-dose group are in a descending trend compared with the expression of the same-phase model group, the expression of the histone is reduced most obviously by using the traditional Chinese medicine low-dose treatment, and the difference has statistical significance (P is less than 0.05 or P is less than 0.01). (see FIG. 7, Table 4)

TABLE 4 quantitative analysis results of Hes-1 protein image in rat intestinal tissues of each group: (

n＝4)

	N	M	X	D	G
						Hes-1	0.65±0.28	1.2±0.27 ^**	1.1±0.14	0.85±0.1 ^△△	1.3±0.28

4. distribution and expression of MIP-2 protein in lung tissue of rats in each group

Compared with the normal group, the MIP-2 protein is abundantly expressed in the lung tissue of the rat in the model group and is brownish yellow. Compared with the model group, the western medicine group has no obvious change in the MIP-2 protein expression of the rat lung tissue, the MIP-2 protein expression of the Chinese medicine treatment group is obviously weakened, and the difference has statistical significance (P is less than 0.05) compared with the model group. (see FIG. 8, Table 5) Table 5 results of quantitative analysis of MIP-2 protein images in lung tissues of rats in each group: (

n＝6)

the above description is only for the purpose of illustrating the present invention and the appended claims are not to be construed as limiting the scope of the invention, which is intended to cover all modifications, equivalents and improvements that are within the spirit and scope of the invention as defined by the appended claims.

Claims

1. The traditional Chinese medicine preparation for treating ulcerative colitis is characterized by being prepared from 15-20% of astragalus, 4-6% of liquorice, 15-20% of salvia miltiorrhiza, 6-10% of ligusticum wallichii, 25-30% of houttuynia cordata, 8-10% of scutellaria baicalensis and 8-10% of sophora flavescens according to mass percentage;

the preparation method of the traditional Chinese medicine preparation for treating ulcerative colitis comprises the following steps: