CN112592925A - Lycium ruthenicum stable genetic transformation system and application thereof - Google Patents

Abstract

The invention discloses a lycium ruthenicum stable genetic transformation system and application thereof, and a spine-free lycium ruthenicum sucrose synthaseSUSThe gene has a sequence shown in a sequence table SEQ ID NO. 1; a transgenic plant expression vector plasmid is characterized by that said transgenic plant expression vector plasmid is inserted in the plant expression vectorSUS+XA fusion gene; a stable genetic transformation system of lycium ruthenicum comprises: pre-culturing a lycium ruthenicum leaf tip explant, and adding recombinant agrobacterium to infect; inoculating and dark culturing; after co-culture, cleaning, inoculating the explant to a selective culture medium, and culturing until the explant begins to bud to form a complete resistant plantlet; cutting a stem with a top bud, inoculating the stem into a resistant rooting culture medium, and culturing until the bud can root and grow normally; has the advantages that: is free ofThe hormone and low-concentration Kana screening leads the resistant plants to grow well; the fusion gene reduces the toxicity of green fluorescent protein to the lycium ruthenicum, the plant can grow normally and is transformed stably, and the transformation efficiency is high; does not pass through a callus stage, shortens the transformation period and reduces the pollution of agrobacterium.

Description

Lycium ruthenicum stable genetic transformation system and application thereof

Technical Field

The invention belongs to the field of forest biotechnology and molecular biology, and particularly relates to a lycium ruthenicum stable genetic transformation system and application thereof.

Background

Lycium ruthenicum Murr is perennial shrub of Lycium of Solanaceae, has plant height of about 20-50 cm, is mainly distributed in northwest desert areas of Ningxia, Qinghai, Gansu, Xinjiang and the like, is in flaky cluster distribution, is drought-resistant and barren, is a dominant species and a mass-building species of desert communities in the area of Fangxin in the black river basin, and plays an important role in water and soil conservation, wind prevention, sand fixation and the like. The lycium ruthenicum fruit contains rich amino acid, anthocyanin, polysaccharide, polyphenol and other active ingredients, wherein the content of the procyanidine is the highest of the fruits, and the lycium ruthenicum fruit has high medicinal value and is a common medicament for vitamin and Tibetan medicines. With the gradually paid attention to the ecological value and economic value of lycium ruthenicum, the research on the gene function of lycium ruthenicum is deepened day by day. At present, researches on lycium ruthenicum mill mainly focus on extraction processes and pharmacological analysis of fruit nutritional ingredients, medicinal ingredients, pigments and polysaccharides. Researches show that the fruit components of the fruit have the functions of resisting radiation, regulating intestinal flora, resisting oxidation, resisting cancer, resisting fatigue, enhancing immunity, resisting aging and the like. In addition, recent research finds that lycium ruthenicum polyphenol can delay the occurrence and the progression of oxidative stress related neurodegenerative diseases; lycium ruthenicum Murr polysaccharide plays a role in neuroprotection on primary cortical neuron injury of rats induced by oxygen glucose deprivation/reoxygenation. Lycium ruthenicum Murr is also called "the king of natural procyanidin". The lycium ruthenicum pigment is a non-toxic substance and has good food safety. The pigment has the characteristics of strong tinting strength, good stability, simple processing and the like, and can be widely applied to the industries of medicine, food, textile and the like. In conclusion, the lycium ruthenicum murr is an important ecological economic shrub and has a wide development and application prospect.

Despite the advantages, the lycium ruthenicum has the production disadvantages of more thorns, thin peel, easy root rot and the like. The rapid and effective stable genetic transformation system of the lycium ruthenicum mill can be used for revealing the functions of key excellent character related genes and achieving the purpose of rapid molecular breeding and improvement of unfavorable characters.

The currently reported stable genetic transformation systems of lycium ruthenicum are regeneration systems based on callus, and agrobacterium strains GV3101 are adopted; no report of successful transformation of lycium ruthenicum by agrobacterium strains EHA105 and LBA4404 is found, and no report of stable genetic transformation of lycium ruthenicum based on rapid direct organogenesis is found. The screening method for stable genetic transformation of agrobacterium-mediated plants comprises a positive selection method and a negative selection method. Negative selection methods based on antibiotics and herbicides are more commonly used. However, since the negative selection principle is that the cells/tissues which are not successfully transformed die on the resistant medium, part of the cell death usually causes damage to the surrounding successfully transformed cells, so that the resistant plants cannot be obtained if the successfully transformed cells exist.

Disclosure of Invention

The invention aims to provide a lycium ruthenicum stable genetic transformation system and application thereof.

Lycium ruthenicum murr sucrose synthase without thornSUSThe base sequence of the gene is shown in a sequence table SEQ ID NO. 1.

A transgenic plant expression vector plasmid is characterized by that said transgenic plant expression vector plasmid is inserted in the plant expression vectorSUS。

A transgenic plant expression vector plasmid is inserted in plant expression vectorTo masterSUS+XThe fusion gene is a gene which is expressed by the gene,Xrepresents a gene of interest of the transgene,SUSthe gene is a gene shown as SEQ ID NO.1 of a sequence table;

saidXIs a GFP gene;

the plant expression vector is pRI101 AN.

A recombinant agrobacterium transformed with said one transgenic plant expression vector plasmid;

the agrobacterium is EHA105 or LBA 4404.

A stable genetic transformation system of lycium ruthenicum comprises:

1) preculturing the lycium ruthenicum leaf apex explant for 1-2 days, and adding the recombinant agrobacterium tumefaciens for infection, wherein the preculturing culture medium consists of 4.74g/l of MS dry powder, 40g/l of sucrose and 4.8g/l of agar;

2) after infection, inoculating the explant into a co-culture medium, and performing dark culture until white agrobacterium is grown around the leaf explant; the co-culture medium consists of 4.74g/l MS dry powder, 40g/l sucrose, 4.8g/l agar and 100 mu M AS;

3) after co-culturing, washing the lycium ruthenicum leaf explant by using sterile water containing 500 mg/l Cef; inoculating the explant to a selective culture medium, and culturing until the explant begins to bud to form a complete resistant plantlet; the selective medium consists of 4.74g/l of MS dry powder, 40g/l of sucrose, 4.8g/l of agar, 3mg/l of Kana and 300mg/l of Cef;

4) the bud of the resistant plantlet in the step 3) grows to 4.5-5.5 cm in height, 1.5-2.5 cm of stem with a top bud is cut, inoculated into a resistant rooting culture medium and cultured until the bud can root and grow normally; the resistant rooting medium consists of 2.37g/l of MS dry powder, 20g/l of sucrose, 4.8g/l of agar, 5 mg/l of Kana and 300mg/l of Cef.

The invention provides a lycium ruthenicum murr sucrose synthase without thornSUSThe base sequence of the gene is shown as a sequence table SEQ ID NO. 1; a transgenic plant expression vector plasmid is characterized by that said transgenic plant expression vector plasmid is inserted in the plant expression vectorSUS+XThe fusion gene is a gene which is expressed by the gene,Xrepresents a gene of interest of the transgene,SUSthe gene is shown as SEQ ID N of the sequence tableA gene represented by O.1; a stable genetic transformation system of lycium ruthenicum comprises: pre-culturing the lycium ruthenicum leaf apex explant for 1d, and adding the recombinant agrobacterium tumefaciens for infection; after infection, inoculating the explant into a co-culture medium, and performing dark culture until white agrobacterium is grown around the leaf explant; after co-culturing, cleaning the lycium ruthenicum leaf explant by using sterile water; inoculating the explant to a selective culture medium, and culturing until the explant begins to bud to form a complete resistant plantlet; when the buds grow to 4.5-5.5 cm in height, cutting 1.5-2.5 cm of stem with top buds, inoculating the stem into a resistant rooting culture medium, and culturing until the buds can root and grow normally;

the invention has the beneficial effects that: the stable genetic transformation of the lycium ruthenicum is realized by adopting agrobacterium strains EHA105 and LBA4404, and the transformation efficiency is as high as 8.33-16.65%;thornlessSUSfrom Lycium ruthenicum Murr; no exogenous hormone is needed in the whole process; the callus stage is not needed, the transformation period is shortened, and the possibility of agrobacterium contamination is reduced; the low-concentration Kana can achieve the screening effect and reduce the damage to plant materials; hormone-free and low-concentration Kana screening leads to good and robust growth of resistant plants; the high-expression green fluorescent protein is found to be toxic to lycium ruthenicum and the plant has unfavorable characters of slow growth and the like, but the high expression green fluorescent protein is highGFPAndthornlessSUSthe fusion gene SUSGFP can reduce the toxicity, and the plant can grow normally and form high expressionthornlessSUSThe Lycium ruthenicum Murr plant has the characteristics of thick stem, strong root tillering capability, large increase of fibrous root quantity and the like.

The invention establishes a screening transformation system with extremely low kanamycin (Kana) concentration. At this concentration untransformed successful explants will not form plants, but will not die as quickly; the explants which are successfully transformed can quickly form healthy resistant plants; a rapid, efficient, low-cost and easy-to-operate stable genetic transformation system of lycium ruthenicum is established, which comprises screening and establishing a target gene group, successfully cloning a saccharose synthase gene (lycium ruthenicum murr) (athornlessSUS) Full length CDS of (1), construction of a plasmid containing a single geneGFP、thornlessSUSThe overexpression vector of (3), construction of fusion-containing GenethornlessSUS-GFPThe overexpression vector of the gene is screened and established to a receptor plant population,transforming Lycium ruthenicum Murr to obtain resistant plant expressing target gene, and identifying the transgenic plant.

Drawings

FIG. 1 is a diagram showing the structure of an expression unit of an expression vector; (A) pRI-GFP; (B) pRI-SUS; (C) pRI-SUSGFP;

FIG. 2 screening of leaf explants of Lycium ruthenicum Murr Kana concentration; A. leaf explants rooted after inoculation for 14d (control); B. rooting explants started to bud after 28 days of inoculation (control); C. leaf explants with Kana concentration of 3mg/l after 30 days of inoculation; D. leaf explants with Kana concentration higher than 3mg/l after 30 days of inoculation;

FIG. 3 shows transgenic Lycium ruthenicum plants obtained by Agrobacterium transformation; A. screening out the lycium ruthenicum leaf tip explants which are not transformed in the culture for 30 days (control); B. transformed rooted leaf tip explants at 17d of selection culture; C-E, screening the explant of the bud leaf which is transformed during the culture for 30 d; f, G, inoculating the transgenic plant after 20 days in a rooting medium containing Kana and Cef; H. untransformed plants inoculated in rooting medium 20d containing Kana and Cef; I. rooting conditions of transgenic plants (left) and plants (right) which are not transformed;

FIG. 4 PCR validation of pRI-SUS vector transgenic plants; m: DL2000 DNA Plus Marker; 1-4: transgenic resistant plants; 5,6: negative control, untransformed plants; 7: positive control, pRI-SUS vector; 9: blank control, water;

FIG. 5 PCR validation of pRI-SUSGFP vector transgenic plants. M: DL2000 DNA Marker; 1-4: transgenic resistant plants; 5,6: negative control, untransformed plants; 7: positive control, pRI-SUSGFP vector plasmid; 8: blank control, water;

FIG. 6 semi-quantitative PCR validation of pRI-SUS vector transgenic plants. M: DL2000 DNA Marker; 1: water (control); 2-3: untransformed plant roots; 4-5: untransformed plant stems; 6-7: untransformed plant leaves; 8-9: transforming the resistant plant roots; 10-11: transforming resistant plant stems; 12-13: transformation of resistant plant leaves

FIG. 7 laser confocal microscopy of Transfusogenic genesSS-GFPThe lycium ruthenicum leaves.

Detailed Description

Example 1thornlessSUSCloning of genes

Original experimental materials: mature seeds are collected from a plurality of spiny adult lycium ruthenicum murr, after accelerating germination for 24 h at 37 ℃ under the humid condition, surface sterilization is carried out in an ultra-clean workbench (30-60S is processed by 75% alcohol, 1-2 min is processed by 0.1% mercury bichloride, 3-5 times is washed by sterile clear water), and after surface moisture is sucked dry, the seeds are transversely inoculated to 1/2MS culture medium (1/2 MS macroelements, 1/2MS microelements, 1/2MS ferric salts, 1/2MS organic components, 2% sucrose, 0.45-0.5% agar powder, and the pH value is 5.8-6.0). Culturing under 12 h light/12 h dark photoperiod condition after seed germination under the condition of complete darkness at 24-26 ℃. Light is provided by the LED lamp tube with the intensity of 48 mu mol/m²And s. When 10-20 leaves are developed from the aseptic seedling, a tender stem section (with 1-2 axilla removed) is taken as an explant, and the lower end of the stem section is inserted into a stem culture medium for 2-3 mm downwards in the vertical direction. The stem culture medium is MS culture medium containing 4% (w/v) sucrose, 0.50% (w/v) agar powder and 0.1-0.2 mg/L6-BA, and has pH of 5.8, light period and temperature conditions similar to those of the seedling culture. Under the culture condition, the explants obtained from part of seedlings are inserted into the stem cut of a culture medium to generate nodule-like calluses, and then the callus forms a large number of adventitious buds on the same culture medium; at the same time, axillary buds can also rapidly sprout into cluster buds. When the height of the adventitious bud cluster generated by the callus exceeds 1cm, cutting/shearing buds, and inoculating the buds to 1/2MS culture medium containing 0.2 mg/L IBA to induce rooting. When the bud grows to root and the stem grows to contain 10-20 leaves, the stem segment is taken as the explant again according to the method, adventitious bud growth is induced, and bud cutting is conducted to induce rooting. The regeneration culture of 2-6 generations can obtain a tissue culture clone group from a mature seed of Lycium ruthenicum Murr. Marking each rooting clone group in the bottle, domesticating under natural illumination of a windowsill at the temperature of 23-28 ℃, and transplanting into a flowerpot with the caliber of 15 cm when the stems are thick and the leaves are dark green. The transplanting matrix is 1 turf: 1, humus soil: 2, filling the vegetable garden soil into a polyethylene edible fungus bag before transplanting the matrix, sealing the bag, and sterilizing the bag for 30 to 60 minutes under the damp-heat condition of 121 ℃. Cleaning the culture medium at the root of the tissue culture seedling, soaking in broad-spectrum antibacterial working solution for 5-10 min, transplanting into a pot, and adding the mediumThe plastic film with holes is covered by the water. Note that a bottle is moved into a basin. The water content of the pot soil is kept at 100% of the field water capacity within 10 days, the covered plastic film can be gradually uncovered after 10 days, and the water content of the pot soil is kept at 90-100% of the field water capacity. Transplanting in a greenhouse at 25 + -2 deg.C, and irradiating with scattered natural light. When the pot seedlings start to pump new stems, the pot seedlings are gradually transferred to direct natural illumination, and the field water capacity of the pot soil is still kept above 90%. The water control experiment (under natural illumination in a greenhouse) is carried out on each tissue culture clone which is transplanted and just recovered to grow, each clone transplanting seedling is divided into two groups, and the field water capacity is controlled to be more than 90% and less than 60% respectively. A typical asexual line that remains stingless at > 90% field capacity was selected. Taking the young, tender and non-lignified completely non-pricked stem, removing leaves, and shearing the three topmost stem nodes as the original experimental materials of high-throughput transcriptome sequencing (RNA-Seq) and gene cloning.

Obtaining the Lycium ruthenicum Murr sucrose synthase Gene by RNA-Seq of Baimaike Corp: (thornlessSUS) The sequence is partially expressed. Based on this sequence, primers were designed using the software Primer Premier5 forthornlessSUSCloning; the primers were designed as follows:

SUS-F：5'-GGAAAGAATGGCAGCCAGTAG- 3'

SUS-R：5'- CCAGTGTCGGGATAACCAAG- 3'；

the method adopts the spinless stem node as a material, adopts Ultrapure RNA Kit to extract total RNA and synthesizes first strand cDNA, and comprises the following specific steps:

1) fully grinding 100-200mg of stem node material in liquid nitrogen, adding 1ml of TRIzon Reagent, and uniformly mixing;

2) repeatedly blowing and beating for several times after adding the TRIzon Reagent to fully crack the sample; standing at room temperature for 5min to completely separate protein nucleic acid complex;

3) adding 200 μ l chloroform, covering the tube cover, shaking vigorously for 15s, and standing at room temperature for 2 min;

4) centrifuging at 12000 rpm for 10min at 4 deg.C, and transferring RNA in the upper water phase into a new RNase free centrifuge tube;

5) adding 200 μ l 70% ethanol (prepared without RNase water), reversing, and mixing;

6) adding all the solution obtained in the previous step into an adsorption column filled with a collecting pipe. Centrifuging at 12000 rpm for 20 s, pouring out waste liquid in the collecting tube, and putting the adsorption column back into the collecting tube again;

7) adding 700 μ l Buffer RW1 into the adsorption column, centrifuging at 12000 rpm for 20 s, pouring off waste liquid in the collection tube, and replacing the adsorption column into the collection tube;

8) adding 500 μ l Buffer RW2 (adding anhydrous ethanol before use) into adsorption column, centrifuging at 12000 rpm for 20 s, pouring off waste liquid in collection tube, and replacing adsorption column into collection tube;

9) repeating step 8);

10) centrifuging at 12000 rpm for 2min, and pouring off waste liquid in the collecting pipe. Placing the adsorption column at room temperature for 5-10 min, and air drying completely;

11) placing the adsorption column in a new RNase-Free centrifuge tube, adding 20-50 μ l RNase-Free Water into the middle part of the adsorption column, standing at room temperature for 1min, centrifuging at 12000 rpm for 1min, collecting RNA solution, performing electrophoresis, and determining that the concentration, integrity and purity meet the experimental requirements by adopting a micro nucleic acid protein determinator. RNA is stored at-70 ℃ to-80 ℃ to prevent degradation.

12) Synthesis of cDNA Using M-mlV Reverse Transcriptase (M1701). the entire reaction system was carried out in a 0.2 ml PCR tube as follows:

RNA 5μl

Oligo d(T)₁₅ 1μl

DEPC Water 9. mu.l

Total volume 15. mu.l

The reaction process is as follows: rapidly placing on ice at 70 deg.C for 5min, and ice-cooling for 2 min; add 1. mu. l M-mlV, 5. mu. l M-mlV 5 × Reaction Buffer, 5. mu.l dNTP, 1. mu.l RNase, 3. mu.l sterile water (RNase free); storing at 42 deg.C for 60 min and 4 deg.C.

PCR was performed using the above-synthesized cDNA as a template and primers for SUS-F and SUS-R, as follows:

cDNA 1μl

SUS-F 0.5μl

SUS-R 0.5μl

Taq 0.25μl

Taq Buffer 2.5μl

dNTP 0.5μl

19.75. mu.l of ultrapure water

Total volume 25. mu.l

The PCR reaction program is: 5min at 95 ℃; 30s at 95 ℃; annealing at 56-60 deg.C for 30s, extending at 72 deg.C for 1min, and performing 35 cycles; stretching for 5min at 72 ℃.

And (3) carrying out electrophoresis on the PCR product on 1% agarose gel, observing by a gel imaging system, photographing, recovering an ideal fragment from the gel, connecting a T Vector (pUCm-T Vector kit) for transformation, and sending to Beijing Hua large gene for sequencing. The sequencing results prove thatthornlessSUSThe sequence has no stop codon. So obtained using 3' RACEthornlessSUSComplete CDS of the gene. Obtained according to the abovethornlessSUSPartial sequence design of gene upstream primer C751: 5'-GGGAAACACTGCTCAACG-3', respectively; the downstream primer is 3' RACE universal primer B26: 5'-GACTCGAGTCGACATCGATTTTTTTTTTTTTTTTT-3', respectively; amplification by PCR methodthornlessSUSA 3' region of the gene; the PCR reaction system is as follows:

cDNA 1μl

C751 0.5μl

B26 0.5 μl

Taq 0.25μl

Taq Buffer 2.5 μl

dNTP 0.5 μl

19.75. mu.l of ultrapure water

Total volume 25. mu.l

The PCR reaction program is: 5min at 95 ℃; 30s at 95 ℃; 30s at 46 ℃, 30s of annealing time, 2min at 72 ℃ and 35 cycles; 5min at 72 ℃;

and (3) carrying out electrophoresis on the PCR product on 1% agarose gel to observe the gene amplification condition, observing by a gel imaging system, and taking a picture. Selecting a PCR product with a single and clear strip, recovering glue, connecting with a T vector, transforming, and sending to Beijing Huada gene for sequencing. According to the sequencing result, the full-length CDS sequence of the gene is obtained by splicing. The sequence was analyzed by comparison at NCBI and predicted to be obtainedthornlessSUSFull length of gene CDS. The upstream Primer F was designed using software Primer Premier5 based on the full-length sequence: 5'-ATGGCAGCCAGTAGTCTTAGCA-3' and the downstream primer R-2: 5'-TAAATCCCAGATAATGTCATCACTT-3', amplification by PCRthornlessSUSFull length of gene CDS. The PCR reaction system is as follows:

cDNA 1μl

F 0.5μl

R-2 0.5μl

Taq 0.25μl

Taq Buffer 2.5μl

dNTP 0.5μl

19.75. mu.l of ultrapure water

Total volume 25. mu.l

The PCR reaction program is: 5min at 95 ℃; 30s at 95 ℃; setting 5 annealing gradients, 30s at 61.4-55.6 ℃, 5min at 72 ℃ and 35 cycles; 10min at 72 ℃; storing at 4 deg.C;

and (3) observing the gene amplification condition of the PCR product by using 1% agarose gel electrophoresis, observing the PCR product by using a gel imaging system, and taking a picture. Selecting target PCR product with single and clear band, cutting and recovering gel, connecting T vector, converting, and sequencing to obtain the productthornlessSUSThe full-length CDS sequence is shown in a sequence table SEQ ID NO. 1.

The glue recovery used in the above experiment adopts DNA gel recovery kit of Kangji biological technology company Limited, the specific method is as follows:

1) cutting off a single-purpose DNA band, putting the cut single-purpose DNA band into two 2ml centrifuge tubes, and weighing the gel;

2) adding Buffer PG with one time volume into the centrifugal tube with the rubber blocks;

3) water bath at 50 deg.C, and gently turning the centrifuge tube upside down every 2-3 min until the gel is fully dissolved and the solution is yellow;

4) adding 200 μ l Buffer PS into the adsorption column in the collection tube, centrifuging at 13000 rpm for 1min, discarding the waste liquid, and placing the adsorption column back into the collection tube;

5) adding the solution obtained in the step 3) into an adsorption column, standing at room temperature for 2min, centrifuging at 13000 rpm for 1min, discarding the waste liquid, and placing the adsorption column back into the collection pipe;

6) adding 450 μ l Buffer PW (anhydrous ethanol is added in advance) into the adsorption column, centrifuging at 13000 rpm for 1min, discarding the waste liquid, and placing the adsorption column back into the collection tube;

7) repeating step 6);

8) centrifuging at 13000 rpm for 1min, discarding the waste liquid, and placing the adsorption column back into the collection tube;

9) placing the adsorption column into a new 1.5 ml centrifuge tube, suspending and dropwise adding 50 μ l Buffer EB, standing at room temperature for 2min, centrifuging at 13000 rpm for 1min, and storing at-20 deg.C.

10) Mu.l of the purified DNA fragment was electrophoresed on a 1% agarose gel, visualized with a gel imaging system, and photographed.

The transformation of the connecting T vectors adopts pUCm-T vectors for connection, and the specific method comprises the following steps: 0.2 pmol of the purified and diluted DNA fragment was ligated with 50 ng of pUCm-T vector in the following reaction system:

the diluted DNA fragment was purified in 5. mu.l (volume adjusted according to length and concentration)

pUCm-T Vector 1 μl

10 x Ligation Buffer 1 μl

50 % PEG 4000 1 μl

T4 DNA Ligase 1 μl

ddH2O 1 μl

Total volume 10. mu.l

Ligation was performed overnight at 16 ℃.

The products ligated in the above experiment were all transferred into E.coli DH 5. alpha. competence for sequencing, and the specific procedures were as follows:

1) placing the competent cells in an ice-water bath for thawing, adding 5 mul of the ligation product into 50 mul of the competent cells, and gently mixing;

2) ice-water bath for 30 min without shaking;

3) hot shocking at 42 ℃ for 60 s without shaking;

4) ice-water bath for 2min without shaking;

5) adding 500 mul of sterile LB liquid culture medium;

6) resuscitating at 37 deg.C under shaking at 180 rpm for 60 min;

7) the cells were centrifuged at 4000 rpm for 1min, 100. mu.l of the cell suspension was applied to LB solid medium having Amp resistance (100 mg/l), and inverted and cultured at 37 ℃.

A plurality of single colonies were picked up with a sterile white pipette tip and added to 5ml of LB liquid medium supplemented with 100 mg/l ampicillin (Amp) (Bio/Industrial) and cultured at 37 ℃ and 180 rpm for 12 to 16 hours. The amplified culture broth was used to verify whether the DNA fragment was successfully ligated to the T-vector by PCR using M13 primer (M13-F: 5'-GTTGTAAAACGACGGCCAG-3'; M13-R: 5'-CAGGAAACAGCTATGACCATGATTACG-3'). The PCR reaction system is as follows:

single colony bacterial liquid 1. mu.l

M13-F 0.5μl

M13-R 0.5μl

Taq 0.25μl

Taq Buffer 2.5μl

dNTP 0.5μl

19.75. mu.l of ultrapure water

Total volume 25. mu.l

The PCR reaction program is: 15min at 95 ℃; 30s at 95 ℃; at 55 ℃ for 30s, at 72 ℃ for 5min, for 35 cycles; 10min at 72 ℃; storing at 4 ℃. And (3) taking 3 mu l of PCR product to perform electrophoresis on 1% agarose gel, observing the gene amplification condition, observing by a gel imaging system, and taking a picture. Selecting the strain corresponding to the PCR product with single and clear band, and sending the strain to Beijing Huada gene for sequencing.

EXAMPLE 2 construction of recombinant vectors

The original vector was pRI101AN (preserved in Zhang Shi Macro teaching topic group) and was subjected to PCRGFP5 'is added at two ends of CDS of gene'NdeI and 3'EcoRI enzyme cutting site and protective base, then through double enzyme cutting and connection modeGFPThe gene was ligated to pRI101AN vector, and the constructed vector was named pRI-GFP (FIG. 1A);

performing PCR on lycium ruthenicum murrthornlessSUS5 'is added at two ends of CDS of gene'NdeI and 3'EcoRI cleavage site and protected base byNdeI and 3'EcoRI double enzyme digestion and ligationthornlessSUSThe CDS of (4) was ligated to pRI101AN vector, and the resulting recombinant vector was named pRI-SUS (FIG. 1B);

addition of 5 'to both ends of GFP Gene'EcoRI and 3'EcoRI, through enzyme cleavage site 5'EcoRI and 3'EcoRI, the GFP gene was cloned into the recombinant vector pRI-SUS by recombinant method, and the resulting recombinant vector was named pRI-SUSGFP (FIG. 1C).

2. Transfer of recombinant vector plasmid into competent cell

All the constructed vectors need to be transformed into escherichia coli and verified and sequenced (Huada) to verify the correctness of the sequence and the direction; the recombinant vector plasmid is transferred into escherichia coli competent DH5 alpha, and the specific operation steps are as follows:

1) placing the competent cells in an ice-water bath for thawing, adding 3 mul of plasmids of the three expression vectors into 50 mul of the competent cells respectively, and mixing the competent cells gently;

2) ice-water bath for 30 min without shaking;

3) hot shocking at 42 ℃ for 60 s without shaking;

4) ice-water bath for 2min without shaking;

5) adding 500 mul of sterile LB liquid culture medium;

6) resuscitating at 37 deg.C under shaking at 180 rpm for 60 min;

7) the cells were centrifuged at 4000 rpm for 1min, 100. mu.l of the resulting suspension was applied to LB solid medium having Kana resistance (50 mg/l), and the suspension was cultured in an inverted state at 37 ℃.

A plurality of single colonies were picked up with a sterile white pipette tip and added to 5ml of LB liquid medium with Kana resistance (50 mg/l) and cultured at 37 ℃ and 180 rpm for 12 to 16 hours. Taking the enlarged culture bacterial liquid, and checking whether the recombinant plasmid is transferred into escherichia coli competent DH5 alpha by a PCR method.

The PCR reaction system for verifying the pRI-GFP vector was as follows:

single colony bacterial liquid 1. mu.l

GFP-F5’- TGCTTCAGCCGCTACCCC -3’ 0.5μl

GFP-R 5’- ATCGCGCTTCTCGTTGGG -3’ 0.5μl

Taq 0.25 μl

Taq Buffer 2.5 μl

dNTP 0.5 μl

19.75. mu.l of ultrapure water

Total volume 25. mu.l

The PCR reaction program is: 15min at 95 ℃; 30s at 95 ℃; 30s at 58 ℃, 1min at 72 ℃ and 35 cycles; 10min at 72 ℃. And (3) taking 3 mu l of PCR product to perform electrophoresis on 1% agarose gel, observing the gene amplification condition, observing by a gel imaging system, and taking a picture. Selecting a bacterial solution corresponding to a PCR product with a single and clear strip and a correct length, and sending the bacterial solution to Beijing Huada gene for sequencing;GFPthe gene sequence is shown in a sequence table SEQ ID NO. 2.

The PCR reaction system for verifying the effect of pRI-SUS vector transformation was as follows:

single colony bacterial liquid 1. mu.l

SUS-F 5’-GGAAAGAATGGCAGCCAGTAG -3’ 0.5μl

SUS-R 5’- CCAGTGTCGGGATAACCAAG -3’ 0.5μl

Taq 0.25μl

Taq Buffer 2.5μl

dNTP 0.5 μl

19.75. mu.l of ultrapure water

Total volume 25. mu.l

The PCR reaction program is: 15min at 95 ℃; at 95 ℃ for 30s, at 58 ℃ for 30s, at 72 ℃ for 1min, for 35 cycles; 10min at 72 ℃; storing at 4 ℃. And (3) taking 3 mu l of PCR product to perform electrophoresis on 1% agarose gel, observing the gene amplification condition, observing by a gel imaging system, and taking a picture. Selecting a bacterial solution corresponding to a PCR product with a single and clear strip and a correct length, and sending the bacterial solution to Beijing Huada gene for sequencing; obtaining the sequence and the abovethornlessSUSThe full-length CDS sequences are identical.

The PCR reaction system for verifying the transformation effect of the pRI-SUSGFP vector is as follows:

single colony bacterial liquid 1. mu.l

SGFP-F5’- ACCCCTCATGGTTATTTCGCT -3’ 0.5μl

SGFP-R5’- TCACCTTGATGCCGTTCTTCT -3’ 0.5 μl

Taq 0.25μl

Taq Buffer 2.5μl

dNTP 0.5μl

19.75. mu.l of ultrapure water

Total volume 25. mu.l

The PCR reaction program is: 15min at 95 ℃; 30s at 95 ℃; 30s at 58 ℃, 2.5 min at 72 ℃ and 35 cycles; 10min at 72 ℃. And (3) taking 3 mu l of PCR product to perform electrophoresis on 1% agarose gel, observing the gene amplification condition, observing by a gel imaging system, and taking a picture. Selecting a bacterial solution with a single and clear strip and a correct length position corresponding to a PCR product, and sending the bacterial solution to Beijing Huada gene for sequencing; the SUSGFP fusion gene sequence in the vector is shown as a sequence table SEQ ID NO. 3.

The recombinant vector (plasmid) extraction method comprises the following steps: the DH5 alpha strain with the correct sequence verification is streaked on a Kana resistant (50 mg/l) LB solid culture medium, the strain is placed at 37 ℃ for culture until a single colony grows out, the single colony is selected and inoculated on a liquid LB culture medium (50 mg/l Kana), the strain is activated at 37 ℃ and 180 rpm, a plasmid extraction kit of a Tay-Rui-Biotechnology Limited company is used for extracting bacterium liquid plasmids, and the specific operation steps are as follows:

1) taking 4 ml of overnight cultured bacterial liquid in a centrifuge tube, centrifuging for 1min at 10000 rpm, sucking supernatant liquid as much as possible by using a pipette gun, and collecting thalli into one centrifuge tube through twice centrifugation;

2) adding 250 μ l of solution PI (RNaseA was added in advance) and 5 μ l of lysine Dye to the pellet, wherein the solution is red, and thoroughly suspending the cells with a vortex shaker;

3) adding 250 mul of solution P2 into a centrifuge tube, and gently turning the centrifuge tube up and down for 6-8 times to crack the thalli;

4) adding 350 μ l of solution P3 into a centrifuge tube, gently turning over for 6-8 times, mixing well until yellow flocculent precipitate appears, and centrifuging at 10000 rpm for 10 min;

5) transferring the supernatant to an adsorption column (the adsorption column is placed in a collecting pipe) by using a pipette, centrifuging at 10000 rpm for 45 s, and discarding the waste liquid;

6) adding 700 μ l PW (anhydrous ethanol is added in advance) into the adsorption column, centrifuging at 10000 rpm for 45 s, and discarding the waste liquid;

7) adding 500 μ l PW (anhydrous ethanol is added in advance) into the adsorption column, centrifuging at 10000 rpm for 45 s, and discarding the waste liquid;

8) centrifuging at 10000 rpm for 2 min;

9) placing the adsorption column into a clean 1.5 ml centrifuge tube, adding 60 μ l solution EB, standing at room temperature for 2min, centrifuging at 10000 rpm for 2 min;

the extracted plasmid is verified by methods such as electrophoresis and the like and then is stored at the temperature of minus 20 ℃ for preparing the transformed agrobacterium infection.

EXAMPLE 3 preparation of the receptor Material

Collecting mature seeds from a plurality of spiny adult lycium ruthenicum murr, placing the seeds in a moist sterile gauze for accelerating germination for 24 h at 37 ℃, performing surface sterilization in a super-clean workbench (treating with 75% alcohol for 30-60S, treating with 0.1% mercuric chloride for 1-2 min, washing with sterile clear water for 3-5 times), absorbing surface moisture, and then transversely inoculating to 1/2MS for cultureBase (MS dry powder 2.37g/l, sucrose 20g/l, agar powder 4.5-5.0g/l, pH 5.8-6.0). Culturing under 12 h light/12 h dark photoperiod condition after seed germination in complete darkness at 23-27 deg.C. Light is provided by the LED lamp tube with the intensity of 48 mu mol/m²And s. When the height of the aseptic seedling exceeds 8 cm and is lower than 11cm, the plant is cut into two parts: a stem with a top and a lower half part with a root with a top removed, which are 3-5 cm high. And (3) inoculating the two parts into a newly prepared 1/2MS culture medium which does not contain any exogenous plant hormone, cutting off a stem with the top of 3-5 cm when the upper part roots and the lower part lateral branches or root tillering germinates and the plant height reaches 8-11 cm, inoculating the upper part with the top and the lower part with the root into a newly prepared 1/2MS culture medium which does not contain the exogenous plant hormone again, and continuing to cut and transfer according to the method. Through the transfer of more than 4 generations, the strains which are relatively quick in rooting, growth and reproduction are reserved and marked respectively. The tip parts of the selected clone young leaves are cut off by 3-5 mm to be used as explants, and the explants are inoculated into MS culture medium (MS dry powder 4.74g/l + sucrose 40g/l + agar 4.8-5.0 g/l, pH = 5.8) with the paraxial surfaces facing downwards. Under the condition, a clone strain capable of forming a complete plant through a direct organogenesis path is reserved, 3-5 mm of a fully-expanded tender blade tip part of a plant obtained through direct organogenesis is cut off again to be used as an explant, the tip part is inoculated to an MS culture medium in a paraxial face downward mode, after the leaf tip explant forms a plant through direct organogenesis, the leaf tip explant is cut again, inoculated and propagated for … … leaf tip direct organogenesis for more than 10 generations, and the tender plant formed through direct organogenesis is used as a receptor provider of genetic transformation. Except that the seeds are placed in the dark before germination, the illumination conditions such as the photoperiod and the like of other cultures are the same as the conditions after germination of the seeds, and the temperature is 25 +/-2 ℃. The MS dry powder and agar powder are purchased from Zhongtian tissue culture gardening products, Inc. in Jinan city, and the sucrose is purchased from the manufacturer. Adjusting pH value with 1M NaOH (raw), autoclaving culture medium at 121 deg.C for 20min, placing in culture room, observing for 7d, and determining to be sterile and normal for inoculation.

Example 4 determination of kanamycin selection concentration in selection Medium

Selecting clonal seedlings of lycium ruthenicum with good state and basically consistent development, and shearing half of the tips of young and tender leaves in a super clean bench by using sterile scissors to serve as explants. Explants were inoculated back-side up into MS medium (MS dry powder 4.74g/l + sucrose 40g/l + agar 4.8g/l, pH = 5.6-6.0) containing different concentrations of kanamycin (raw), with Kana concentrations of the medium set to 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 50, 100 mg/l, respectively, at least 90 explants were inoculated per treatment. The temperature of the tissue culture room is 25 +/-2 ℃, 1M NaOH (raw material) is adopted for regulating the pH value, and after the culture medium is autoclaved for 20min at 121 ℃, Kana mother liquor which is subjected to filtration sterilization (0.22 mu M) is added before solidification. The light source of the culture room is an LED lamp tube, and the photoperiod is 12 h of illumination/12 h of darkness. The result shows that after 7 days, the control group without adding Kana and the leaf apex explant of the Lycium ruthenicum Murr with the Kanna concentration of 1 mg/l and 2 mg/l start to root, and the rooting rate reaches the maximum after 14 days, and can reach 100 percent at most. After 10 days, the explant of the lycium ruthenicum leaf with the Kanna concentration of 3mg/l starts to root, the rooting rate is 18.89%, and the rest concentration is unchanged. After 28 days, the control group without adding Kana and the lycium ruthenicum leaf explant with the Kanna concentration of 1 mg/l and 2 mg/l begin to bud, and the bud generation rates are 52.22%, 35.56% and 32.22% respectively. After the lycium ruthenicum leaf explant with the Kanna concentration of 3mg/l is rooted, the growth is stopped when the root grows to about 1cm, and no bud is generated subsequently. After a period of inoculation, the remaining treated Lycium ruthenicum leaf explants die, except for the control that had germinated and the Lycium ruthenicum leaf explants with Kanna concentration of 1-2 mg/l. Although the leaf explants of Lycium ruthenicum at Kanna concentration of 3mg/l had short roots, the root elongation growth was inhibited and no bud-forming plants could be produced, and finally the leaf explants gradually turned yellow and died (FIG. 2). Therefore, MS medium supplemented with Kanna at a concentration of 3mg/l was selected as the initial selection medium for this experiment. The concentration can achieve the purpose of screening, and can reduce the damage to plant materials so as to achieve the purpose of enabling the successfully transformed vein incision cells to root and bud as much as possible.

Example 5 determination of the concentration of cefotaxime sodium used

Agrobacterium tumefaciens strains EHA105 and LBA4404, which were maintained by the subject group of Zhang Shixus university of Shenyang agriculture, were used. Placing the Agrobacterium stored in a refrigerator at-80 deg.C on ice, standing for thawing, dipping a small amount of bacterial liquid with sterile inoculating filament in a super clean bench, streak-culturing on YEP solid culture medium containing 50mg/l rifampicin (Rif), and culturing at 27-28 deg.C for 2-3 d in an inverted manner; picking single agrobacterium colony with a sterile white tip in a clean bench, adding the colony into YEP liquid culture medium containing 50mg/l Rif, culturing at 27-28 ℃ under shaking at 180-. The round filter paper sheets were soaked with 100, 150, 200, 250, 300, 350, 400, 450 and 500 mg/l cefotaxime sodium (Cef) solutions, respectively, and placed in the uniformly spread solid medium, and left to stand overnight for cultivation at 27-28 ℃. Overnight observation revealed that filters impregnated with > 300mg/l Cef solution were able to completely inhibit the growth of Agrobacterium EHA105 and LBA 4404. 300mg/l were therefore selected as the concentration of Cef used in the selection medium in order to suppress the re-outbreak of Agrobacterium. 500 mg/l was selected as the Cef concentration in the wash. In the experiment of using Cef alone to inhibit Agrobacterium, if Agrobacterium outgrowth is found, 300mg/l carbenicillin and 300-700 mg/l Cef can be used together to achieve stronger inhibition effect.

EXAMPLE 6 preparation of Agrobacterium competence

Standing and melting Agrobacterium EHA105, LBA4404 (preserved in Zhang shixihong professor topic group of Shenyang agriculture university) stored in a refrigerator at-80 deg.C on ice, dipping a small amount of bacteria solution with sterile inoculating silk in a super clean bench, streak-culturing on YEP solid medium containing 50mg/l Rif, and performing inverted culture at 27-28 deg.C for 2-3 d; picking out single colony of Agrobacterium EHA105 and LBA4404 with sterile white tip in a clean bench, adding into YEP liquid culture medium containing 50mg/l Rif, shaking at 28 deg.C and 180 rpm for 10 h to OD₆₀₀About 0.5, taking 5ml of activated bacteria liquid from a clean bench, adding the bacteria liquid into a sterile 50 ml centrifuge tube, and standing for 10min on ice; centrifuging at 4 deg.C and 5000 rpm for 10min, and removing supernatant with pipette; in clean bench5ml of 25 mM CaCl pre-cooled on ice are added to the centrifuge tube₂Resuspending thallus in solution (filter for sterilization), standing on ice for 20min, centrifuging at 4 deg.C and 5000 rpm for 10min, and removing supernatant; 1ml of 25 mM CaCl pre-cooled beforehand is added to the centrifuge tube in a clean bench₂And (4) resuspending the thalli again, standing for 20min on ice, and quickly freezing the agrobacterium-infected cells by liquid nitrogen and storing at-80 ℃ for later use.

EXAMPLE 7 transformation of Agrobacterium with recombinant vector

Pipetting 5. mu.l of recombinant vector (pRI-GFP, pRI-SUS or pRI-SUSGFP) into 50. mu.l of Agrobacterium EHA105, LBA4404 competent in a super clean bench, and gently mixing; standing on ice for 5min, and quickly freezing in liquid nitrogen for 1 min; water bath at 37 deg.C for 5min, ice bath for 2 min; adding 800 mul YEP liquid culture medium into a centrifuge tube in a clean bench, culturing for 4 h at 28 ℃, 180 rpm in a shaking way, centrifuging for 5min at room temperature of 5000 rpm, sucking redundant liquid culture medium by using a pipette gun, reserving about 100 mul of liquid, suspending thalli, coating bacterial liquid on YEP solid culture medium containing 50mg/l Rif and 50mg/l Kana by using a sterile bacteria coating rod, and culturing for 2-3 d in an inverted way at 27-28 ℃; picking single colony of Agrobacterium with sterile inoculating silk in a clean bench, uniformly spreading on YEP solid culture medium containing 50mg/l Rif and 50mg/l Kana, and performing inverted culture at 28 deg.C for 1-2 d; selecting the two-turn agrobacterium tumefaciens lawn by using a white gun head in a super clean workbench, and checking whether the recombinant plasmid is turned into an agrobacterium tumefaciens competence by a PCR method, wherein the PCR reaction system (bacterial lawn replaces bacterial liquid, and the ultra-pure water is supplemented to 25 mul) and the procedure are the same as those of the 1.2 which checks whether the recombinant plasmid is turned into escherichia coli competence DH5 alpha; according to the results of electrophoresis, two-turn colonies having a band length corresponding to the band length of the objective fragment were selected, shake-cultured in 5ml of YEP liquid medium containing 50mg/l of Rif and 50mg/l of Kana at 28 ℃ on a shaker at 180 rpm, and mixed with sterilized glycerol and the mixture of bacterium 1: 1, storing, and using for subsequent experiments such as sequencing, infection and the like. The strains with correct sequencing verification are used for subsequent genetic transformation, and the engineering bacteria containing various carriers are respectively abbreviated as EHA105_pRI-GFP、EHA105_pRI-SUS、EHA105_pRI-SUSGFP、LBA4404_pRI-GFP、LBA4404_pRI-SUSAnd LBA4404_pRI-SUSGFP。

Example 8 Agrobacterium-mediated genetic transformation

Preparation and infection of bacterial liquid

Dipping small amounts of EHA105 with sterile inoculum wires in a clean bench_pRI-GFP、EHA105_pRI-SUS、EHA105_pRI-SUSGFP、LBA4404_pRI-GFP、LBA4404_pRI-SUSOr LBA4404_pRI-SUSGFPCulturing the strain on YEP solid medium containing 50mg/l Rif and 50mg/l Kana by streaking, and performing inverted culture at 27-28 deg.C for 2-3 d; picking out single agrobacterium colony with a white gun head in a super clean bench, and performing shake culture for 18h in 5ml YEP liquid culture medium containing 50mg/l Rif and 50mg/l Kana; in a super clean bench, 1ml of activated bacteria solution is sucked by a pipette and added into 50 ml of 5ml of YEP liquid culture medium containing 50mg/l of Rif and 50mg/l of Kana to continue shaking culture until EHA105_pRI-GFP、EHA105_pRI-SUSAnd EHA105_pRI-SUSGFPOD of bacterial liquid₆₀₀The value is 0.39-0.61, and LBA4404_pRI-GFP、LBA4404_pRI-SUSOr LBA4404_pRI-SUSGFPOD of bacterial liquid₆₀₀Value 0.39-0.80, centrifugation at 5000 rpm for 5min at 4 ℃, supernatant discarded, and sterilized MS liquid medium (MS dry powder 4.74g/l + sucrose 40g/l, pH = 5.8) 1: 1 resuspending the cells, and standing on ice for 1 h. Add filter-sterilized Acetosyringone (AS) to a final concentration of 100. mu.M before resuspending the cells in MS broth to increase transformation efficiency.

Pouring the resuspended bacterial solution into a sterilized culture dish, placing the lycium ruthenicum leaf apex explants which are not subjected to pre-culture and are subjected to pre-culture for 1d and are subjected to pre-culture for 2d in a filter paper, sucking water, and then respectively adding the explants into the culture dish containing the bacterial solution to infect. The infection time of the 6 kinds of bacteria is set to be 5-15 min. And (3) slightly shaking the culture dish at intervals in the infection process to promote agrobacterium to infect the lycium ruthenicum leaf explant. After infection, transferring the lycium ruthenicum leaf tip explant to sterile filter paper by using a pair of tweezers, and sucking off redundant bacteria liquid. The above operations are all carried out in a clean bench. The preculture is carried out in the dark condition in a tissue culture room at 25 +/-2 ℃, the leaf apex explant is also adopted, the back side is upwards inoculated, the preculture medium is an MS medium (MS dry powder is 4.74g/l, sucrose is 40g/l and agar is 4.8 g/l), the pH value is adjusted to 5.8 by adopting NaOH, and the preculture is carried out for 20min at 121 ℃.

Two, co-culture

The lycium ruthenicum leaf tip explants with the blotted dry bacterial solution are inoculated into a co-culture medium (MS dry powder 4.74g/l + sucrose 40g/l + agar 4.8g/l +100 μ M AS, pH = 5.8) by using sterile forceps in a back-up manner, and 22-23 explants are placed in each culture dish. And continuously culturing in the dark for 2-3 d in the tissue culture chamber until white agrobacterium is grown around the leaf explant.

Selection culture and generation of resistant plants

After the co-culture is finished, the lycium ruthenicum leaf explants are washed 5-6 times with sterile water containing 500 mg/l Cef (sterile filtration membrane filtration sterilized at 0.22 μm) until there are no agrobacteria around the explants. The cleaned leaf tip explants were transferred with tweezers onto sterile filter paper, blotted to remove excess fluid and plated back side up into selection medium (MS dry powder 4.74g/l + sucrose 40g/l + agar 4.8g/l + 3mg/l Kana +300 mg/l Cef, pH = 5.8). The conditions of the chamber light were the same as those of "determination of kanamycin screening concentration". Selection medium will be changed every 7 d. In the process of selective culture, Kana is added into a culture medium for screening, so that escape plants are avoided as much as possible. A stringent control was set up for the experiment. The transformed lycium ruthenicum leaf tip explants start to root after being screened and cultured for 10 days, the rooting rate reaches the highest after 17 days, and the untransformed lycium ruthenicum leaf tip explants gradually yellow and die on a selection culture medium with Kana (3 mg/l) resistance; after 28 days of selection culture, the root base of the rooted leaf tip explants began to bud to form whole resistant plantlets (FIG. 3). And (3) data statistics display: (1) EHA105_pRI-GFPThe genetic transformation rate is as high as 8.33%; (2) LBA4404_pRI-GFPThe genetic transformation rate is as high as 8.33%; (3) LBA4404_pRI-SUSThe genetic transformation rate is as high as 16.65%; (4) EHA105_pRI-SUSGFPThe genetic transformation rate is as high as 8.33%; (5) LBA4404_pRI-SUSGFPHigh genetic transformation rate up to 8.33%, (6) EHA105_pRI-SUSGenetic transformationThe rate is as high as 8.33%. The above transformation rate = leaf tip explant emergence rate on screening medium/average leaf tip explant emergence rate under non-transgenic conditions (control) × 100%. The method obtains the resistant plants without the callus stage, reduces the risk of reoccurrence of infecting agrobacterium, has short period and ensures that the resistant plants grow robustly.

Fourth, secondary screening resistant plant

In order to more effectively avoid the generation of escape plants, a secondary screening experiment is carried out; when the resistant bud grows to be about 5cm high, cutting about 2 cm stem with top bud in a super clean bench, and inoculating the stem into a resistant rooting culture medium (MS dry powder is 2.37g/l, sucrose is 20g/l, agar is 4.8g/l, Kana is 5 mg/l, Cef is 300mg/l, and pH = 5.8); after 30d cultivation, the resistant bud rooted and grew normally (FIG. 3), and the escaped buds that failed to root were eliminated. Setting a strict control group for the experiment; the results show that almost all the resistant materials selected in the previous step (selection culture) can generate roots to form complete resistant plants for the second time.

Example 9 validation of transgenic plants

The resistant plants selected above were identified from the levels of DNA (PCR), RNA (RT-PCR) and protein (laser confocal microscopy GFP).

First, DNA level detection

DNA of resistant plants and untransformed control material was extracted by CTAB method. The specific operation steps are as follows:

1) respectively grinding 100 mg of resistant and control plant leaves in 500 mul of lysis solution, and collecting in a 2ml centrifuge tube;

2) water bath at 65 deg.C for 30 min, reversing the middle part, and mixing for several times;

3) adding 500 mul of DNA extracting agent with the same volume into a centrifuge tube, and reversing and uniformly mixing;

4) centrifuging at 12000 rpm for 10 min;

5) sucking the supernatant with a pipette gun, putting the supernatant into another clean 2ml centrifuge tube, adding 0.7 volume of 350 μ l isopropanol, mixing by inversion, and ice-cooling for 5 min;

6) centrifuging at 12000 rpm for 2min, discarding supernatant, inverting the tube for 1min to remove isopropanol;

7) adding 500 μ l 70% anhydrous ethanol, rinsing, precipitating, centrifuging at 12000 rpm for 1min, and removing supernatant;

8) repeating step 7);

9) sucking out the residual absolute ethyl alcohol by using a liquid transfer gun as much as possible, standing at room temperature for several minutes, and removing the residual absolute ethyl alcohol;

10) the DNA pellet was dissolved by adding 50. mu.l of TE and stored at-20 ℃.

3 mul of DNA was electrophoresed on 1% agarose gel, and the DNA extraction was observed, visualized by gel imaging system, and photographed.

And verifying whether the transformed plant is a positive plant or not by PCR amplification by using the extracted DNA as a template. The primers, the PCR reaction system and the PCR reaction program used for the plant PCR verification of the pRI-SUSGFP recombinant vector are the same as those used for verifying whether the recombinant vector is transferred into competent cells. The primers used for the PCR verification of the plant transformed with the pRI-SUS recombinant vector are designed according to the partial sequence of the Npt II gene, and the PCR reaction system is as follows:

DNA 1 μl

Primer-F （Npt II-F） 0.5μl

Primer-R （Npt II-R） 0.5 μl

Taq 0.25 μl

Taq Buffer 2.5 μl

dNTP 0.5 μl

19.75. mu.l of ultrapure water

Total volume 25. mu.l

The PCR reaction program is: 5min at 95 ℃; 30s at 95 ℃; 30s at 58 ℃, 2min at 72 ℃ and 35 cycles; 10min at 72 ℃; storing at 4 ℃. And (3) taking 3 mu l of PCR product to perform electrophoresis on 1% agarose gel, observing the gene amplification condition, observing by a gel imaging system, and taking a picture.

As a result, it was found that a band was amplified at 4500 bp in pRI-SUS-transformed resistant plants, and the length of the band was consistent with that of a positive control (pRI-SUS vector plasmid), and untransformed control plants had no band at the same position (FIG. 4), which was a preliminary evidence that transgenic plants of Lycium ruthenicum having an overexpressed SUS gene were obtained; the length of the amplified band of the resistant strain transformed by pRI-SUSGFP is consistent with that of the positive control (pRI-SUSGFP vector plasmid), and the result of primary verification of the transgenic plant is obtained ( lanes 3 and 4 in FIG. 5).

Second, RNA level detection

And extracting total RNA of the root, stem and leaf of the resistant and control plant by using an RNA extraction Kit Ultrapure RNA Kit. cDNA was synthesized using M-mlV Reverse Transcriptase (M1701). The specific operation steps are the same as above.

And detecting the concentration of the cDNA by using a trace nucleic acid protein determinator, and detecting whether the cDNA is available or not by using the internal reference gene by using the cDNA diluted to the same concentration as a template. The PCR reaction system is as follows:

cDNA 1 μl

Primer-F （Actin-F） 0.5 μl

Primer-R （Actin-R） 0.5 μl

Taq 0.25 μl

Taq Buffer 2.5 μl

dNTP 0.5 μl

19.75. mu.l of ultrapure water

Total volume 25. mu.l

The PCR reaction program is: 5min at 95 ℃; 30s at 95 ℃; 30 cycles of 58 ℃ for 30s, 72 ℃ for 30 s; 10min at 72 ℃; storing at 4 ℃. And (3) taking 3 mu l of PCR product to perform electrophoresis on 1% agarose gel, observing the gene amplification condition, observing by a gel imaging system, and taking a picture.

And (3) selecting cDNA which is diluted to the same concentration and can be used after verification as a template, and verifying the expression condition of the target gene of the transformed plant by using a semi-quantitative PCR method. The PCR reaction system is as follows:

the PCR reaction program is: 5min at 95 ℃; 30s at 95 ℃; 30 cycles of 30s at 58 ℃ and 1min at 72 ℃; 10min at 72 ℃; storing at 4 deg.C; taking 3 mul of PCR product to carry out electrophoresis on 1% agarose gel, comparing the brightness of an observed target band, observing by a gel imaging system, and taking a picture; the results show that the roots, stems and leaves of the transgenic resistant plantsthornlessSUSGene expression levels were significantly higher than the untransformed control (fig. 6); indicating that the target gene was transformedthornlessSUSOverexpression (transcription) is shown in the root and stem leaves of Lycium ruthenicum.

Third, GFP fluorescence detection

The leaves of the resistant plants transformed with the vectors pRI-GFP and pRI-SUSGFP and the leaves of the control plants not transformed were cut out in a super clean bench with a sterile scissors, the leaves were transversely dissected with a scalpel, and the presence or absence of GFP expression was observed with a confocal laser microscope at a wavelength of 550 nm. Note that the observation conditions for the control and the resistant material are completely identical. Result display quiltGFPAnd fusion geneSUSGFPThe GFP protein expression was found in all transformed resistant plants (fig. 7).

Fourth, character change of transgenic plant

The invention discovers that under the control of CaMV 35S promoterGFPThe gene is heterogeneously and constitutively expressed in Lycium ruthenicum Murr at high level, can generate toxic and side effects on plants, and has unfavorable characters of slow growth and the like in-bottle plants, but when the gene is expressed in the form of a gene in Lycium ruthenicum MurrGFPAndthornlessSUSare fused intoSUS-GFP，When the lycium ruthenicum murr is stably transformed, a successful transgenic plant can grow normally, and the fact that the GFP fused with thornlessSUS is still in constitutive high expression is proved, and toxic and side effects on the lycium ruthenicum murr are also remarkably reduced. Constitutive high expressionthornlessSUSLycium ruthenicum Murr plants have the characteristics of thick stems, strong root tillering capability, large increase of fibrous root quantity and the like (figure 3D).

Sequence listing

<110> Shenyang agriculture university

<120> Lycium ruthenicum stable genetic transformation system and application thereof

<160> 3

<170> SIPOSequenceListing 1.0

<210> 1

<211> 2412

<212> DNA

<213> Lycium ruthenicum Murr (Lycium ruthenicum Murr.)

<400> 1

atggcagcca gtagtcttag cattaaggac cgtttggagg aatccatttt ggctcgtcca 60

gatgaaattt cggcactcaa gtcaagggtt gaaactgaag ggaaaggggt catgaaacca 120

cttgatctct tgaaccattt gatttctgtg aatactaaga agaatggagt aaatgttggt 180

gccagtgcac tcgtggaagt tctcagttgc agccaagaag ctgtgattgt accaccacaa 240

cttgcactag ctgtacgtcc aaggcccggt gtgtgggagt atgtgtcact gaatcttaag 300

acaaagaaag tggctgaatt gagcatcccc aaataccttc aattgaaaga gaacgctgtc 360

gatgaaagtg gaaacgtctt ggaaatggat tttgagccat ttactactgt aactcctcca 420

aagacacttt ctgactccat tggtaatggt ttggagtttc ttaatcgcca tattgcttca 480

acaatgttcc atgacaagga gattgccaag tgcctccttg actttctcag acagcataac 540

tacaaaggaa agtcattgat ggtgaaagaa agcatccaaa gcctggaaag tttccaatat 600

gtcctgaaaa aagcagagga atatctgcac tctctgaatc cagaaactcc atactctaac 660

tttgaatcga aatttgaaga gattggcttg gaaagagggt ggggaaacac tgctcaacgc 720

gtgcaagaaa caatctgtca tttgttgcac ctccttgagg ctcctaatgc atcttccttg 780

gaaaaattcc ttggaagaat cccattggtt ttcaatgttg tcattctcac ccctcatggt 840

tatttcgctc aagaaaacgt ccttggttat cccgacactg gtggccaggt tgtgtacatt 900

cttgatcaag ttccagccat ggagcgtgag atgcttctcc gtttgaagct tcaaggactt 960

gatgatatcc tcccccggat ccttgttgta acaaggctgc tgcctgatgc agttggaacc 1020

acttgtggtg agcgcatgga gaaagtatat ggggcagagc attctcatat tattcgtgtt 1080

ccatttagaa ctgagaaagg aatgttgcgc aaatggatct caagattcga agtctggcca 1140

tacatggaaa ctttcactga ggatgtcgcg gaagaacttg tcaaagagct gcaagctaaa 1200

ccagacttga tcattggaaa ctacagtgag ggaaaccttg ctgcctcctt gttggctaag 1260

aaatttgggg ctactcaatg cacaatagct catgccttgg agaaaaccaa gtatccaaac 1320

tctgaccttt actggaagaa atttgatgac aagtatcatt tctcaagtca gttcagtgct 1380

gatctttttg cgatgaatca cactgatttc atcatcacca gcactttcca agaaatcgct 1440

ggaagcaaga atactgtagg gcagtatgag agccacactg cttttaccat gcctggattg 1500

taccgagtag tccatggaat tgattcattt gatccaaaat tcaacattgt ctcccctggg 1560

gctgatatgt cgatctactt cccttacaca gaaaaggaaa aaaggctaaa caatttccac 1620

ccggaaattg aagaactact ctacagtcct gttgagaaca aagagcacct atgtgtgttg 1680

aaggaccgga acaagccaat tctcttcacc atggcaaggc tagatcgcgt gaagaatcta 1740

acagggctcg ttgaatggta tgccaagaat gcaaggctga gagagcttgt taaccttgtg 1800

gttgttggtg gagacagaag gaaagaatcc aaggatttgg aagagcaagc agagatgaaa 1860

aaaatgtatg accttattga aacctacaac ctgaatggac aattcaggtg gatttcttct 1920

cagatgaatc gtataaggaa cggagagctt taccgatata ttgcagacac gaggggtgct 1980

ttcgttcagc cagctttcta cgaggctttc ggtttgacag ttgttgaatc catgacttgt 2040

ggtttgccaa cttttgctac ttgtaatggt ggaccatttg agattatagt gcatggaaaa 2100

tctggattcc acattgaccc taatcagggt gacaggaatg ctgatctttt ggtcaatttc 2160

tttgagaaat ccaaagaaga tccaagttat tgggataaca tttccaaggg aggcctacaa 2220

cgcatcattg agaagtatac atggcaaatt tattcacaga aagtgatgac attatctggg 2280

atttatggat tctggaagta tgcaaccaca aatgacaaag ttgctagtgc aaagaagcgc 2340

tatctcgaaa tgttttatga acttatgttt aagaaagctg ctgagaaagt tccactggct 2400

attgatgaat ag 2412

<210> 2

<211> 723

<212> DNA

<213> luminescent hydroid medusa (lumineous hydroliduan Aequorea)

<400> 2

atggtgagca agggcgagga gctgttcacc ggggtggtgc ccatcctggt cgagctggac 60

ggcgacgtga acggccacaa gttcagcgtg tccggcgagg gcgagggcga tgccacctac 120

ggcaagctga ccctgaagtt catctgcacc accggcaagc tgcccgtgcc ctggcccacc 180

ctcgtgacca ccttcaccta cggcgtgcag tgcttcagcc gctaccccga ccacatgaag 240

cagcacgact tcttcaagtc cgccatgccc gaaggctacg tccaggagcg caccatcttc 300

ttcaaggacg acggcaacta caagacccgc gccgaggtga agttcgaggg cgacaccctg 360

gtgaaccgca tcgagctgaa gggcatcgac ttcaaggagg acggcaacat cctggggcac 420

aagctggagt acaactacaa cagccacaac gtctatatca tggccgacaa gcagaagaac 480

ggcatcaagg tgaacttcaa gatccgccac aacatcgagg acggcagcgt gcagctcgcc 540

gaccactacc agcagaacac ccccatcggc gacggccccg tgctgctgcc cgacaaccac 600

tacctgagca cccagtccgc cctgagcaaa gaccccaacg agaagcgcga tcacatggtc 660

ctgctggagt tcgtgaccgc cgccgggatc actcacggca tggacgagct gtacagatct 720

taa 723

<210> 3

<211> 3132

<212> DNA

<213> Lycium ruthenicum Murr (Lycium ruthenicum Murr.)

<400> 3

atggcagcca gtagtcttag cattaaggac cgtttggagg aatccatttt ggctcgtcca 60

gatgaaattt cggcactcaa gtcaagggtt gaaactgaag ggaaaggggt catgaaacca 120

cttgatctct tgaaccattt gatttctgtg aatactaaga agaatggagt aaatgttggt 180

gccagtgcac tcgtggaagt tctcagttgc agccaagaag ctgtgattgt accaccacaa 240

cttgcactag ctgtacgtcc aaggcccggt gtgtgggagt atgtgtcact gaatcttaag 300

acaaagaaag tggctgaatt gagcatcccc aaataccttc aattgaaaga gaacgctgtc 360

gatgaaagtg gaaacgtctt ggaaatggat tttgagccat ttactactgt aactcctcca 420

aagacacttt ctgactccat tggtaatggt ttggagtttc ttaatcgcca tattgcttca 480

acaatgttcc atgacaagga gattgccaag tgcctccttg actttctcag acagcataac 540

tacaaaggaa agtcattgat ggtgaaagaa agcatccaaa gcctggaaag tttccaatat 600

gtcctgaaaa aagcagagga atatctgcac tctctgaatc cagaaactcc atactctaac 660

tttgaatcga aatttgaaga gattggcttg gaaagagggt ggggaaacac tgctcaacgc 720

gtgcaagaaa caatctgtca tttgttgcac ctccttgagg ctcctaatgc atcttccttg 780

gaaaaattcc ttggaagaat cccattggtt ttcaatgttg tcattctcac ccctcatggt 840

tatttcgctc aagaaaacgt ccttggttat cccgacactg gtggccaggt tgtgtacatt 900

cttgatcaag ttccagccat ggagcgtgag atgcttctcc gtttgaagct tcaaggactt 960

gatgatatcc tcccccggat ccttgttgta acaaggctgc tgcctgatgc agttggaacc 1020

acttgtggtg agcgcatgga gaaagtatat ggggcagagc attctcatat tattcgtgtt 1080

ccatttagaa ctgagaaagg aatgttgcgc aaatggatct caagattcga agtctggcca 1140

tacatggaaa ctttcactga ggatgtcgcg gaagaacttg tcaaagagct gcaagctaaa 1200

ccagacttga tcattggaaa ctacagtgag ggaaaccttg ctgcctcctt gttggctaag 1260

aaatttgggg ctactcaatg cacaatagct catgccttgg agaaaaccaa gtatccaaac 1320

tctgaccttt actggaagaa atttgatgac aagtatcatt tctcaagtca gttcagtgct 1380

gatctttttg cgatgaatca cactgatttc atcatcacca gcactttcca agaaatcgct 1440

ggaagcaaga atactgtagg gcagtatgag agccacactg cttttaccat gcctggattg 1500

taccgagtag tccatggaat tgattcattt gatccaaaat tcaacattgt ctcccctggg 1560

gctgatatgt cgatctactt cccttacaca gaaaaggaaa aaaggctaaa caatttccac 1620

ccggaaattg aagaactact ctacagtcct gttgagaaca aagagcacct atgtgtgttg 1680

aaggaccgga acaagccaat tctcttcacc atggcaaggc tagatcgcgt gaagaatcta 1740

acagggctcg ttgaatggta tgccaagaat gcaaggctga gagagcttgt taaccttgtg 1800

gttgttggtg gagacagaag gaaagaatcc aaggatttgg aagagcaagc agagatgaaa 1860

aaaatgtatg accttattga aacctacaac ctgaatggac aattcaggtg gatttcttct 1920

cagatgaatc gtataaggaa cggagagctt taccgatata ttgcagacac gaggggtgct 1980

ttcgttcagc cagctttcta cgaggctttc ggtttgacag ttgttgaatc catgacttgt 2040

ggtttgccaa cttttgctac ttgtaatggt ggaccatttg agattatagt gcatggaaaa 2100

tctggattcc acattgaccc taatcagggt gacaggaatg ctgatctttt ggtcaatttc 2160

tttgagaaat ccaaagaaga tccaagttat tgggataaca tttccaaggg aggcctacaa 2220

cgcatcattg agaagtatac atggcaaatt tattcacaga aagtgatgac attatctggg 2280

atttatggat tctggaagta tgcaaccaca aatgacaaag ttgctagtgc aaagaagcgc 2340

tatctcgaaa tgttttatga acttatgttt aagaaagctg ctgagaaagt tccactggct 2400

attgatgaaa tggtgagcaa gggcgaggag ctgttcaccg gggtggtgcc catcctggtc 2460

gagctggacg gcgacgtgaa cggccacaag ttcagcgtgt ccggcgaggg cgagggcgat 2520

gccacctacg gcaagctgac cctgaagttc atctgcacca ccggcaagct gcccgtgccc 2580

tggcccaccc tcgtgaccac cttcacctac ggcgtgcagt gcttcagccg ctaccccgac 2640

cacatgaagc agcacgactt cttcaagtcc gccatgcccg aaggctacgt ccaggagcgc 2700

accatcttct tcaaggacga cggcaactac aagacccgcg ccgaggtgaa gttcgagggc 2760

gacaccctgg tgaaccgcat cgagctgaag ggcatcgact tcaaggagga cggcaacatc 2820

ctggggcaca agctggagta caactacaac agccacaacg tctatatcat ggccgacaag 2880

cagaagaacg gcatcaaggt gaacttcaag atccgccaca acatcgagga cggcagcgtg 2940

cagctcgccg accactacca gcagaacacc cccatcggcg acggccccgt gctgctgccc 3000

gacaaccact acctgagcac ccagtccgcc ctgagcaaag accccaacga gaagcgcgat 3060

cacatggtcc tgctggagtt cgtgaccgcc gccgggatca ctcacggcat ggacgagctg 3120

tacagatctt aa 3132

Claims (8)

1. Lycium ruthenicum murr sucrose synthase without thornSUSThe base sequence of the gene is shown in a sequence table SEQ ID NO. 1.

2. A transgenic plant expression vector plasmid is characterized by that said transgenic plant expression vector plasmid is inserted in the plant expression vectorSUS。

3. A transgenic plant expression vector plasmid is characterized by that said transgenic plant expression vector plasmid is inserted in the plant expression vectorSUS+XThe fusion gene is a gene which is expressed by the gene,Xrepresents a gene of interest of the transgene,SUSthe gene is a gene shown as SEQ ID NO.1 of a sequence table.

4. According to claim 3The transgenic plant expression vector plasmid is characterized in that: saidXIs a GFP gene.

5. A transgenic plant expression vector plasmid according to claim 2, 3 or 4, wherein: the plant expression vector is pRI101 AN.

6. A recombinant Agrobacterium transformed with a transgenic plant expression vector plasmid of claim 2 or 3.

7. A recombinant Agrobacterium according to claim 6, wherein: the agrobacterium is EHA105 or LBA 4404.

8. A stable genetic transformation system of lycium ruthenicum comprises:

1) preculture the lycium ruthenicum leaf apex explant for 1-2 days, and adding the recombinant agrobacterium infection described in claim 5, wherein the preculture medium consists of 4.74g/l of MS dry powder, 40g/l of sucrose and 4.8g/l of agar;

2) after infection, inoculating the explant into a co-culture medium, and performing dark culture until white agrobacterium is grown around the leaf explant; the co-culture medium consists of 4.74g/l MS dry powder, 40g/l sucrose, 4.8g/l agar and 100 mu M AS;

3) after co-culturing, washing the lycium ruthenicum leaf explant by using sterile water containing 500 mg/l Cef; inoculating the explant to a selective culture medium, and culturing until the explant begins to bud to form a complete resistant plantlet; the selective medium consists of 4.74g/l of MS dry powder, 40g/l of sucrose, 4.8g/l of agar, 3mg/l of Kana and 300mg/l of Cef;

4) the bud of the resistant plantlet in the step 3) grows to 4.5-5.5 cm in height, 1.5-2.5 cm of stem with a top bud is cut, inoculated into a resistant rooting culture medium and cultured until the bud can root and grow normally; the resistant rooting medium consists of 2.37g/l of MS dry powder, 20g/l of sucrose, 4.8g/l of agar, 5 mg/l of Kana and 300mg/l of Cef.

Images