CN112538497B

CN112538497B - CRISPR/Cas9 system and application thereof in construction of alpha, beta and alpha & beta thalassemia model pig cell lines

Info

Publication number: CN112538497B
Application number: CN201910890978.2A
Authority: CN
Inventors: 牛冬; 汪滔; 王德华; 王磊; 程锐; 曾为俊; 马翔
Original assignee: Nanjing Qizhen Genetic Engineering Co Ltd
Current assignee: Nanjing Qizhen Genetic Engineering Co Ltd
Priority date: 2019-09-20
Filing date: 2019-09-20
Publication date: 2023-02-28
Anticipated expiration: 2039-09-20
Also published as: CN112538497A; WO2021051484A1

Abstract

The invention discloses a CRISPR/Cas9 system and application thereof in constructing alpha, beta and alpha & beta thalassemia model pig cell lines, wherein a pair of target sequences are respectively designed aiming at pig HBA and HBB genes, three CRISPR/Cas9 systems are constructed by utilizing the two pairs of target sequences, and each CRISPR/Cas9 system comprises a gRNA vector and a Cas9 expression vector; the expression vectors in the three CRISPR/Cas9 systems are respectively transferred into pig fibroblasts in proportion, and alpha, beta and alpha & beta thalassemia model pig cell lines are obtained by screening. The invention respectively causes single gene mutation and combined gene mutation to pig HBA and HBB genes in primary pig fibroblasts by a gene editing technology to obtain HBA, HBB and HBA & HBB gene mutant cells.

Description

CRISPR/Cas9 system and application thereof in construction of alpha, beta and alpha & beta thalassemia model pig cell lines

Technical Field

The invention belongs to the technical field of gene editing, and particularly relates to a gRNA target combination and application of a cas9 system in construction of alpha, beta and alpha & beta thalassemia model pig cell lines.

Background

Thalassemia (from greek sea 1) is a group of hereditary autosomal recessive blood diseases that result in hemolytic anemia due to reduced or absent globin chain synthesis. An imbalance in the globin chain causes hemolysis and impairs erythropoiesis. Globin variation is present in about 5% of the world population, but only 1.7% of the population is characterized by alpha or beta thalassemia. Thalassemia affects men and women equally, with newborns occurring at a much lower frequency, with approximately 4.4 per 10000 newborns. Alpha thalassemia is most common in africa and southeast asian descendants, and beta thalassemia is most common in the mediterranean, africa, and southeast asian descendants. Of these minority nationalities, 5% to 30% of people are characterized by thalassemia. China is mostly seen in Guangdong, guangxi and Sichuan, and the regions in the south of Yangtze river have sporadic cases, while the north is rare.

Hemoglobin consists of a ferrihemoglobin ring and four globin chains: two alpha chains and two non-alpha chains. The composition of the four globin chains determines the type of hemoglobin. Fetal hemoglobin (HbF) consists of two alpha chains and two gamma chains (alpha 2-gamma 2). Adult hemoglobin a (HbA) consists of two alpha chains and two beta chains (α 2 β 2), while hemoglobin A2 (HbA 2) consists of two alpha chains and two delta chains (α 2 δ 2). At birth, hbF accounts for approximately 80% of hemoglobin and HbA accounts for approximately 20%. The transition from gamma-globin synthesis (HbF) to beta-globin synthesis (HbA) starts before birth. At about 6 months of age, hemoglobin in healthy infants will shift to contain primarily HbA, a small amount of HbA2 and negligible HbF.

Alpha-thalassemia is the result of a loss of the alpha-globin chain or a lack of synthesis, resulting in an excess of the beta-globin chain. The production of the alpha-globin chain is controlled by two pairs of alleles (HBA 1, HBA 2) on chromosome 16. The resulting defect is usually caused by a deletion of one or more of these alleles. Alpha thalassemia caused by single allele deletion is a static carrier state, no symptoms and normal results of hematological examination. Deletion of both alleles results in mild thalassemia, associated with microcytosis, usually anemial. The deletion of three alleles results in the intermediate form of alpha-thalassemia with high production of hemoglobin H (HbH), also known as HbH disease, hbH has four beta strands (β 4) that can cause microcytic anemia, hemolysis and splenomegaly. Deletion of the four alleles results in severe α thalassemia, whose hemoglobin Bart's (Hb Bart's, containing 4 γ chains (γ 4)) are produced in large numbers, often resulting in fetal fatal edema.

Beta thalassemia is the result of insufficient or absent beta-globin chain synthesis leading to an excess of the alpha chain. The synthesis of β -globin is controlled by a pair of alleles (HBBs) on chromosome 11. Beta thalassemia is caused by more than 300 point mutations and deletions of both alleles (which are rare). The production of the beta-globin chain ranges from near normal to complete deletion, resulting in varying degrees of alpha globin excess. The single allele deficiency results in asymptomatic mild beta thalassemia, manifested as microcytosis and mild anemia. If the synthesis of both alleles is severely reduced or absent, beta thalassemia major, also known as Cooley anemia, is manifested. People with severe beta-thalassemia are born with few symptoms due to the presence of HbF, but at 6 months of age symptoms begin to develop, with pallor, irritability, growth retardation, abdominal swelling and jaundice, leading to hemolytic anemia, poor growth and skeletal abnormalities in infancy. People with microcytic anemia, but with minor symptoms, develop beta-thalassemia later in life. Beta thalassemia intermedia is manifested if the beta strand synthesis is less severely reduced. These patients have less symptoms and survive 20 years without lifelong transfusion.

Bone marrow transplantation in children is currently the only treatment for beta thalassemia. Hematopoietic stem cell transplantation usually achieves good results in low risk populations. In addition, since the advent of gene editing technology, gene therapy is the most promising treatment for thalassemia patients in the future.

Alpha & beta thalassemia is an anemic disease caused by insufficient or absent synthesis of both the alpha-globin chain and the beta-globin chain, and depending on the extent of the lack of synthesis of both globin chains, it can cause anemia of varying degrees, with the need for lifelong blood transfusion and even death in the severe cases.

The above-mentioned various treatment methods all need to have corresponding animal models to verify the quality of the treatment effect and whether there are side effects. At present, only a mouse model exists in the Mediterranean anemia animal model, and no large animal model is reported. Rodents such as rats and mice have great differences from humans in body types, organ sizes, physiology, pathology and the like, and cannot truly simulate normal physiological and pathological states of humans. Studies have shown that over 95% of drugs validated to be effective in large mice are not effective in human clinical trials.

The large animals, primates, which are the animals most closely related to humans, are small in size, late in sexual maturity (mating starts at age 6-7), and are single-birth animals, and the population propagation rate is extremely slow, and the raising cost is high. In addition, the cloning efficiency of the primate is low, the difficulty is high and the cost is high.

Disclosure of Invention

The invention designs a pair of target sequences aiming at pig HBA and HBB genes respectively, constructs three CRISPR/Cas9 systems by utilizing the two pairs of target sequences, transfers the three CRISPR/Cas9 systems into pig fibroblasts respectively, and screens to obtain alpha, beta and alpha & beta thalassemia model pig cell lines.

A CRISPR/Cas9 system comprises a first gRNA vector, a second gRNA vector and a Cas9 expression vector, wherein the target sequence of the first gRNA vector is CCTTGACCTGGTCGGAGCCG (SEQ ID NO: 77), and the target sequence of the second gRNA vector is CGGGTCCACACGCAGCTTGT (SEQ ID NO: 79). The target sequences in the group of CRISPR/Cas9 systems are target sequences aiming at HBA genes.

Optionally, the molar ratio of the first gRNA vector, the second gRNA vector, and the Cas9 expression vector is 1.5 to 2. Further optionally, the molar ratio of the first gRNA vector, second gRNA vector, and Cas9 expression vector is 1.5.

A CRISPR/Cas9 system comprises a third gRNA vector, a fourth gRNA vector and a Cas9 expression vector, wherein the target sequence of the third gRNA vector is GGCATTGGACAGGTCCCCAA (SEQ ID NO: 95), and the target sequence of the fourth gRNA vector is TCAGGCCGTCACTGAAGGAC (SEQ ID NO: 96). The target sequences in the CRISPR/Cas9 system are target sequences aiming at HBB genes.

Optionally, the molar ratio of the third gRNA vector, the fourth gRNA vector, and the Cas9 expression vector is 1.5-2. Further optionally, the molar ratio of the first gRNA vector, second gRNA vector, and Cas9 expression vector is 1.5.

A CRISPR/Cas9 system comprises a first gRNA vector, a second gRNA vector, a third gRNA vector, a fourth gRNA vector and a Cas9 expression vector, wherein the target sequence of the first gRNA vector is CCTTGACCTGGTCGGAGCCG (SEQ ID NO: 77), and the target sequence of the second gRNA vector is CGGGTCCACACGCAGCTTGT (SEQ ID NO: 79); the target sequence of the third gRNA vector is GGCATTGGACAGGTCCCCAA (SEQ ID NO: 95), and the target sequence of the fourth gRNA vector is TCAGGCCGTCACTGAAGGAC (SEQ ID NO: 96). The target sequences in the CRISPR/Cas9 system are target sequences aiming at HBA genes and HBB genes simultaneously

Optionally, the molar ratio of the first gRNA vector, the second gRNA vector, the third gRNA vector, the fourth gRNA vector and the Cas9 expression vector is 0.75-1. Further optionally, the molar ratio of the first gRNA vector, second gRNA vector, third gRNA vector, fourth gRNA vector, and Cas9 expression vector is 0.75.

Alternatively, the base sequence of the Cas9 expression vector is shown as SEQ ID NO. 70.

Optionally, the original vector of the gRNA vector is pKG-U6gRNA. The complete sequence of pKG-U6gRNA is shown in SEQ ID NO:71.

The invention also provides a method for constructing the thalassemia model pig cell line, which comprises the following steps: transferring the CRISPR/Cas9 system of any claim 1-8 into a primary fibroblast of pig ear, and screening the monoclonal cell for gene mutation.

The thalassemia includes alpha, beta and alpha & beta types.

The invention also provides an alpha, beta or alpha & beta thalassemia model pig cell line constructed according to the method.

The invention also provides an application of the gRNA target combination in constructing a thalassemia model pig cell line, wherein the gRNA target combination consists of a first gRNA target and a second gRNA target, and/or a third gRNA target and a fourth gRNA target,

wherein, the base sequence of the first gRNA target point is CCTTGACCTGGTCGGAGCCG (SEQ ID NO: 77), and the base sequence of the second gRNA target point is CGGGTCCACACGCAGCTTGT (SEQ ID NO: 79);

the base sequence of the third gRNA target is GGCATTGGACAGGTCCCCAA; the base sequence of the fourth gRNA target is TCAGGCCGTCACTGAAGGAC.

The invention also provides a double-stranded DNA molecule comprising a cohesive end and a target fragment, wherein the base sequences of the target fragment are respectively as follows:

CCTTGACCTGGTCGGAGCCG(SEQ ID NO：77)；

or CGGGTCCACACGCAGCTTGT (SEQ ID NO: 79);

or GGCATTGGACAGGTCCCCAA (SEQ ID NO: 95);

or TCAGGCCGTCACTGAAGGAC (SEQ ID NO: 96).

The invention also provides an expression cassette or gRNA vector comprising the double-stranded DNA molecule as described.

Optionally, the step of constructing the Cas9 expression vector comprises:

taking a vector pX330-U6-Chimeric _ BB-CBh-hSpCas9 as an original vector, wherein the original vector has a gRNA framework sequence, a CMV enhancer and a Cas9 gene; replacing a chicken beta-actin promoter downstream of the CMV enhancer with an EF1a promoter; at least one nuclear localization coding sequence NLS is added at the N end and the C end of the Cas9 gene respectively;

the method can also comprise the following steps: the gRNA backbone sequence was engineered to be as shown in SEQ ID NO:70 to remove invalid redundant sequences.

The method can also comprise the following steps: and a P2A-EGFP-T2A-PURO sequence, a WPRE gene, a 3' LTR gene and a bGH polyA sequence are sequentially inserted into the downstream of the C-end NLS of the Cas9 gene, so that a fluorescence and resistance screening marker is increased, and the expression efficiency of the Cas9 is enhanced.

According to the invention, the high-efficiency knockout target sequence is designed by carrying out conservative analysis on HBA and HBB gene knockout preset target exons and adjacent genome sequences, the gRNA vector is constructed by using the target sequence, and the gRNA vector and an expression vector for efficiently expressing Cas9 are transferred into a host cell together, so that the gene editing efficiency is remarkably improved.

The invention mutates HBA, HBB, HBA and HBB in primary pig fibroblasts by a gene editing technology to obtain each gene mutant cell.

Compared with the prior art, the invention has at least the following beneficial effects:

(1) For each target gene, the invention adopts double gRNA combination to carry out mutation, compared with the method adopting single gRNA, the invention can effectively reduce the generation of non-frame-shift mutation, and can directly detect the gene editing efficiency by PCR.

If a single gRNA is used to mutate a target gene, there is a 1/3 probability of generating a non-frameshift mutation of the base in random repair of non-homologous end joining (NHEJ) of DNA, and the non-frameshift mutation is likely not to destroy the function of the target gene and does not reach the intended goal of inactivating the target gene. When the double gRNA is used for cutting and mutating the target gene, a fragment can be removed from the target gene, and the fragment deletion frame shift mutation of the target gene can be effectively generated by designing a base fragment with non-3 times removed. Meanwhile, the gene editing product of the deletion fragment can be directly detected by a PCR means, and the efficiency of gene editing can be directly estimated by the ratio of the gene editing product to a wild-type product (i.e. unedited product).

(2) gRNA vectors and cas9 vectors are not routinely 1:1, but in a ratio of 3:1 in terms of a molar ratio.

For grnas that ultimately function: cas9 protein complex, gRNA vectors transcribe grnas earlier than cas9 protein formation and the transcribed grnas degrade at a rapid rate, so that if at the DNA vector level, the molar ratio is 1:1, early transcription and degradation of grnas eventually results in a higher molar amount of cas9 protein than undegraded grnas. Through experimental comparison, 3:1 or 4:1 is found to be more efficient than the gRNA: cas9 carrier molar ratio editing of 1:1. Therefore, the present invention preferably uses a gRNA to cas9 carrier molar ratio of 3:1.

(3) The subject of the invention (pig) has better applicability than other animals (rats, mice, primates). No large animal thalassemia model has been successfully developed. The selected research object is the pig, a thalassemia model cell line of the pig is constructed, and the thalassemia disease model pig is cloned and produced for research on drug screening, pharmacology, pathology, toxicology and the like.

To date, only mouse models of thalassemia have been constructed, and no large animal models of thalassemia have been successfully developed. Rodents such as rats and mice have great differences from humans in body types, organ sizes, physiology, pathology and the like, and cannot truly simulate normal physiological and pathological states of humans. Studies have shown that over 95% of drugs validated to be effective in large mice are not effective in human clinical trials. The large animals, primates, which are the animals most closely related to humans, are small in size, mature late (beginning to mate between 6 and 7 years), and are single-born animals with extremely low population propagation rate and high feeding cost. In addition, primate cloning efficiency is low, difficulty is high, and cost is high.

However, pigs, which are animals that have a close relationship with humans except primates, do not have the above-mentioned disadvantages as model animals, and have body types, body weights, organ sizes, and the like close to those of humans, and are very similar to those of humans in terms of anatomy, physiology, nutritional metabolism, disease pathogenesis, and the like. Meanwhile, the pigs have early sexual maturity (4-6 months), high reproductive capacity and multiple fetuses in one litter, and can form a large group within 2-3 years. In addition, the cloning technology of the pig is very mature, and the cloning and feeding cost is much lower than that of a primate; and the pig is taken as a carnivorous animal of human for a long time, and the pig is taken as a disease model animal, so that the problems of animal protection, ethics and the like do not exist.

(4) The efficiency of gene editing by adopting the cas9 high-efficiency expression vector modified by the invention is improved by about 300-400% compared with the original vector.

Drawings

FIG. 1 is a map of pU6gRNA eEF1a-mNLS-hSpCas9-EGFP-PURO vector (pKG-GE 3 for short).

FIG. 2 is a structural map of the original vector pX330-U6-Chimeric _ BB-CBh-hSpCas 9.

FIG. 3 shows the result of the electrophoresis of the original vector pX330 by BbsI and XbaI.

FIG. 4 is an electrophoretogram of gRNAsc1-6 insert synthesized from the whole gene.

FIG. 5 is a structural map of recombinant vector pU6gRNAcas 9.

FIG. 6 is a structural map of pU6gRNA-eEF1a Cas9 vector.

FIG. 7 shows the result of cutting the pU6gRNAcas9 vector with XbaI and AgeI enzymes.

FIG. 8 is a diagram showing the results of electrophoresis of eEF1a1-14 synthesized from the whole gene.

FIG. 9 is a pU6gRNA-eEF1a Cas9+ nNLS vector map.

FIG. 10 shows the result of AgeI and BglII enzymatic cleavage of pU6gRNA-eEF1a Cas 9.

FIG. 11 is a diagram showing the results of electrophoresis of N-NLS 1-12 in whole gene synthesis.

FIG. 12 shows FseI and SbfI cleavage maps of vector pU6gRNA-eEF1a Cas9+ nLS.

FIG. 13 is the result of a gel map of the spliced 2727bp fragment.

FIG. 14 depicts a map of the constructed pKG-U6gRNA vector.

FIG. 15 is a schematic diagram showing ligation of pKG-U6gRNA vectors after annealing of DNA oligo.

FIG. 16 is a graph showing the results of the optimal molar ratio screening assay for gRNA and cas9 vectors.

FIG. 17 is a graph showing comparison of the editing efficiency of MSTN gene.

FIG. 18 is a graph showing the comparison of the editing efficiency of FNDC5 gene.

FIG. 19 is a porcine HBA gene transcription profile.

FIG. 20 is a diagram showing the results of PCR for optimal primer screening for HBA gene amplification.

FIG. 21 is a graph showing the results of PCR amplification of 8 porcine HBA genes using the selected primer set.

FIG. 22 is an analysis chart showing the alignment of the HBA gene sequence obtained by amplification with the published HBA gene sequence.

FIG. 23 shows the HBA-gRNA1 insertion sequence.

FIG. 24 shows the HBA-gRNA2 insertion sequence.

FIG. 25 shows the HBA-gRNA3 insertion sequence.

FIG. 26 shows the HBA-gRNA4 insertion sequence.

FIG. 27 is a PCR result diagram of HBA high-efficiency target gRNA combined screening.

FIG. 28 is a diagram showing the result of HBA PCR (primer HBA-F848/HBA-R1348) detection of HBA mutant monoclonal.

FIG. 29 is a classification chart of sequencing results of monoclonal PCR products.

FIG. 30 is a graph of the alignment of the forward sequencing results of monoclonal HBA without nested peaks to published HBA sequences.

FIG. 31 is a graph showing the comparison of the sequencing result of clone HBA-F848 of HBA-2 with that of HBA-F848 of WT and the sequence analysis.

FIG. 32 is a porcine HBB gene transcription profile.

FIG. 33 is a diagram showing the results of PCR for optimal primer screening for HBB gene amplification.

FIG. 34 is a graph showing the results of PCR amplification of 8 porcine HBB genes using the selected primer set.

FIG. 35 is an analysis chart showing the alignment of the HBB gene sequence obtained by amplification with the published HBB gene sequence.

FIG. 36 shows an HBB-gRNA1 insertion sequence.

FIG. 37 is an HBB-gRNA2 insertion sequence.

FIG. 38 shows the HBB-gRNA3 insertion sequence.

FIG. 39 shows the HBB-gRNA4 insertion sequence.

FIG. 40 is a PCR result diagram of HBB high-efficiency target gRNA combined screening.

FIG. 41 is a graph showing the results of HBB PCR (primers HBB-F695/HBB-R1085) of HBB mutant monoclonal.

FIG. 42 is a graph showing the alignment of the sequencing results of monoclonal HBB with no nested peaks with published HBB sequences.

FIG. 43 is a diagram showing the results of PCR detection of HBA (primer HBA-F848/HBA-R1348) of HBA + HBB mutant monoclonal.

FIG. 44 is a graph showing the results of PCR detection of HBB (primer HBB-F695/HBB-R1085) of HBA + HBB mutant monoclonal.

FIG. 45 is a graph showing the alignment of the forward sequencing nested peaks of HBA + HBB monoclonal HBA with published HBA sequences.

FIG. 46 is a graph showing the alignment of the positive and negative sequencing results of HBA + HBB monoclonal HBB without nested peaks with published HBB sequences.

Detailed Description

Construction of Cas9 high-efficiency expression vector and detection of application effect

1.1Cas9 construction of high-efficiency expression vector

The pU6gRNA eEF1a-mNLS-hSpCas9-EGFP-PURO vector (pKG-GE 3 for short) is modified from addge (Plasmid #42230, from Zhang Feng lab) pX330-U6-Chimeric _ BB-CBh-hSpCas9 vector, and the map is shown in figure 1, the base sequence is shown in SEQ ID NO: shown at 70.

The original vector used, pX330-U6-Chimeric _ BB-CBh-hSpCas9, is shown in FIG. 2 and purchased from addge (Plasmid #42230, from Zhang Feng lab).

The construction steps are as follows:

(1) Removal of excess short gRNA backbone

pX330-U6-Chimeric _ BB-CBh-hSpCas9 (FIG. 2) is digested by BbsI and XbaI, a vector fragment (about 8313 bp) is recovered, an insert fragment 175bp (SEQ I D NO: 1) is synthesized by a whole gene, and the insert fragment is recombined with the recovered vector fragment to obtain a pU6gRNAcas9 vector (FIG. 2).

The construction method comprises the following specific steps:

1) The plasmid pX330-U6-Chimeric _ BB-CBh-hSpCas9 was digested with restriction enzymes BbsI and XbaI (the digestion system is shown in Table 1, and the reaction is carried out at 37 ℃ for 2h.

TABLE 1

Composition of	Measurement of
		ddH ₂ O	To 50ul
pX330 plasmid	2ug
		10XFD buffer	5ul
FD BbsI	1.5ul
		FD XbaI	1.5ul
Total amount of	50

2) The digested pX330-U6-Chimeric _ BB-CBh-hSpCas9 plasmid was isolated by agarose Gel separation, and as a result, as shown in FIG. 3, the large fragment of the vector was recovered by Gel recovery Kit (Novozam FastPull DNA Extraction Mini Kit # DC 301), and the desired fragment was dissolved in 50ul ddH ₂ O at-20 ℃ for later use.

3) Using DNAworks design, 175bp inserts were synthesized in the whole gene, and the primers for whole gene synthesis are shown in Table 2:

TABLE 2

gRNAsc-1	TGTGGAAAGGACGAAACACC(SEQ ID NO：2)
		gRNAsc-2	TGCTATTTCTAGCTCTAAAACAGGTCTTCTCGAAGACCCGGTGTTTCGTCCTTTCCACA(SEQ ID NO：3)
gRNAsc-3	CCTGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAA(SEQ ID NO：4)
		gRNAsc-4	CACGCGCTAGAAAAAAGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGC(SEQ ID NO：5)
gRNAsc-5	GTGCTTTTTTCTAGCGCGTGCGCCAATTCTGCAGACAAATGGCTCTAGAGGTACCCGTT(SEQ ID NO：6)
		gRNAsc-6	TTATGTAACGGGTACCTCTAGAGCC(SEQ ID NO：7)

Whole Gene Synthesis PCR Using Phanta Max (Novozam P505), the mixture was mixed according to the system shown in Table 3:

TABLE 3

Composition of	Volume ul
		ddH ₂ O	To 50ul
2×Phanta Max Buffer	25ul
		dNTP(10mM)	1ul
DMSO	2ul
		Primer mix (10 uM 0.1ul per Primer)	0.6ul
F primer gRNAsc-1 (10 uM)	1ul
		R primer gRNAsc-6 (10 uM)	1ul
Phanta Max	1ul
		Total amount of	50ul

PCR conditions were as follows: cycling at 95 ℃ for 3min (95 ℃ 15s 58 ℃ 15s 72 ℃ for 20 s) 32 times at 72 ℃ for 5min; storing at 4 ℃. A175 bp insert (SEQ ID NO: 1) was obtained by whole gene synthesis, and after completion of PCR, the PCR product was subjected to 1% agarose electrophoresis and separated, and as a result, as shown in FIG. 4, the target fragment was recovered with a Gel recovery Kit (Novonopause FastPulDNA Extraction Mini Kit # DC 301), and dissolved in 50ul ddH ₂ O at-20 ℃ for later use.

4) Recombination of the vector and the 175bp insert was performed using a Cloning recombination Kit (Novozam Clonexpress II One Step Cloning Kit # C112). The components were added according to the system shown in Table 4, mixed and reacted at 37 ℃ for 30min, immediately after completion of the reaction on ice and used for the conversion.

TABLE 4

Composition of	Volume ul
		Linearized vector	150ng
Insert fragment	0.04Xbp number ng
		5x CE II Buffer	2ul
Exnase II	1ul
		ddH ₂ O	To 10ul

5) Transformation, cloning, detection and plasmid miniextraction

a) 100. Mu.L of DH 5. Alpha. Chemocompetent cells (Vazyme # C502) were placed in an ice bath;

b) Adding 10 mu L of the recombination reaction product obtained in the step (4) into a centrifuge tube filled with competent cells, uniformly mixing, and standing in an ice bath for 30min;

c) Placing the competent cells subjected to ice bath for 30min in a water bath at 42 ℃ for 90s, and then quickly transferring the competent cells to the ice bath to cool the cells for 3min;

d) Adding 300 μ L sterile LB culture medium (without antibiotic) into the centrifuge tube, mixing, and shake culturing at 37 deg.C with 220rpm shaking table for 60min;

f) Adding 100uL of competent cells to an LB solid agar culture medium containing corresponding antibiotics, and uniformly coating the competent cells by using a sterile coating rod; and (3) inverting the LB solid agar culture medium coated with the competent cells into an incubator at 37 ℃ for culturing for 12-16 h.

6) Selecting clone, culturing, testing bacterial liquid, correctly cloning and extracting.

4 clones are picked from the constructed plate, respectively placed in 300ul of LB culture medium containing Amp resistance, cultured overnight at 37 ℃, 100ul of the clones separated on the next day are respectively sequenced by using a universal primer LKO1_5, the clone with the correct sequencing result is obtained, 20ul of bacterial liquid is respectively picked and placed in a test tube containing 3ml of Amp LB for overnight culture, plasmid extraction is carried out by using a plasmid miniprep kit on the next day, and the plasmid is stored for later use at-20 ℃. The resulting recombinant vector pU6gRNAcas9 is shown in FIG. 5.

(2) Engineering promoters and enhancers

For the constructed pU6gRNAcas9 vector, xbaI and AgeI endonuclease are used to remove promoter (CMV enhancer) and enhancer sequence (chicken beta-actin), linear vector sequence is recovered by about 7650bp, 554bp sequence containing CMV enhancer and EF1a promoter (SEQ ID NO: 8) is synthesized, and the DNA is recombined with the enzyme digestion vector pU6gRNAcas9 to obtain pU6gRNA-eEF1a Cas9 vector (figure 6).

The construction method comprises the following specific steps:

1) The modified pU6gRNAcas9 plasmid is cut by restriction enzymes XbaI and AgeI

See the linear part of the vector in the process of modifying pU6gRNACas9 vector as described above.

The result of cutting the DNA of pU6gRNAcas9 vector XbaI and AgeI with the enzyme is shown in FIG. 7, and the large fragment of the vector is recovered.

2) The 554bp insert was synthesized whole gene, and the primers for whole gene synthesis are shown in Table 5:

TABLE 5

eEF1a-1	TCTGCAGACAAATGGCTCTAGAGGTACCCG(SEQ ID NO：9)
		eEF1a-2	GGCGGTCAGCCAGGCGGGCCATTTACCGTAAGTTATGTAACGGGTACCTCTAGAGCCAT(SEQ ID NO：10)
eEF1a-3	GCCTGGCTGACCGCCCAACGACCCCCGCCCATTGACGTCAATAGTAACGCCAATAGGGA(SEQ ID NO：11)
		eEF1a-4	TACCGTAAATACTCCACCCATTGACGTCAATGGAAAGTCCCTATTGGCGTTACTATTGA(SEQ ID NO：12)
eEF1a-5	AATGGGTGGAGTATTTACGGTAAACTGCCCACTTGGCAGTACATCAAGTGTATCATATG(SEQ ID NO：13)
		eEF1a-6	TACCGTCATTGACGTCAATAGGGGGCGTACTTGGCATATGATACACTTGATGTACTGCC(SEQ ID NO：14)
eEF1a-7	CCTATTGACGTCAATGACGGTAAATGGCCCGCCTGGCATTGTGCCCAGTACATGACCTT(SEQ ID NO：15)
		eEF1a-8	GACTAATACGTAGATGTACTGCCAAGTAGGAAAGTCCCATAAGGTCATGTACTGGGCAC(SEQ ID NO：16)
eEF1a-9	TGGCAGTACATCTACGTATTAGTCATCGCTATTACCATGGGGGCAGAGCGCACATCGCC(SEQ ID NO：17)
		eEF1a-10	GGATCAATTGCCGACCCCTCCCCCCAACTTCTCGGGGACTGTGGGCGATGTGCGCTCTG(SEQ ID NO：18)
eEF1a-11	GGGGTCGGCAATTGATCCGGTGCCTAGAGAAGGTGGCGCGGGGTAAACTGGGAAAGTGA(SEQ ID NO：19)
		eEF1a-12	CCCCCACCCTCGGGAAAAAGGCGGAGCCAGTACACGACATCACTTTCCCAGTTTACCCC(SEQ ID NO：20)
eEF1a-13	TCCCGAGGGTGGGGGAGAACCGTATATAAGTGCAGTAGTCGCCGTGAACGTTCTTTTTC(SEQ ID NO：21)
		eEF1a-14	GTTGCGAAAAAGAACGTTCACGGCG(SEQ ID NO：22)

The whole gene synthesis method refers to the whole gene synthesis part in the modification process of the pU6gRNACas9 vector.

3) Recombination of linearized vector and synthetic insert see above for cloning of the recombinant portion in the engineering of the pU6gRNACas9 vector. The electrophoresis result of the eEF1a1-14 whole gene synthesis is shown in FIG. 8, and the target fragment 554bp is recovered by gel.

4) Selecting clone, culturing, transferring bacteria liquid, correctly cloning and sampling

See above, the cloning, culture, bacterial liquid transfer (sequencing using the same universal primer LKO1_ 5) and correct cloning spot were picked during the process of the transformation of the pU6gRNAcas9 vector. The resulting pU6gRNA-eEF1a Cas9 vector is shown in FIG. 6.

(3) Cas9 gene N-terminal increasing NLS sequence

The constructed vector pU6gRNA-eEF1a Cas9 is subjected to enzyme digestion by AgeI and BglII, a 7786bp vector sequence is recovered, the sequence with the increased NLS is supplemented to an enzyme digestion site, the following sequence 447bp is synthesized to comprise 2 nuclear localization signals and a partially-excised Cas9 coding sequence (SEQ ID NO:23, and a pU6gRNA-eEF1a Cas9+ nNLS vector is obtained through recombination (figure 9).

The construction method comprises the following specific steps:

1) pU6gRNA-eEF1a Cas9 plasmid subjected to enzyme digestion modification by using restriction enzymes AgeI and BglII

See the above linear part of the vector during the process of engineering the pU6gRNAcas9 vector.

The result of AgeI and BglII enzymatic cleavage of pU6gRNA-eEF1a Cas9 is shown in FIG. 10, and the large vector fragment is recovered.

2) The 447bp insert was synthesized from the whole gene, and the primers for the whole gene synthesis are shown in Table 6:

TABLE 6

Referring to the whole gene synthesis part in the process of modifying the pU6gRNAcas9 vector, the electrophoresis result of N-NLS 1-12 whole gene synthesis is shown in FIG. 11, and the target fragment of 447bp is recovered from the gel.

3) Linearization vectors and recombination of synthetic inserts

See above for cloning of recombinant portions during engineering of the pU6gRNAcas9 vector.

See above the pU6gRNAcas9 vector in the transformation process of picking cloning, culture, bacteria liquid sent to test (using synthetic primer gRNA-F: ttttagagctaGAAAtagcaag for sequencing) and correct cloning of the small extract. The resulting pU6gRNA-eEF1a Cas9+ nNLS vector map is shown in FIG. 9.

(4) Adding NLS, P2A-EGFP-T2A-PURO and WPRE-3' LTR-bGH polyA signals to C end of Cas9 gene

The constructed vector is named as pU6gRNA-eEF1a Cas9+ nNLS, enzyme digestion is carried out by using FseI and SbfI, the vector sequence is recovered by 7781bp, the synthetic sequence 2727bp comprises the sequence of NLS-P2A-EGFP-T2A-PURO-WPRE-3' LTR-bGH polyA signals (SEQ ID NO: 36), and the vector is recombined with the vector fragment to obtain the vector pU6gRNA eEF1a-mNLS-hSpCas9-EGFP-PURO.

The construction method comprises the following specific steps:

1) The pU6gRNA-eEF1a Cas9+ nNLS plasmid which is enzyme-cut and transformed by restriction endonucleases FseI and SbfI is used for recovering a 7781bp linear vector fragment:

see the above pU6gRNAcas9 vector in the transformation process of the linear part of the vector. The FseI and SbfI enzymatic cleavage maps of the vector pU6gRNA-eEF1a Cas9+ nNLS are shown in FIG. 12, and the large fragment of the vector is recovered.

2) 2727bp insert fragment for whole gene synthesis

The whole gene synthesis method refers to the whole gene synthesis part in the process of modifying the pU6gRNAcas9 vector. The 2727bp synthetic fragment is derived from 3 fragment overlap extension PCR, and specifically comprises the following steps:

fragment one: the nucleotide sequence containing the nuclear localization signal and the P2A and EGFP overlapping sequence 192bp (SEQ ID NO: 37) are synthesized, the primer sequences are shown in Table 7 and obtained by whole gene synthesis (see the method that the whole gene synthesis part is obtained in the process of modifying the pU6gRNAcas9 vector).

TABLE 7

C-NLS-1	CGGCGGCCACGAAAAAGGCCGGCCAGGCAAAAAAG(SEQ ID NO：38)
		C-NLS-2	AGGCCGCTTGGAGCCGCCCTTTTTCTTTTTTGCCTGGCCGGCCTTTTTCGTGGCCGCCG(SEQ ID NO：39)
C-NLS-3	GGCTCCAAGCGGCCTGCCGCGACGAAGAAAGCGGGACAGGCCAAGAAAAAGAAAGGATC(SEQ ID NO：40)
		C-NLS-4	TCCGGCTTGTTTCAGCAGAGAGAAGTTTGTTGCGCCGGATCCTTTCTTTTTCTTGGCCT(SEQ ID NO：41)
C-NLS-5	CTGCTGAAACAAGCCGGAGATGTCGAAGAGAATCCTGGACCGGTGAGCAAGGGCGAGGA(SEQ ID NO：42)
		C-NLS-6	CGGTGAACAGCTCCTCGCCCTTGCTCAC(SEQ ID NO：43)

Fragment two: the EGFP fragment 744bp (SEQ ID NO: 68), the template was commercial vector EGFP-N1, and the primers are shown in Table 8, and obtained by conventional PCR.

TABLE 8

EGFP-F	GTGAGCAAGGGCGAGGAGCTGTTCACCGG(SEQ ID NO：44)
		EGFP-R	TAGAAGACTTCCCCTGCCCTCGCCGGAGCCCTTGTACAGCTCGTCCATGCCGAGAGTG(SEQ ID NO：45)

Fragment three: T2A-PURO-WPRE-3' LTR-polyA signals sequence 1840bp (SEQ ID NO: 69), lentiCRISPRRV 2 (adddge Plasmid # 52961) as a template, primers shown in Table 9, V2-F/V2-R primer PCR using LentiCRISPRRV 2 as a template, and target fragment 1840bp obtained by T2A-F and V2-R PCR using the PCR product of the previous step as a template.

TABLE 9

The three fragments are used as a template, a primer C-NLS-1/V2-R PCR is used for obtaining a full-length 2727bp target fragment (SEQ ID NO: 36), and the final assembled 2727bp fragment gel diagram result is shown in figure 13.

3) Recombination of linearized vectors and synthetic inserts

The insert fragments of the linearized vector pU6gRNA-eEF1a Cas9+ nNLS 7781bp and 2727bp are recombined, and the method refers to the cloning and recombination part in the process of modifying the pU6gRNAcas9 vector.

See above pU6gRNAcas9 vector in the transformation process picking cloning, culture, bacteria liquid transfer (using synthetic primers Cas9-5-F: CCACCAGAGCATCACCGGCCTG (SEQ ID NO: 49) and F1ori-R: cacacccgccgcgcttaatgcg (SEQ ID NO: 50) for test), correct cloning of the mini-extract. The map of the obtained final modified vector pU6gRNA eEF1a-mNLS-hSpCas9-EGFP-PURO is shown in figure 1, and the base sequence (SEQ ID NO: 70) is shown.

The main elements of the modified vector pU6gRNA eEF1a-mNLS-hSpCas9-EGFP-PURO are as follows:

1) gRNA expression elements: U6-gRNA scaffold.

2) A promoter: CMV enhancer and EF1a hybrid promoter.

3) Cas9 gene containing multiple NLS: cas9 gene containing N-and C-terminal multinuclear localization signal (NLS).

4) Screening for marker genes: the fluorescent and resistant double-screening marker original P2A-EGFP-T2A-PURO.

5) Elements that enhance translation: WPRE and 3' LTR, enhancing translation of cas9 and the selectable marker gene.

6) Transcription termination signal: bGH polyA signal.

7) Carrier skeleton: including Amp resistance elements and ori replicons.

1.2 construction of MSTN and FNDC5 Gene gRNA target vectors to detect efficiency of modified cas9 vector

pKG-U6gRNA vector: a pUC57 vector is derived, a pKG-U6gRNA insertion sequence (a DNA fragment containing a U6 promoter, a BbsI enzyme cutting site and a sgRNA framework sequence, namely SEQ ID NO: 67) is connected through an EcoRV enzyme cutting site, the pKG-U6gRNA insertion sequence is reversely inserted into the pUC57 vector, and a positive clone is obtained after bacteria are transformed. The complete sequence of pKG-U6gRNA vector (SEQ ID NO: 71).

pKG-U6gRNA insertion sequence (the first underlined part is U6 promoter sequence, the capital base letter segment is the sequence of two BbsI enzyme cutting sites, the second underlined part is sgRNA framework sequence):

gataaacatgtgagggcctatttcccatgattccttcatatttgcatatacgatacaaggctgttaga gagataattggaattaatttgactgtaaacacaaagatattagtacaaaatacgtgacgtagaaagtaataatttc ttgggtagtttgcagttttaaaattatgttttaaaatggactatcatatgcttaccgtaacttgaaagtatttcga tttcttggctttatatatcttgtggaaaggacgaaacaccGGGTCTTCGAGAAGACCTgttttagagctagaaata gcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgcttttttctagcgcgtgcgccaattctgcagacaaatggctctagaggtacccatag

the map of the constructed pKG-U6gRNA vector is as shown in fig. 14:

synthesizing 2 pairs of complementary DNA oligos for each target, and forming a DNA double strand which is complementary to a cohesive end of a BbsI (restriction enzyme digested product) vector pKG-U6gRNA by annealing, as shown in figure 15, when a target insertion sequence sense strand is synthesized, because a U6 promoter starts to transcribe from the first g after the promoter, when the target is not started by g, one g is added in front of the target, and cacc is added in front of the g and is complementary to the U6 end of the BbsI vector; when synthesizing a complementary strand of the target insertion sequence, a complementary sequence of g and the target needs to be synthesized, and then an aaac sequence is added to the 5' end to be complementary with the sequence of the gRNA framework end digested by BbsI. When the target is g, g can be not added before the target of the sense strand, and c which is complementary to the added g is added to the 3 end of the complementary strand.

Designing two gRNA targets of MSTN:

MSTN-gRNA1: GCTGATTGTTGCTGGTCCCG (SEQ ID NO: 51) and

MSTN-gRNA2:TTTCCAGGCGAAGTTTACTG(SEQ ID NO：52)。

two gRNA targets of FNDC5 were designed:

FNDC5-gRNA1: TGTACTCAGTGTCCTCCTCC (SEQ ID NO: 53) and

FNDC5-gRNA2：GCTCTTCAAGACGCCTCGCG(SEQ ID NO：54)。

and primers for detecting later gene editing efficiency are respectively designed on two sides of the target spot:

MSTN detection primer:

MSTN-F196 TCTCTCAGACAGTGCAGGCATTA(SEQ ID NO：55)

MSTN-R1351 CGTTTCCGTCGTAGCGTGATAAT(SEQ ID NO：56)

FNDC5 detection primer:

FNDC5-F209 CAGTTCTCACTTGATGGCCTTGG(SEQ ID NO：57)

FNDC5-R718 AGGGGTCTGGGGAGGAATGG(SEQ ID NO：58)

the following double strands were synthesized according to the four targets:

cloning a gRNA target sequence to a pKG-U6gRNA vector framework, and specifically comprising the following steps:

(1) Digesting 1ug pKG-U6gRNA plasmid with restriction enzyme BbsI;

(2) Carrying out agarose gel separation on the digested pKG-U6gRNA plasmid, and purifying and recovering a digested product by using a gel recovery kit;

(3) The sequences of the oligonucleotide strands gRNA-S and gRNA-A were annealed according to the following procedure:

95 ℃ C, 5min and then reduced to 25 ℃ at a rate of 5 ℃/min.

(4) The ligation reaction was carried out according to the following system at 37 ℃ for 60min:

(5) Transformation of

1) 100. Mu.L of competent cells (Vazyme) were placed in an ice bath;

2) Adding 20 mu L of the ligation plasmid solution obtained in the step (4) into a centrifuge tube filled with competent cells, uniformly mixing, and standing in an ice bath for 30min;

3) Placing the competent cells in ice bath for 30min in water bath at 42 deg.C for 90s, and rapidly transferring to ice bath to cool the cells for 3min;

4) Adding 300 μ L sterile LB culture medium (without antibiotic) into the centrifuge tube, mixing, and shake culturing at 37 deg.C with 220rpm shaking table for 60min;

5) Adding 100uL of competent cells to an LB solid agar medium containing corresponding antibiotics, and uniformly coating the competent cells by using a sterile coating rod; inverting the LB solid agar culture medium coated with the competent cells in an incubator at 37 ℃ for culturing for 12-16 h;

6) Selecting, cloning, culturing, sending to a company for sequencing, and performing small plasmid extraction after determining that the vector containing the target gRNA is constructed correctly.

2 clones of each constructed plate are picked, 16 clones in total are respectively placed in LB culture medium containing 300ul of Amp resistance, the culture is carried out at 37 ℃ overnight, 100ul of the clones are separated on the second day, sequencing is respectively carried out by using universal primers M13F or M13R (sequencing is carried out by a general biology company), the clone with the correct sequencing result is obtained, 20ul of bacterial liquid is respectively taken and is cultured in a test tube containing 3ml of Amp LB overnight, plasmid extraction is carried out by using a plasmid miniprep kit on the second day, and the plasmids are respectively named as pKG-U6gRNA (MSTN-1), pKG-U6gRNA (TN MS-2), pKG-U6gRNA (FNDC 5-1) and pKG-U6gRNA (FNDC 5-2) for standby. According to the same method, 10 tubes of pKG-GE3 plasmid were drawn in small tubes for use.

1.3gRNA vector and Cas9 vector optimal molar ratio screening

In order to determine that when double gRNAs are used to cause genome fragment deletion, two gRNA vectors pKG-U6gRNA (about 3.0 kb) containing target spots and a Cas9 vector pU6gRNA eEF1a-mNLS-hSpCas9-EGFP-PURO (pKG-GE 3 for short about 10.5 kb) are subjected to common electrotransfer according to the optimal proportion of the three plasmids, the gRNA vectors and the Cas9 vectors are subjected to electrotransfer after being mixed according to different proportions, and the electrotransfer cell gene editing efficiency after the gRNA and the Cas9 plasmids are mixed according to different proportions is detected to determine the optimal proportion.

The method comprises the following specific steps:

(1) Preparation of primary pig fibroblasts

1) Respectively taking 4 female pigs (1 2 3) of Cong Jiang newly born fragrant pigs and 0.5g of pig ear tissues of 4 male pigs (AB C D), removing external tissues, and soaking for 30-40s with 75% of alcohol.

2) 5 washes with PBS containing 5%P/S (Gibco Penicillin-Streptomyces) and one wash with PBS without P/S:

wherein the PBS formula of 5%P/S is: 5%P/S (Gibco Penicillin-Streptomyces) +95% PBS,5%, 95% by volume.

3) The tissue was minced with scissors, 5mL of 1% collagenase (Sigma) was added and digested in a shaker at 37 ℃ for 1h.

4) 500g was centrifuged for 5min, the supernatant removed, and the pellet resuspended in 1mL complete medium and plated into a 9cm cell culture dish containing 10mL complete medium and sealed with 0.2% gelatin (VWR).

Wherein, the formula of the complete cell culture medium is as follows: 15% fetal bovine serum (Gibco) +83% DMEM medium (Gibco) +1%P/S (Gibco Penicillin-Streptomyces) +1% HEPES (Solarbio), 15%, 83%, 1% in volume%.

5) Standing at 37 deg.C, 5% CO ₂ (volume percent), 5%O ₂ The culture was carried out in a constant temperature incubator (volume percent).

6) When the cells were cultured to about 60% of the bottom of the dish, the cells were digested with 0.25% (Gibco) trypsin, then the complete medium was added to stop the digestion, the cell suspension was transferred to a 15mL centrifuge tube, centrifuged at 400g for 4min, the supernatant was discarded, and the cells were frozen using a cell freezing medium (90% complete medium +10% DMSO, vol.%) for use.

(2) gRNA and Cas9 expression vector mixed electric primary pig cell with different molar ratios

Respectively co-transfecting a Cas9 expression vector pU6gRNA eEF1a-mNLS-hSpCas9-EGFP-PURO and the gRNA vectors pKG-U6gRNA (MSTN-1) and pKG-U6gRNA (MSTN-2) constructed as above to a primary pig fibroblast.

Electrotransformation experiments were carried out using a mammalian nuclear transfection kit (Neon kit, thermofeisher) with a Neon TM transfection system electrotransfer apparatus.

The grouping is as follows:

group B (control): pU6gRNA eEF1a-mNLS-hSpCas9-EGFP-PURO, the actual dosage of the plasmid is 2ug

Group 1: pKG-U6gRNA (MSTN-1) + pKG-U6gRNA (MSTN-2) + pU6gRNA eEF1a-mNLS-hSpCas9-EGFP-PURO, in a molar ratio of 0.5:0.5:1, the actual dosage of the plasmid is 0.22ug +1.56ug, the total amount is 2ug

Group 2: pKG-U6gRNA (MSTN-1) + pKG-U6gRNA (MSTN-2) + pU6gRNA eEF1a-mNLS-hSpCas9-EGFP-PURO, in a molar ratio of 1:1:1, the actual dosage of the plasmid is 0.36ug +1.27ug, and the total amount is 2ug

Group 3: pKG-U6gRNA (MSTN-1) + pKG-U6gRNA (MSTN-2) + pU6gRNA eEF1a-mNLS-hSpCas9-EGFP-PURO, in a molar ratio of 1.5:1.5:1, the actual dosage of plasmid is 0.46ug +1.08ug, the total amount is 2ug

Group 4: pKG-U6gRNA (MSTN-1) + pKG-U6gRNA (MSTN-2) + pU6gRNA eEF1a-mNLS-hSpCas9-EGFP-PURO, in a molar ratio of 2:2:1, the actual dosage of the plasmid is 0.53ug +0.93ug, the total amount is 2ug

Preparing an electrotransformation reaction liquid, wherein the system is as follows:

the bubbles are not generated by carelessness in the process of uniformly mixing;

carrying out electrotransformation on primary pig cells and collecting the cells:

1) Digesting cells by using pancreatin, washing the obtained cell suspension once by using PBS phosphate buffer solution (Solarbio), centrifuging for 6min at 600g, removing a supernatant, and re-suspending the cells by using 7uL of electric transfer basic solution R, wherein bubbles are prevented from being generated in the re-suspending process;

2) Sucking 7uL of cell suspension, adding the cell suspension into the electrotransformation reaction liquid obtained in the step 1), and uniformly mixing, wherein no air bubble is generated in the uniformly mixing process;

3) Placing the electric rotating cup with the reagent cassette in a cup groove of a Neon (TM) transformation system electric rotating instrument, and adding 3mL of E Buffer;

4) Sucking 10uL of the mixed solution obtained in the step 3) by using an electric rotary gun, inserting the mixed solution into a click cup, selecting an electric rotary program (1450V 10ms 3pulse), immediately transferring the mixed solution in the electric rotary gun into a 6-well plate in a super clean bench after electric shock transfection, wherein each well contains 2mL of complete culture solution of 15% fetal bovine serum (Gibco) +83% DMEM medium (Gibco) +1%P/S (Gibco penilligin-Streptomycin) +1 HEPES (Solarbio);

5) Mixing, and placing at 37 deg.C, 5% CO ₂ 、5％O ₂ Culturing in a constant-temperature incubator;

6) And (3) performing electrotransformation for 6-12h for liquid exchange, performing electrotransformation for 48h by using trypsin for digestion, collecting cells into a 1.5ml EP tube, and performing mutation efficiency PCR detection at the later stage.

(3) PCR detection of MSTN gene deletion mutation efficiency

1) To the cells collected in the 1.5mL centrifuge tube in the previous step (depending on the cell amount, the cells are too much to be diluted appropriately and then a part is lysed), 10uL of a lysis solution prepared (Kapa biosystems: kapa hotspot mouse mutagenesis kit, cat # KK 7352) is added to lyse the cells and crude extract the genomic DNA of the cells.

The KAPA2G lysate preparation system is as follows:

10X extract Buffer 1uL

Kapa Express extract enzyme 0.2uL

ddH ₂ O 8.8uL

and (3) cracking: the temperature of 75 ℃ is 15min to 95 ℃ and the temperature of 5min to 4 ℃, and the genome DNA is preserved at the temperature of-20 ℃ after the reaction is finished;

2) The MSTN group uses MSTN-F896/MSTN-R1351 primer for PCR detection, and the PCR reaction system is as follows:

the reaction conditions were as follows

The results of the electrophoretic analysis are shown in FIG. 16: the molar ratio of gRNA1: gRNA2: cas9 was group 1 (0.5; group 2 (1.0; group 3 (1.5; group 4 (2.0; group B, no gRNA control. The result shows that the 456bp band is a wild-type band (WT), and the band around 329bp (456 bp-127 bp theoretical deletion) is a deletion mutant band (MT).

According to the formula: gene deletion mutation efficiency =100 × (MT gray/MT band bp number)/(WT gray/WT band bp number + MT gray/MT band bp number)%, and the calculated gene deletion mutation efficiency of MSTN group 1 is 28.6%, the gene deletion mutation efficiency of MSTN group 2 is 77.8%, the gene deletion mutation efficiency of MSTN group 3 is 86.8%, and the gene deletion mutation efficiency of MSTN group 4 is 81.5%, wherein the group 3 gene editing efficiency is the highest, and the optimal usage of two gRNA plasmids and Cas9 plasmids is determined to be a molar ratio of 1.5:1.5:1, the actual dosage of the plasmid is 0.46ug +1.08ug.

1.4Cas9 expression vector Gene editing Effect test

In order to detect the gene editing efficiency of the modified pU6gRNA eEF1a-mNLS-hSpCas9-EGFP-PURO vector relative to the pX330-U6-Chimeric _ BB-CBh-hSpCas9 vector before modification. In the embodiment, two gRNA target vectors of the constructed pig MSTN gene and FNDC5 gene and a modified cas9 vector are utilized, and the gene editing efficiency of the vectors is determined by electrically transforming pig primary fibroblasts and detecting the deletion mutation efficiency of each gene through PCR.

The method comprises the following specific steps:

(1) Electroporation of porcine primary cells

Cas9 expression vector pX330 or modified pU6gRNA eEF1a-mNLS-hSpCas9-EGFP-PURO and gRNA vectors pKG-U6gRNA (MSTN-1) and pKG-U6gRNA (MSTN-2) or pKG-U6gRNA (FNDC 5-1) and pKG-U6gRNA (FNDC 5-2) are co-transfected into pig primary fibroblasts respectively.

Electrotransfer experiments were performed using a mammalian nuclear transfection kit (Neon) with a Neon TM transfection system electrotransfer instrument.

MSTN group B: pKG-U6gRNA (MSTN-1) and pKG-U6gRNA (MSTN-2)

MSTN set 330: pX330+ pKG-U6gRNA (MSTN-1) and pKG-U6gRNA (MSTN-2)

MSTN group KG: pU6gRNA eEF1a-mNLS-hSpCas9-EGFP-PURO + pKG-U6gRNA (MSTN-1) and pKG-U6gRNA (MSTN-2)

FNDC5 group B: pKG-U6gRNA (FNDC 5-1) and pKG-U6gRNA (FNDC 5-2)

FNDC5 group 330: pX330+ pKG-U6gRNA (FNDC 5-1) and pKG-U6gRNA (FNDC 5-2)

FNDC5 group KG: pU6gRNA eEF1a-mNLS-hSpCas9-EGFP-PURO + pKG-U6gRNA (FNDC 5-1) and pKG-U6gRNA (FNDC 5-2)

see above (1.3 gRNA vector and Cas9 vector optimal molar ratio screening) section for the method of electroporation and cell collection of porcine primary cells.

(2) PCR detection of MSTN and FNDC5 gene mutation efficiency

Cell lysis, PCR detection and electrophoresis were performed according to the procedure described above (1.3 gRNA vector and Cas9 vector optimal molar ratio screening- (3) PCR detection of MSTN gene deletion mutation efficiency).

3ul of PCR product was collected and analyzed by agarose gel electrophoresis, and the results are shown in FIGS. 17 and 18. FIG. 17 is a comparison of the editing efficiency of MSTN genes, and the ratio of KG to 330 mutant/wild-type bands was higher, indicating that the editing efficiency of KG genes was higher than 330. FIG. 18 is a comparison of the editing efficiency of FNDC5 gene, and the ratio of KG gene editing to wild type gene editing was higher than that of group 330, indicating that KG gene editing efficiency was higher than that of group 330.

According to the formula: the gene deletion mutation efficiency =100 × (MT gray level/MT band bp number)/(WT gray level/WT band bp number + MT gray level/MT band bp number)%, and the gene deletion mutation efficiency of the MSTN-330 group and the gene deletion mutation efficiency of the MSTN-KG group were calculated to be 27.6% and 86.5%, respectively. The FNDC5-330 group gene deletion mutation efficiency is 18.6 percent, the FNDC5-KG group gene deletion mutation efficiency is 81.7 percent, and the editing efficiency of the modified vector pU6gRNA eEF1a-mNLS-hSpCas9-EGFP-PURO gene is obviously improved (about 3 to 4 times).

Knock-out of HBA Gene

2.1HBA Gene knockout target gRNA design and construction

(1) Extraction of genomic DNA from porcine ear tissue

Column extraction of genomic DNA from ear Tissue of 8 piglets (male A B C D female 12 3) was performed using the Fastpure Cell/Tissue DNA Isolation Mini Kit (Vazyme Cat. DC102-01) from Vazyme, inc., and finally genomic DNA was dissolved in sterilized deionized water and quantified using NanoDrop and stored at-20 ℃ for future use.

(2) Conservative analysis of HBA gene knockout preset target exon and adjacent genome sequence

1) Search for pig HBA Gene information as follows

LOC110259958 hepatoglobin subbunit alpha [ Sus scrofa (pig) ] Gene ID: 110259958location.

The transcript pattern of the HBA gene is shown in FIG. 19 (coding exons in the dark wide lines and non-coding exons in the light wide lines). Including 3 exons, of which exon 2 is 205bp, this example proposes to design the target within exon 2 of the HBA gene.

2) HBA gene knockout preset target point exon and adjacent genome sequence PCR amplification primer design

According to the found HBA genome sequence of the pig

(https:// www.ncbi.nlm.nih.gov/nuccore/NC _010445.4report = genbank and from =41482353 and to =41483564 and strand = true), primers were designed to amplify the 8 porcine genomic samples at the front site of exon 2 of the HBA gene.

Primer design was performed using Primer3, and the design results were as follows:

HBA-GT-F440 gggacttcaacgggtagaacctg(SEQ ID NO：72)

HBA-GT-F727 cccgcacgcttctggtcccgacc(SEQ ID NO：73)

HBA-GT-R1503 GCAGAGTGCAAGAGGGCCCCAC(SEQ ID NO：74)

HBA-GT-R1541 ATTCAACGATCAGGAGGTCAGGG(SEQ ID NO：75)

3) HBA genome PCR amplification primer screening

PCR was performed using the genome extracted from ear tissue of pig (female 2) as a template, using the designed two upstream and two downstream combinations, max enzyme (Vazyme: P505), and electrophoresed to select the amplification primers, the result is shown in FIG. 20, in which 55 is the HBA-GT-F440/HBA-GT-R1503 primer amplification band; 56 is HBA-GT-F440/HBA-GT-R1541 primer amplification band; 57 is an HBA-GT-F727/HBA-GT-R1503 primer amplification band; 58 is HBA-GT-F727/HBA-GT-R1541 primer amplification band, and 58, i.e. HBA-GT-F727/HBA-GT-R1541, is determined to be adopted as the primer.

4) PCR amplification of 8 pig HBA gene fragments

The HBA genome fragment was amplified with 8 genome templates (male A B C D female 12 3), primers HBA-GT-F727/HBA-GT-R1541, max enzyme, respectively, and the results are shown in FIG. 21.

5) HBA gene sequence conservation analysis

The PCR amplification product was subjected to sequencing using the amplification primers (sequencing by general Bio Inc.). The sequencing result is analyzed by comparing the Snapgene with HBA gene sequences published on the Internet, the result is shown in FIG. 22, white vertical lines represent mutation or deletion mutation, black vertical lines represent insertion mutation, and design of target points and detection primers on the mutation sequences needs to be avoided.

(3) Double gRNA targets are designed in a conserved region on a preset target exon, so that a code shift mutation of a coding exon can be caused

(1) Targeted gRNA design using synthego

Designing a target to avoid possible mutation sites, and designing the gRNA of the target by using synthgo:

https://www.synthego.com/products/bioinformatics/crispr-design-tool

HBA gene knockout targets are designed as follows:

HBA-sgRNA1：CCCCACTTCAACCTGAGCCA(SEQ ID NO：76)

HBA-sgRNA2：CCTTGACCTGGTCGGAGCCG(SEQ ID NO：77)

HBA-sgRNA3：GACCAAAGCTGTGGGCCACC(SEQ ID NO：78)

HBA-sgRNA4：CGGGTCCACACGCAGCTTGT(SEQ ID NO：79)

the combinations of targets and the resulting theoretical deletions are shown in table 10.

TABLE 10 target combinations and resulting theoretical deletions

Based on the alignment, possible mutation sites were avoided and primers for later detection of mutations were designed as shown in table 11:

TABLE 11 HBA detection primers

HBA-F848	GCAGAGGCCCTGGAAAGgtgag(SEQ ID NO：80)
		HBA-R1348	TCACCAGCAGGCAGTGGCTCAG(SEQ ID NO：81)

Synthetic HBA insert complementary DNA oligos for 4 targets are shown in table 12:

TABLE 12

HBA-1S	caccgCCCCACTTCAACCTGAGCCA(SEQ ID NO：82)
		HBA-1A	aaacTGGCTCAGGTTGAAGTGGGGc(SEQ ID NO：83)
HBA-2S	caccgCCTTGACCTGGTCGGAGCCG(SEQ ID NO：84)
		HBA-2A	aaacCGGCTCCGACCAGGTCAAGGc(SEQ ID NO：85)
HBA-3S	caccGACCAAAGCTGTGGGCCACC(SEQ ID NO：86)
		HBA-3A	aaacGGTGGCCCACAGCTTTGGTC(SEQ ID NO：87)
HBA-4S	caccgCGGGTCCACACGCAGCTTGT(SEQ ID NO：88)
		HBA-4A	aaacACAAGCTGCGTGTGGACCCGc(SEQ ID NO：89)

Each target synthesized 2 pairs of complementary DNA oligos, which upon annealing formed a DNA duplex complementary to the cleaved sticky ends of pKG-U6gRNA vector BbsI (FIG. 15).

The double-stranded insertion sequence formed after the complementary DNA oligo annealing of the insertion sequence of the synthesized HBA gene target is shown in FIGS. 23 to 26:

the HBA-gRNA1 insertion sequence is shown in figure 23; the HBA-gRNA2 insertion sequence is shown in figure 24; the HBA-gRNA3 insertion sequence is shown in figure 25; the sequence of HBA-gRNA4 insertion is shown in FIG. 26.

The HBA gRNA vector construction was performed with reference to the gRNA vector construction process described above (1.2 construction of MSTN and FNDC5 gene gRNA target vectors to check the efficiency of the engineered cas9 vector).

The correct clones were designated pKG-U6gRNA (HBA-1), pKG-U6gRNA (HBA-2), pKG-U6gRNA (HBA-3), pKG-U6gRNA (HBA-4), respectively, and the plasmids were mini-extracted and stored at-20 ℃ for use.

2.2 different target gRNA vector combination and Cas9 vector electrotransfer pig ear primary fibroblast

Porcine primary fibroblasts were co-transfected with the 4 gRNA vectors pKG-U6gRNA (HBA) constructed and Cas9 expression vector pKG-GE 3. Electrotransformation experiments were performed using a mammalian fibroblast cell nuclear transfection kit (Neon) with a Neon TM transfection system electrotransfer instrument.

Group 1: theoretical deletion of 68bp for pKG-U6gRNA (HBA-1) + pKG-U6gRNA (HBA-3) + pKG-GE3

Group 2: theoretical deletion of 122bp group 3 for pKG-U6gRNA (HBA-1) + pKG-U6gRNA (HBA-4) + pKG-GE 3: theoretical deletion of 62bp for pKG-U6gRNA (HBA-2) + pKG-U6gRNA (HBA-3) + pKG-GE3

Group 4: theoretical deletion 116bp control for pKG-U6gRNA (HBA-2) + pKG-U6gRNA (HBA-4) + pKG-GE 3: the electroporation reaction solution was prepared for non-electroporated WT cells according to a molar ratio of gRNA1: gRNA2: cas9=1.5, and the system was as follows:

the porcine primary cells were electroporated and cell collection were performed according to the electroporation method mentioned above (optimal molar ratio screening of 1.3gRNA vector and Cas9 vector).

2.3 PCR detection of the cells after electroporation to determine highly efficient editing target combinations

Cell lysis, PCR detection (detection primers: HBA-F848/HBA-R1348) and electrophoretic analysis were performed according to the procedure described above (1.3 gRNA vector and Cas9 vector optimal molar ratio screening- (3) PCR detection of MSTN gene deletion mutation efficiency), with the following results.

The PCR detection result of HBA gRNA combined mutation efficiency is shown in FIG. 27, HBA-1,3 is group 1 (gRNA 1,3); HBA-1,4 is group 2 (gRNA 1,4); HBA-2,3 is group 3 (gRNA 2,3); HBA-2,4 is group 4 (gRNA 2,4); control was non-electroporated WT cells.

The larger band is the wild-type band, the smaller band is the band after deletion mutation, and the brighter the smaller band (mutated band) is relative to the larger band (wild-type band), the higher the mutation efficiency. The experimental result shows that the group 4 (pKG-U6 gRNA (HBA-2) + pKG-U6gRNA (HBA-4) + pKG-GE 3) theoretically lacks 116bp, and the mutation efficiency is highest.

2.4 preparation of pig ear Primary fibroblast HBA Gene editing monoclonal cells

(1) Porcine ear primary fibroblast cell electrotransformed by using high-efficiency target gRNA combination and Cas9 vector

Cell electrotransfer is carried out according to a method for electrotransfering pig ear primary fibroblasts by combining the target gRNA vector and the Cas9 vector (see the optimal molar ratio screening of the 1.3gRNA vector and the Cas9 vector), and number 2 cells (female, blood type AO) are used for electrotransfer:

HBA mutation: pKG-U6gRNA (HBA-2) (0.46 ug) + pKG-U6gRNA (HBA-4) (0.46 ug) + pKG-GE3 (1.08 ug). The molar ratio of each component is as follows: pKG-U6gRNA (HBA-2): pKG-U6gRNA (HBA-4): pKG-GE3=1.5:1.5:1.

(2) Isolating single clone, amplifying culture

1) Culturing the cells after electrotransfer for 36-48 hr, performing monoclonal sorting, digesting with trypsin, neutralizing with complete culture medium, centrifuging for 5min at 500g, removing supernatant, re-suspending the precipitate with 1mL of complete culture medium, diluting properly, picking out monoclonal with oral pipette, transferring into 96-well plate containing 200ul of complete culture medium, picking out 96 monoclonal per cell group, placing at 37 deg.C, 5%CO ₂ 、5％O ₂ The cell culture medium is changed every 2 to 3 days, the growth condition of each hole of cells is observed by a microscope during the cell culture medium changing process, and holes without cells and non-monoclonal cells are removed;

2) After the cells in the wells of the 96-well plate grew to the bottom of the well (about 2 weeks or so), the cells were digested with trypsin and collected, 2/3 of the cells were seeded into a 6-well plate containing complete medium, and the remaining 1/3 of the cells were collected in a 1.5mL centrifuge tube;

3) When 6-well plate cells were grown to 50% confluency, the cells were digested with 0.25% (Gibco) trypsin and harvested, and the cells were cryopreserved using cell cryopreserving (90% complete medium +10% dmso by volume).

(3) PCR detection is carried out after monoclonal cell culture, and sequencing is carried out to determine the mutation type

1) PCR detection

Cells in a 1.5mL centrifuge tube were collected and subjected to monoclonal PCR detection according to the method described above (1.3 gRNA vector and Cas9 vector optimal molar ratio screening- (3) PCR detection of MSTN gene deletion mutation efficiency). The detection results are shown in FIG. 28. FIG. 28 shows the results of HBA PCR (primer HBA-F848/HBA-R1348) detection of HBA mutant monoclonals, and it was found from the results that 9, 11, 13, and 16 were homozygous deletion mutant monoclonals, 2,4,5,6, 12, 15, and 17 were heterozygous deletion mutant monoclonals, and 1,3,7,8 and 10 did not undergo large fragment deletion.

2) Sequencing further confirmed each monoclonal mutation type

Sequencing the PCR products by using PCR primers through gel recovery (multiple bands need to be recovered), analyzing sequencing results and further determining the mutation condition of each monoclonal HBA gene.

Sequencing results are divided into three types, for example, as shown in fig. 29, a double set of peaks and a multiple set of peaks (as the sequencing of the HBA monoclonal PCR product has no multiple set of peaks, an example of the sequencing result of HBB-36 monoclonal is used), the non-set peaks can be directly compared with the genome sequence corresponding to HBA through the sequencing result to determine the mutation condition (wild type or homozygous mutation), the double set of peaks are front non-set peaks and back 2 set of peaks, two sequences contained in the set of peaks are determined by comparing the wild type sequence or the sequence after theoretical deletion, the multiple set of peaks are front non-set of peaks and back set of peaks are disordered, the clone can be judged to have more than 2 mutations, and the clone is judged to be a non-monoclonal cell.

For example, fig. 30 shows the comparison result between the forward sequencing result (1,3,5,6,8, 10, 13, 15, 16, 17) of the single clone HBA without set peaks and the HBA wild-type sequence, white blank spaces represent deletion mutations, insert lines represent insertion mutations, it can be seen from the result that 5,6, 13, 15, 16 has large fragment deletion, 8, 17 has small fragment insertion or deletion mutation at two targets, 1,3, 10 has no deletion or insertion as wild-type.

The sequence of the double peak sequence needs to be speculated by combining a gel picture with a wild type sequence, a theoretical deletion sequence and the like. Taking HBA-2 monoclonal as an example, the comparison of the HBA-2 clone HBA-F848 sequencing result with the WT HBA-F848 sequencing result and the sequence analysis chart are shown in FIG. 31, the wild type and the theoretical deletion sequence are compared, the theoretical deletion-116 bp sequence exists in the double peak of the HBA-2 clone, and after the theoretical deletion sequence is eliminated, the other sequence of the double peak is judged to be-7 bp (consistent with the judgment of heterozygosis deletion mutation of HBA-2 in the glue chart, and the-7 bp is close to the WT sequence in size).

The sequencing result of the random nested peaks is that no nested peaks exist in the front and a plurality of random nested peaks appear in the back, and the PCR sequencing result of the HBB-36 clone in FIG. 29 contains more than 2 mutations and is judged to be polyclonal.

All sequencing results were subjected to mutation analysis according to such methods.

The genotype of each clone was shown in table 13 by analysis of specific sequences:

watch 13

From the above analysis results, HBA gene mutant cell lines were successfully constructed. In HBA gene editing cell monoclonals 1-17, homozygous mutant cell clones comprise: 2,4,5,6,7,8,9, 11, 13, 15, 16, 17; wild type cells were cloned with: 1,3, 10; heterozygosity mutation cloning: none; and (3) multiple cloning: none.

Knock-out of HBB Gene

3.1HBB Gene knockout target gRNA design and construction

(1) Extraction of genomic DNA from porcine ear tissue

The method is shown in 2.1HBA gene knockout target gRNA design and construction.

(2) HBB gene knockout preset target exon and adjacent genome sequence conservation analysis

1) Searching pig HBB gene information as follows:

HBB hemoglobin,beta[Sus scrofa(pig)]Gene ID:407066

Location:9；9p2.4 Exon count:3

the transcriptional map of the HBB gene is shown in FIG. 32 (the dark wide line in the map is coding exon, the light wide line is non-coding exon), and the transcriptional map comprises 3 exons and the No. 2 exon 223bp, and the target point is designed in the No. 2 exon of the HBB gene in the scheme of the embodiment.

2) HBB gene knockout preset target exon and adjacent genome sequence PCR amplification primer design

According to the found HBB genome sequence of the pig

(https:// www.ncbi.nlm.nih.gov/nuccore/NC _010451.4report = genbank &from =4800683&to =4801941&st rand = true) primers were designed to amplify the HBB gene exon 2 and flanking sequences of 8 pig genome samples.

HBB-GT-F517 taaaaggaagagcagagccagca(SEQ ID NO：90)

HBB-GT-F540 gccacctacatttgcttctgaca(SEQ ID NO：91)

HBB-GT-R1243 aacagaggagaacaagagagagt(SEQ ID NO：92)

HBB-GT-R1306 acttaaaagagagaagacatcgca(SEQ ID NO：93)

3) HBB genome PCR amplification primer screening

The genome extracted from ear tissue of pig (female 2) was used as a template, PCR was carried out using the designed two upstream and two downstream combinations, max enzyme (Vazyme: P505), and the PCR was electrophoresed to select a good amplification primer. The electrophoresis result is shown in FIG. 33, and the 59 th primer is HBB-GT-F517/HBB-GT-R1243 amplification band; 60 is HBB-GT-F517/HBB-GT-R1306 primer amplification band; 61 is HBB-GT-F540/HBB-GT-R1243 primer amplification band; 62 is HBB-GT-F540/HBB-GT-R1306 primer amplification band, and 61 is selected as HBB-GT-F540/HBB-GT-R1243 as amplification primer.

4) PCR amplification of HBB genome fragment of 8 pig genome templates

The results of amplification of HBB genomic fragments with 8 genomic templates (male A B C D female 12 3), primers HBB-GT-F540/HBB-GT-R1243, max enzyme, respectively, are shown in FIG. 34.

5) HBB gene sequence conservation analysis

The PCR amplification products were subjected to sequencing using amplification primers (sequencing by Universal Bio Inc.). The sequencing result is analyzed by comparing the Snapgene with the HBB gene sequence published on the Internet, the result is shown in figure 35, white vertical lines represent mutation or deletion mutation, black vertical lines represent insertion mutation, and the design of target points and detection primers need to be avoided on the mutation sequence.

(1) Targeted gRNA design using synthego

Designing target to avoid possible mutation sites, and designing target gRNA by using synthgo

https://www.synthego.com/products/bioinformatics/crispr-design-tool

HBB gene knockout targets are designed as follows:

HBB-sgRNA1：GAGGTTCTTCGAGTCCTTTG(SEQ ID NO：94)

HBB-sgRNA2：GGCATTGGACAGGTCCCCAA(SEQ ID NO：95)

HBB-sgRNA3：TCAGGCCGTCACTGAAGGAC(SEQ ID NO：96)

HBB-sgRNA4：GCTTAGCAAAGGTGCCCTTG(SEQ ID NO：97)

the target combinations and resulting theoretical deletions are shown in table 14.

TABLE 14 target combinations and resulting theoretical deletions

5 terminal target sequence	Direction	Number of	3 terminal target sequence	Direction	Numbering	Deletion length bp
							GAGGTTCTTCGAGTCCTTTG	+	1	TCAGGCCGTCACTGAAGGAC	-	3	76
GAGGTTCTTCGAGTCCTTTG	+	1	GCTTAGCAAAGGTGCCCTTG	-	4	112
							GGCATTGGACAGGTCCCCAA	-	2	TCAGGCCGTCACTGAAGGAC	-	3	73
GGCATTGGACAGGTCCCCAA	-	2	GCTTAGCAAAGGTGCCCTTG	-	4	109

Based on the alignment results, possible mutation sites were avoided, and primers for mutation detection at the later stage were designed, see table 15.

TABLE 15HBB detection primers

HBB-F695	gtatccagggcttcaggagagg(SEQ ID NO：98)
		HBB-R1085	gagctcagccatgaccaaggag(SEQ ID NO：99)

Synthetic HBB insert complementary DNA oligos for 4 targets are shown in table 16:

complementary DNA oligo for insertion sequence of 4 targets of HBB in Table 16

HBB-1S	caccGAGGTTCTTCGAGTCCTTTG(SEQ ID NO：100)
		HBB-1A	aaacCAAAGGACTCGAAGAACCTC(SEQ ID NO：101)
HBB-2S	caccGGCATTGGACAGGTCCCCAA(SEQ ID NO：102)
		HBB-2A	aaacTTGGGGACCTGTCCAATGCC(SEQ ID NO：103)
HBB-3S	caccgTCAGGCCGTCACTGAAGGAC(SEQ ID NO：104)
		HBB-3A	aaacGTCCTTCAGTGACGGCCTGAc(SEQ ID NO：105)
HBB-4S	caccGCTTAGCAAAGGTGCCCTTG(SEQ ID NO：106)
		HBB-4A	aaacCAAGGGCACCTTTGCTAAGC(SEQ ID NO：107)

Each target synthesized 2 pairs of complementary DNA oligos, which upon annealing formed a DNA duplex complementary to the cleaved sticky ends of pKG-U6gRNA vector BbsI (FIG. 18).

The double-stranded insertion sequence obtained by annealing the synthetic HBB gene target complementary DNA oligo is shown in FIGS. 36 to 39:

the HBB-gRNA1 insertion sequence is shown in figure 36; the HBB-gRNA2 insertion sequence is shown in figure 37; the HBB-gRNA3 insertion sequence is shown in figure 38; the HBB-gRNA4 insertion sequence is shown in FIG. 39.

HBB gRNA vector construction was performed with reference to the gRNA vector construction procedure described above (1.2 construction of MSTN and FNDC5 gene gRNA target vectors to examine the efficiency of the modified cas9 vector).

The correct clones were designated pKG-U6gRNA (HBB-1), pKG-U6gRNA (HBB-2), pKG-U6gRNA (HBB-3), pKG-U6gRNA (HBB-4), plasmid miniextract, and stored at-20 ℃ for use.

3.2 different target gRNA vector combinations and Cas9 vectors electrotransfer porcine ear primary fibroblasts

Porcine primary fibroblasts were co-transfected with the 4 gRNA vectors pKG-U6gRNA (HBB) constructed and Cas9 expression vector pKG-GE 3. Electrotransformation experiments were carried out using a mammalian fibroblast cell nuclear transfection kit (Neon kit, thermofeisher) with a Neon TM transfection system electrotransfer instrument.

Group 1: pKG-U6gRNA (HBB-1) + pKG-U6gRNA (HBB-3) + pKG-GE3 theoretical HBB deletion 76bp

Group 2: pKG-U6gRNA (HBB-1) + pKG-U6gRNA (HBB-4) + pKG-GE3 theoretical HBB deletion 112bp

Group 3: pKG-U6gRNA (HBB-2) + pKG-U6gRNA (HBB-3) + pKG-GE3 theoretical HBB deletion 73bp

Group 4: pKG-U6gRNA (HBB-2) + pKG-U6gRNA (HBB-4) + pKG-GE3 theoretical HBB deletion 109bp

Comparison: non-electroporated WT cells

An electrotransformation reaction solution is prepared according to a molar ratio of gRNA1: gRNA2: cas9=1.5, and the system is as follows:

the porcine primary cells were electroporated and cell harvested according to the electroporation method mentioned above (optimal molar ratio screening of 1.3gRNA vector and Cas9 vector).

3.3 PCR detection of the cells after electroporation to determine highly efficient editing target combinations

Cell lysis, PCR detection (detection primer: HBB-F695/HBB-R1085) and electrophoretic analysis were performed according to the procedure described above (1.3 gRNA vector and Cas9 vector optimal molar ratio screening- (3) PCR detection of MSTN gene deletion mutation efficiency), and the results were as follows.

The PCR detection result of HBB combined gRNA mutation efficiency is shown in figure 40.HBB-1,3 is group 1 (gRNA 1,3); HBB-1,4 is group 2 (gRNA 1,4); HBB-2,3 is group 3 (gRNA 2,3); HBB-2,4 is group 4 (gRNA 2,4); control was non-electroporated WT cells. The larger band is the wild-type band, the smaller band is the band after deletion mutation, and the brighter the smaller band (mutated band) is relative to the larger band (wild-type band), the higher the mutation efficiency. According to the experimental result, the theoretical HBB has the highest mutation efficiency of deleting 73bp from the group 3pKG-U6gRNA (HBB-2) + pKG-U6gRNA (HBB-3) + pKG-GE3 in HBB.

3.4 preparation of pig ear Primary fibroblast HBB Gene editing monoclonal cells

HBB mutation: pKG-U6gRNA (HBB-2) (0.46 ug) + pKG-U6gRNA (HBB-3) (0.46 ug) + pKG-GE3 (1.08 ug). The mol ratio of each component is as follows: pKG-U6gRNA (HBB-2): pKG-U6gRNA (HBB-3): pKG-GE3=1.5:1.5:1.

(2) Isolating single clone, amplifying culture

The steps of the method are shown in the step 2.4, and HBA gene editing monoclonal cells of the pig ear primary fibroblasts are prepared.

1) PCR detection

Cells in a 1.5mL centrifuge tube were collected, and monoclonal cell lysis, PCR detection and electrophoretic analysis were performed according to the methods described above (1.3 gRNA vector and Cas9 vector optimal molar ratio screening- (3) PCR detection of MSTN gene deletion mutation efficiency). The results of HBB PCR (primers HBB-F695/HBB-R1085) detection of HBB mutant monoclonal are shown in FIG. 41, and it is determined from the results that 18, 20, 21, 22, 23, 24, 25, 29, 30, 31, 33, 34, 37, 40, 42, 43, 44, 45 are homozygous large-fragment deletion mutant monoclonal, 39,46 are heterozygous large-fragment deletion mutant monoclonal, and 19, 26, 27, 28, 32, 36, 38, 41 have no large-fragment deletion.

2) Sequencing further confirmed each monoclonal mutation type

Sequencing the PCR products by using PCR primers through gel recovery (multiple bands need to be recovered), analyzing sequencing results and further determining the mutation condition of each monoclonal HBB gene.

The sequencing result analysis method of the HBA monoclonal PCR product is referred to for analyzing the sequencing result of the HBB monoclonal PCR product. FIG. 42 is a graph of the alignment of the sequencing results of the tandem monoclonal HBB without nested peaks with published HBB sequences.

The genotype of each clone was shown in table 17 by analysis of specific sequences:

TABLE 17

From the above analysis results, HBB gene mutant cell lines were successfully constructed. In HBB gene editing cell monoclonals 18-46, homozygous mutant cell clones have the following characteristics: 18 19, 20, 21, 22, 23, 24, 25, 29, 30, 31, 32, 33, 34, 37, 39, 40, 42, 43, 44, 45, 46; wild type cells were cloned with: 26 27, 28, 38, 41; heterozygous mutant cloning: none; and (3) polyclonal cloning: 36.

4. preparation of HBA and HBB Gene knockout-combined monoclonal cell

(1) Porcine ear primary fibroblast cell electrotransferred by HBA and HBB high-efficiency target gRNA combination and Cas9 vector

And (3) performing cell electrotransfer on the gRNA combination and the Cas9 vector by using the optimum HBA and HBB target gRNA combination screened by the experiment according to the method for electrotransfering the primary fibroblast of the pig ear (see the screening of the optimum molar ratio of the 1.3gRNA vector and the Cas9 vector), and performing electrotransfer by using a No. 2 cell (female, blood group AO):

HBA + HBB mutation: pKG-U6gRNA (HBA-1) (0.23 ug) + pKG-U6gRNA (HBA-4) (0.23 ug) + pKG-U6gRNA (HBB-2) (0.23 ug) + pKG-U6gRNA (HBB-3) (0.23 ug) + pKG-GE3 (1.08 ug) the molar ratio of the above components is: pKG-U6gRNA (HBA-1): pKG-U6gRNA (HBA-4): pKG-U6gRNA (HBB-2): pKG-U6gRNA (HBB-3): pKG-GE3= 0.75.

(2) Isolating single clone, amplifying culture

The steps of the method are referred to the preparation of HBA gene editing monoclonal cells of pig ear primary fibroblasts 2.4.

(3) PCR detection is carried out after monoclonal cell culture, and sequencing is carried out to determine mutation types

1) PCR detection

Cells in a 1.5mL centrifuge tube were collected, and monoclonal cell lysis, PCR detection and electrophoretic analysis were performed according to the methods described above (1.3 gRNA vector and Cas9 vector optimal molar ratio screening- (3) PCR detection of MSTN gene deletion mutation efficiency). The PCR detection result of HBA (primer HBA-F848/HBA-R1348) of HBA + HBB mutant monoclonal is shown in FIG. 43, and the PCR detection result of HBB (primer HBB-F695/HBB-R1085) of HBA + HBB mutant monoclonal is shown in FIG. 44.

The HBA mutation condition is judged from the PCR detection results of HBA (primer HBA-F848/HBA-R1348) and HBB (primer HBB-F695/HBB-R1085) of HBA + HBB mutant monoclonal 47-76: 47 50, 53, 66, 67, 68, 69, 73, 75 and 76 have large fragment deletion homozygous mutation; 48 49, 51, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 70, 71, 72, 74 have no large-fragment deletion mutation (being wild-type or small-fragment insertion deletion mutation); 52,66 was mutated by large fragment deletion shuffling. HBB mutational status: 47 50, 52, 53, 57, 58, 61, 62, 64, 66, 67, 69, 72, 73, 75, 76 have undergone large fragment deletion homozygous mutations; 48 51, 54, 55, 56, 59, 60, 63, 65, 70, 71, 74 have no large-fragment deletion mutation (being wild-type or small-fragment insertion deletion mutation); 68, a large fragment deletion heterozygous mutation occurs.

2) Sequencing further confirmed each monoclonal mutation type

Sequencing the PCR products by using PCR primers through gel recovery (multiple bands need to be recovered), analyzing sequencing results and further determining the mutation conditions of each monoclonal HBA and HBB gene.

The sequencing result analysis method of HBA + HBB monoclonal PCR product is referred to for analyzing the sequencing result of HBA + HBB monoclonal PCR product. FIG. 45 is a graph showing the alignment of the forward sequencing nested peaks of HBA + HBB monoclonal HBA with published HBA sequences. FIG. 46 is a graph showing the alignment of the positive and negative sequencing results of HBA + HBB monoclonal HBB without nested peaks with published HBB sequences.

The genotype of each clone was shown in table 18 by analysis of specific sequences:

TABLE 18 analysis of Simultaneous mutational monoclonal sequencing results for HBA and HBB

From the above analysis results, HBA + HBB gene mutant cell lines were successfully constructed. In HBA + HBB gene editing cell monoclone 47-76, the double-gene homozygous mutant cell clone has the following components: 47 50, 53, 61, 65, 66, 68, 69, 70, 73, 75, 76; wild type cells were cloned with: 51 54, 55, 59, 60, 63, 71; single gene heterozygous or homozygous mutant clones: 48 56, 74; and (3) multiple cloning: 56, 67.

Sequence listing

<110> Nanjing King Gene engineering Co., ltd

<120> CRISPR/Cas9 system and application thereof in construction of alpha, beta and alpha & beta thalassemia model pig cell line

<160> 107

<170> SIPOSequenceListing 1.0

<210> 1

<211> 175

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 1

tgtggaaagg acgaaacacc gggtcttcga gaagacctgt tttagagcta gaaatagcaa 60

gttaaaataa ggctagtccg ttatcaactt gaaaaagtgg caccgagtcg gtgctttttt 120

ctagcgcgtg cgccaattct gcagacaaat ggctctagag gtacccgtta cataa 175

<210> 2

<211> 20

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 2

tgtggaaagg acgaaacacc 20

<210> 3

<211> 59

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 3

tgctatttct agctctaaaa caggtcttct cgaagacccg gtgtttcgtc ctttccaca 59

<210> 4

<211> 59

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 4

cctgttttag agctagaaat agcaagttaa aataaggcta gtccgttatc aacttgaaa 59

<210> 5

<211> 59

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 5

cacgcgctag aaaaaagcac cgactcggtg ccactttttc aagttgataa cggactagc 59

<210> 6

<211> 59

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 6

gtgctttttt ctagcgcgtg cgccaattct gcagacaaat ggctctagag gtacccgtt 59

<210> 7

<211> 25

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 7

ttatgtaacg ggtacctcta gagcc 25

<210> 8

<211> 554

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 8

tctgcagaca aatggctcta gaggtacccg ttacataact tacggtaaat ggcccgcctg 60

gctgaccgcc caacgacccc cgcccattga cgtcaatagt aacgccaata gggactttcc 120

attgacgtca atgggtggag tatttacggt aaactgccca cttggcagta catcaagtgt 180

atcatatgcc aagtacgccc cctattgacg tcaatgacgg taaatggccc gcctggcatt 240

gtgcccagta catgacctta tgggactttc ctacttggca gtacatctac gtattagtca 300

tcgctattac catgggggca gagcgcacat cgcccacagt ccccgagaag ttggggggag 360

gggtcggcaa ttgatccggt gcctagagaa ggtggcgcgg ggtaaactgg gaaagtgatg 420

tcgtgtactg gctccgcctt tttcccgagg gtgggggaga accgtatata agtgcagtag 480

tcgccgtgaa cgttcttttt cgcaacgggt ttgccgccag aacacaggtt ggaccggtgc 540

caccatggac tata 554

<210> 9

<211> 30

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 9

tctgcagaca aatggctcta gaggtacccg 30

<210> 10

<211> 59

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 10

ggcggtcagc caggcgggcc atttaccgta agttatgtaa cgggtacctc tagagccat 59

<210> 11

<211> 59

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 11

gcctggctga ccgcccaacg acccccgccc attgacgtca atagtaacgc caataggga 59

<210> 12

<211> 59

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 12

taccgtaaat actccaccca ttgacgtcaa tggaaagtcc ctattggcgt tactattga 59

<210> 13

<211> 59

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 13

aatgggtgga gtatttacgg taaactgccc acttggcagt acatcaagtg tatcatatg 59

<210> 14

<211> 59

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 14

taccgtcatt gacgtcaata gggggcgtac ttggcatatg atacacttga tgtactgcc 59

<210> 15

<211> 59

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 15

cctattgacg tcaatgacgg taaatggccc gcctggcatt gtgcccagta catgacctt 59

<210> 16

<211> 59

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 16

gactaatacg tagatgtact gccaagtagg aaagtcccat aaggtcatgt actgggcac 59

<210> 17

<211> 59

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 17

tggcagtaca tctacgtatt agtcatcgct attaccatgg gggcagagcg cacatcgcc 59

<210> 18

<211> 59

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 18

ggatcaattg ccgacccctc cccccaactt ctcggggact gtgggcgatg tgcgctctg 59

<210> 19

<211> 59

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 19

ggggtcggca attgatccgg tgcctagaga aggtggcgcg gggtaaactg ggaaagtga 59

<210> 20

<211> 59

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 20

cccccaccct cgggaaaaag gcggagccag tacacgacat cactttccca gtttacccc 59

<210> 21

<211> 59

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 21

tcccgagggt gggggagaac cgtatataag tgcagtagtc gccgtgaacg ttctttttc 59

<210> 22

<211> 25

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 22

gttgcgaaaa agaacgttca cggcg 25

<210> 23

<211> 447

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 23

ccagaacaca ggttggaccg gtgccaccat ggactataag gaccacgacg gagactacaa 60

ggatcatgat attgattaca aagacgatga cgataagatg gcccccaaaa agaaacgaaa 120

ggtgggtggg tccccaaaga agaagcggaa ggtcggtatc cacggagtcc cagcagccga 180

caagaagtac agcatcggcc tggacatcgg caccaactct gtgggctggg ccgtgatcac 240

cgacgagtac aaggtgccca gcaagaaatt caaggtgctg ggcaacaccg accggcacag 300

catcaagaag aacctgatcg gagccctgct gttcgacagc ggcgaaacag ccgaggccac 360

ccggctgaag agaaccgcca gaagaagata caccagacgg aagaaccgga tctgctatct 420

gcaagagatc ttcagcaacg agatggc 447

<210> 24

<211> 24

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 24

ccagaacaca ggttggaccg gtgc 24

<210> 25

<211> 59

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 25

gatccttgta gtctccgtcg tggtccttat agtccatggt ggcaccggtc caacctgtg 59

<210> 26

<211> 59

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 26

cgacggagac tacaaggatc atgatattga ttacaaagac gatgacgata agatggccc 59

<210> 27

<211> 59

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 27

tcttctttgg ggacccaccc acctttcgtt tctttttggg ggccatctta tcgtcatcg 59

<210> 28

<211> 59

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 28

ggtgggtccc caaagaagaa gcggaaggtc ggtatccacg gagtcccagc agccgacaa 59

<210> 29

<211> 59

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 29

cccacagagt tggtgccgat gtccaggccg atgctgtact tcttgtcggc tgctgggac 59

<210> 30

<211> 59

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 30

cggcaccaac tctgtgggct gggccgtgat caccgacgag tacaaggtgc ccagcaaga 59

<210> 31

<211> 59

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 31

cttgatgctg tgccggtcgg tgttgcccag caccttgaat ttcttgctgg gcaccttgt 59

<210> 32

<211> 59

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 32

gaccggcaca gcatcaagaa gaacctgatc ggagccctgc tgttcgacag cggcgaaac 59

<210> 33

<211> 59

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 33

tatcttcttc tggcggttct cttcagccgg gtggcctcgg ctgtttcgcc gctgtcgaa 59

<210> 34

<211> 59

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 34

gagaaccgcc agaagaagat acaccagacg gaagaaccgg atctgctatc tgcaagaga 59

<210> 35

<211> 40

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 35

gccatctcgt tgctgaagat ctcttgcaga tagcagatcc 40

<210> 36

<211> 2727

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 36

cggcggccac gaaaaaggcc ggccaggcaa aaaagaaaaa gggcggctcc aagcggcctg 60

ccgcgacgaa gaaagcggga caggccaaga aaaagaaagg atccggcgca acaaacttct 120

ctctgctgaa acaagccgga gatgtcgaag agaatcctgg accggtgagc aagggcgagg 180

agctgttcac cggggtggtg cccatcctgg tcgagctgga cggcgacgta aacggccaca 240

agttcagcgt gtccggcgag ggcgagggcg atgccaccta cggcaagctg accctgaagt 300

tcatctgcac caccggcaag ctgcccgtgc cctggcccac cctcgtgacc accctgacct 360

acggcgtgca gtgcttcagc cgctaccccg accacatgaa gcagcacgac ttcttcaagt 420

ccgccatgcc cgaaggctac gtccaggagc gcaccatctt cttcaaggac gacggcaact 480

acaagacccg cgccgaggtg aagttcgagg gcgacaccct ggtgaaccgc atcgagctga 540

agggcatcga cttcaaggag gacggcaaca tcctggggca caagctggag tacaactaca 600

acagccacaa cgtctatatc atggccgaca agcagaagaa cggcatcaag gtgaacttca 660

agatccgcca caacatcgag gacggcagcg tgcagctcgc cgaccactac cagcagaaca 720

cccccatcgg cgacggcccc gtgctgctgc ccgacaacca ctacctgagc acccagtccg 780

ccctgagcaa agaccccaac gagaagcgcg atcacatggt cctgctggag ttcgtgaccg 840

ccgccgggat cactctcggc atggacgagc tgtacaaggg ctccggcgag ggcaggggaa 900

gtcttctaac atgcggggac gtggaggaaa atcccggccc aaccgagtac aagcccacgg 960

tgcgcctcgc cacccgcgac gacgtcccca gggccgtacg caccctcgcc gccgcgttcg 1020

ccgactaccc cgccacgcgc cacaccgtcg atccggaccg ccacatcgag cgggtcaccg 1080

agctgcaaga actcttcctc acgcgcgtcg ggctcgacat cggcaaggtg tgggtcgcgg 1140

acgacggcgc cgcggtggcg gtctggacca cgccggagag cgtcgaagcg ggggcggtgt 1200

tcgccgagat cggcccgcgc atggccgagt tgagcggttc ccggctggcc gcgcagcaac 1260

agatggaagg cctcctggcg ccgcaccggc ccaaggagcc cgcgtggttc ctggccaccg 1320

tcggagtctc gcccgaccac cagggcaagg gtctgggcag cgccgtcgtg ctccccggag 1380

tggaggcggc cgagcgcgcc ggggtgcccg ccttcctgga gacctccgcg ccccgcaacc 1440

tccccttcta cgagcggctc ggcttcaccg tcaccgccga cgtcgaggtg cccgaaggac 1500

cgcgcacctg gtgcatgacc cgcaagcccg gtgcctgaac gcgttaagtc gacaatcaac 1560

ctctggatta caaaatttgt gaaagattga ctggtattct taactatgtt gctcctttta 1620

cgctatgtgg atacgctgct ttaatgcctt tgtatcatgc tattgcttcc cgtatggctt 1680

tcattttctc ctccttgtat aaatcctggt tgctgtctct ttatgaggag ttgtggcccg 1740

ttgtcaggca acgtggcgtg gtgtgcactg tgtttgctga cgcaaccccc actggttggg 1800

gcattgccac cacctgtcag ctcctttccg ggactttcgc tttccccctc cctattgcca 1860

cggcggaact catcgccgcc tgccttgccc gctgctggac aggggctcgg ctgttgggca 1920

ctgacaattc cgtggtgttg tcggggaaat catcgtcctt tccttggctg ctcgcctgtg 1980

ttgccacctg gattctgcgc gggacgtcct tctgctacgt cccttcggcc ctcaatccag 2040

cggaccttcc ttcccgcggc ctgctgccgg ctctgcggcc tcttccgcgt cttcgccttc 2100

gccctcagac gagtcggatc tccctttggg ccgcctcccc gcgtcgactt taagaccaat 2160

gacttacaag gcagctgtag atcttagcca ctttttaaaa gaaaaggggg gactggaagg 2220

gctaattcac tcccaacgaa gacaagatct gctttttgct tgtactgggt ctctctggtt 2280

agaccagatc tgagcctggg agctctctgg ctaactaggg aacccactgc ttaagcctca 2340

ataaagcttg ccttgagtgc ttcaagtagt gtgtgcccgt ctgttgtgtg actctggtaa 2400

ctagagatcc ctcagaccct tttagtcagt gtggaaaatc tctagcaggg cccgtttaaa 2460

cccgctgatc agcctcgact gtgccttcta gttgccagcc atctgttgtt tgcccctccc 2520

ccgtgccttc cttgaccctg gaaggtgcca ctcccactgt cctttcctaa taaaatgagg 2580

aaattgcatc gcattgtctg agtaggtgtc attctattct ggggggtggg gtggggcagg 2640

acagcaaggg ggaggattgg gaagacaata gcaggcatgc tggggatgcg gtgggctcta 2700

tggcctgcag gggcgcctga tgcggta 2727

<210> 37

<211> 192

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 37

cggcggccac gaaaaaggcc ggccaggcaa aaaagaaaaa gggcggctcc aagcggcctg 60

ccgcgacgaa gaaagcggga caggccaaga aaaagaaagg atccggcgca acaaacttct 120

ctctgctgaa acaagccgga gatgtcgaag agaatcctgg accggtgagc aagggcgagg 180

agctgttcac cg 192

<210> 38

<211> 35

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 38

cggcggccac gaaaaaggcc ggccaggcaa aaaag 35

<210> 39

<211> 59

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 39

aggccgcttg gagccgccct ttttcttttt tgcctggccg gcctttttcg tggccgccg 59

<210> 40

<211> 59

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 40

ggctccaagc ggcctgccgc gacgaagaaa gcgggacagg ccaagaaaaa gaaaggatc 59

<210> 41

<211> 59

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 41

tccggcttgt ttcagcagag agaagtttgt tgcgccggat cctttctttt tcttggcct 59

<210> 42

<211> 59

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 42

ctgctgaaac aagccggaga tgtcgaagag aatcctggac cggtgagcaa gggcgagga 59

<210> 43

<211> 28

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 43

cggtgaacag ctcctcgccc ttgctcac 28

<210> 44

<211> 29

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 44

gtgagcaagg gcgaggagct gttcaccgg 29

<210> 45

<211> 58

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 45

tagaagactt cccctgccct cgccggagcc cttgtacagc tcgtccatgc cgagagtg 58

<210> 46

<211> 54

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 46

gagggcaggg gaagtcttct aacatgcggg gacgtggagg aaaatcccgg ccca 54

<210> 47

<211> 58

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 47

tgcggggacg tggaggaaaa tcccggccca accgagtaca agcccacggt gcgcctcg 58

<210> 48

<211> 56

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 48

taccgcatca ggcgcccctg caggccatag agcccaccgc atccccagca tgcctg 56

<210> 49

<211> 22

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 49

ccaccagagc atcaccggcc tg 22

<210> 50

<211> 22

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 50

cacacccgcc gcgcttaatg cg 22

<210> 51

<211> 20

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 51

gctgattgtt gctggtcccg 20

<210> 52

<211> 20

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 52

tttccaggcg aagtttactg 20

<210> 53

<211> 20

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 53

tgtactcagt gtcctcctcc 20

<210> 54

<211> 20

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 54

gctcttcaag acgcctcgcg 20

<210> 55

<211> 23

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 55

tctctcagac agtgcaggca tta 23

<210> 56

<211> 23

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 56

cgtttccgtc gtagcgtgat aat 23

<210> 57

<211> 23

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 57

cagttctcac ttgatggcct tgg 23

<210> 58

<211> 20

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 58

aggggtctgg ggaggaatgg 20

<210> 59

<211> 24

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 59

caccgctgat tgttgctggt cccg 24

<210> 60

<211> 24

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 60

aaaccgggac cagcaacaat cagc 24

<210> 61

<211> 25

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 61

caccgtttcc aggcgaagtt tactg 25

<210> 62

<211> 25

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 62

aaaccagtaa acttcgcctg gaaac 25

<210> 63

<211> 25

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 63

caccgtgtac tcagtgtcct cctcc 25

<210> 64

<211> 25

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 64

aaacggagga ggacactgag tacac 25

<210> 65

<211> 24

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 65

caccgctctt caagacgcct cgcg 24

<210> 66

<211> 24

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 66

aaaccgcgag gcgtcttgaa gagc 24

<210> 67

<211> 410

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 67

gataaacatg tgagggccta tttcccatga ttccttcata tttgcatata cgatacaagg 60

ctgttagaga gataattgga attaatttga ctgtaaacac aaagatatta gtacaaaata 120

cgtgacgtag aaagtaataa tttcttgggt agtttgcagt tttaaaatta tgttttaaaa 180

tggactatca tatgcttacc gtaacttgaa agtatttcga tttcttggct ttatatatct 240

tgtggaaagg acgaaacacc gggtcttcga gaagacctgt tttagagcta gaaatagcaa 300

gttaaaataa ggctagtccg ttatcaactt gaaaaagtgg caccgagtcg gtgctttttt 360

ctagcgcgtg cgccaattct gcagacaaat ggctctagag gtacccatag 410

<210> 68

<211> 744

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 68

gtgagcaagg gcgaggagct gttcaccggg gtggtgccca tcctggtcga gctggacggc 60

gacgtaaacg gccacaagtt cagcgtgtcc ggcgagggcg agggcgatgc cacctacggc 120

aagctgaccc tgaagttcat ctgcaccacc ggcaagctgc ccgtgccctg gcccaccctc 180

gtgaccaccc tgacctacgg cgtgcagtgc ttcagccgct accccgacca catgaagcag 240

cacgacttct tcaagtccgc catgcccgaa ggctacgtcc aggagcgcac catcttcttc 300

aaggacgacg gcaactacaa gacccgcgcc gaggtgaagt tcgagggcga caccctggtg 360

aaccgcatcg agctgaaggg catcgacttc aaggaggacg gcaacatcct ggggcacaag 420

ctggagtaca actacaacag ccacaacgtc tatatcatgg ccgacaagca gaagaacggc 480

atcaaggtga acttcaagat ccgccacaac atcgaggacg gcagcgtgca gctcgccgac 540

cactaccagc agaacacccc catcggcgac ggccccgtgc tgctgcccga caaccactac 600

ctgagcaccc agtccgccct gagcaaagac cccaacgaga agcgcgatca catggtcctg 660

ctggagttcg tgaccgccgc cgggatcact ctcggcatgg acgagctgta caagggctcc 720

ggcgagggca ggggaagtct tcta 744

<210> 69

<211> 1840

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 69

gagggcaggg gaagtcttct aacatgcggg gacgtggagg aaaatcccgg cccaaccgag 60

tacaagccca cggtgcgcct cgccacccgc gacgacgtcc ccagggccgt acgcaccctc 120

gccgccgcgt tcgccgacta ccccgccacg cgccacaccg tcgatccgga ccgccacatc 180

gagcgggtca ccgagctgca agaactcttc ctcacgcgcg tcgggctcga catcggcaag 240

gtgtgggtcg cggacgacgg cgccgcggtg gcggtctgga ccacgccgga gagcgtcgaa 300

gcgggggcgg tgttcgccga gatcggcccg cgcatggccg agttgagcgg ttcccggctg 360

gccgcgcagc aacagatgga aggcctcctg gcgccgcacc ggcccaagga gcccgcgtgg 420

ttcctggcca ccgtcggagt ctcgcccgac caccagggca agggtctggg cagcgccgtc 480

gtgctccccg gagtggaggc ggccgagcgc gccggggtgc ccgccttcct ggagacctcc 540

gcgccccgca acctcccctt ctacgagcgg ctcggcttca ccgtcaccgc cgacgtcgag 600

gtgcccgaag gaccgcgcac ctggtgcatg acccgcaagc ccggtgcctg aacgcgttaa 660

gtcgacaatc aacctctgga ttacaaaatt tgtgaaagat tgactggtat tcttaactat 720

gttgctcctt ttacgctatg tggatacgct gctttaatgc ctttgtatca tgctattgct 780

tcccgtatgg ctttcatttt ctcctccttg tataaatcct ggttgctgtc tctttatgag 840

gagttgtggc ccgttgtcag gcaacgtggc gtggtgtgca ctgtgtttgc tgacgcaacc 900

cccactggtt ggggcattgc caccacctgt cagctccttt ccgggacttt cgctttcccc 960

ctccctattg ccacggcgga actcatcgcc gcctgccttg cccgctgctg gacaggggct 1020

cggctgttgg gcactgacaa ttccgtggtg ttgtcgggga aatcatcgtc ctttccttgg 1080

ctgctcgcct gtgttgccac ctggattctg cgcgggacgt ccttctgcta cgtcccttcg 1140

gccctcaatc cagcggacct tccttcccgc ggcctgctgc cggctctgcg gcctcttccg 1200

cgtcttcgcc ttcgccctca gacgagtcgg atctcccttt gggccgcctc cccgcgtcga 1260

ctttaagacc aatgacttac aaggcagctg tagatcttag ccacttttta aaagaaaagg 1320

ggggactgga agggctaatt cactcccaac gaagacaaga tctgcttttt gcttgtactg 1380

ggtctctctg gttagaccag atctgagcct gggagctctc tggctaacta gggaacccac 1440

tgcttaagcc tcaataaagc ttgccttgag tgcttcaagt agtgtgtgcc cgtctgttgt 1500

gtgactctgg taactagaga tccctcagac ccttttagtc agtgtggaaa atctctagca 1560

gggcccgttt aaacccgctg atcagcctcg actgtgcctt ctagttgcca gccatctgtt 1620

gtttgcccct cccccgtgcc ttccttgacc ctggaaggtg ccactcccac tgtcctttcc 1680

taataaaatg aggaaattgc atcgcattgt ctgagtaggt gtcattctat tctggggggt 1740

ggggtggggc aggacagcaa gggggaggat tgggaagaca atagcaggca tgctggggat 1800

gcggtgggct ctatggcctg caggggcgcc tgatgcggta 1840

<210> 70

<211> 10476

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 70

gagggcctat ttcccatgat tccttcatat ttgcatatac gatacaaggc tgttagagag 60

ataattggaa ttaatttgac tgtaaacaca aagatattag tacaaaatac gtgacgtaga 120

aagtaataat ttcttgggta gtttgcagtt ttaaaattat gttttaaaat ggactatcat 180

atgcttaccg taacttgaaa gtatttcgat ttcttggctt tatatatctt gtggaaagga 240

cgaaacaccg ggtcttcgag aagacctgtt ttagagctag aaatagcaag ttaaaataag 300

gctagtccgt tatcaacttg aaaaagtggc accgagtcgg tgcttttttc tagcgcgtgc 360

gccaattctg cagacaaatg gctctagagg tacccgttac ataacttacg gtaaatggcc 420

cgcctggctg accgcccaac gacccccgcc cattgacgtc aatagtaacg ccaataggga 480

ctttccattg acgtcaatgg gtggagtatt tacggtaaac tgcccacttg gcagtacatc 540

aagtgtatca tatgccaagt acgcccccta ttgacgtcaa tgacggtaaa tggcccgcct 600

ggcattgtgc ccagtacatg accttatggg actttcctac ttggcagtac atctacgtat 660

tagtcatcgc tattaccatg ggggcagagc gcacatcgcc cacagtcccc gagaagttgg 720

ggggaggggt cggcaattga tccggtgcct agagaaggtg gcgcggggta aactgggaaa 780

gtgatgtcgt gtactggctc cgcctttttc ccgagggtgg gggagaaccg tatataagtg 840

cagtagtcgc cgtgaacgtt ctttttcgca acgggtttgc cgccagaaca caggttggac 900

cggtgccacc atggactata aggaccacga cggagactac aaggatcatg atattgatta 960

caaagacgat gacgataaga tggcccccaa aaagaaacga aaggtgggtg ggtccccaaa 1020

gaagaagcgg aaggtcggta tccacggagt cccagcagcc gacaagaagt acagcatcgg 1080

cctggacatc ggcaccaact ctgtgggctg ggccgtgatc accgacgagt acaaggtgcc 1140

cagcaagaaa ttcaaggtgc tgggcaacac cgaccggcac agcatcaaga agaacctgat 1200

cggagccctg ctgttcgaca gcggcgaaac agccgaggcc acccggctga agagaaccgc 1260

cagaagaaga tacaccagac ggaagaaccg gatctgctat ctgcaagaga tcttcagcaa 1320

cgagatggcc aaggtggacg acagcttctt ccacagactg gaagagtcct tcctggtgga 1380

agaggataag aagcacgagc ggcaccccat cttcggcaac atcgtggacg aggtggccta 1440

ccacgagaag taccccacca tctaccacct gagaaagaaa ctggtggaca gcaccgacaa 1500

ggccgacctg cggctgatct atctggccct ggcccacatg atcaagttcc ggggccactt 1560

cctgatcgag ggcgacctga accccgacaa cagcgacgtg gacaagctgt tcatccagct 1620

ggtgcagacc tacaaccagc tgttcgagga aaaccccatc aacgccagcg gcgtggacgc 1680

caaggccatc ctgtctgcca gactgagcaa gagcagacgg ctggaaaatc tgatcgccca 1740

gctgcccggc gagaagaaga atggcctgtt cggaaacctg attgccctga gcctgggcct 1800

gacccccaac ttcaagagca acttcgacct ggccgaggat gccaaactgc agctgagcaa 1860

ggacacctac gacgacgacc tggacaacct gctggcccag atcggcgacc agtacgccga 1920

cctgtttctg gccgccaaga acctgtccga cgccatcctg ctgagcgaca tcctgagagt 1980

gaacaccgag atcaccaagg cccccctgag cgcctctatg atcaagagat acgacgagca 2040

ccaccaggac ctgaccctgc tgaaagctct cgtgcggcag cagctgcctg agaagtacaa 2100

agagattttc ttcgaccaga gcaagaacgg ctacgccggc tacattgacg gcggagccag 2160

ccaggaagag ttctacaagt tcatcaagcc catcctggaa aagatggacg gcaccgagga 2220

actgctcgtg aagctgaaca gagaggacct gctgcggaag cagcggacct tcgacaacgg 2280

cagcatcccc caccagatcc acctgggaga gctgcacgcc attctgcggc ggcaggaaga 2340

tttttaccca ttcctgaagg acaaccggga aaagatcgag aagatcctga ccttccgcat 2400

cccctactac gtgggccctc tggccagggg aaacagcaga ttcgcctgga tgaccagaaa 2460

gagcgaggaa accatcaccc cctggaactt cgaggaagtg gtggacaagg gcgcttccgc 2520

ccagagcttc atcgagcgga tgaccaactt cgataagaac ctgcccaacg agaaggtgct 2580

gcccaagcac agcctgctgt acgagtactt caccgtgtat aacgagctga ccaaagtgaa 2640

atacgtgacc gagggaatga gaaagcccgc cttcctgagc ggcgagcaga aaaaggccat 2700

cgtggacctg ctgttcaaga ccaaccggaa agtgaccgtg aagcagctga aagaggacta 2760

cttcaagaaa atcgagtgct tcgactccgt ggaaatctcc ggcgtggaag atcggttcaa 2820

cgcctccctg ggcacatacc acgatctgct gaaaattatc aaggacaagg acttcctgga 2880

caatgaggaa aacgaggaca ttctggaaga tatcgtgctg accctgacac tgtttgagga 2940

cagagagatg atcgaggaac ggctgaaaac ctatgcccac ctgttcgacg acaaagtgat 3000

gaagcagctg aagcggcgga gatacaccgg ctggggcagg ctgagccgga agctgatcaa 3060

cggcatccgg gacaagcagt ccggcaagac aatcctggat ttcctgaagt ccgacggctt 3120

cgccaacaga aacttcatgc agctgatcca cgacgacagc ctgaccttta aagaggacat 3180

ccagaaagcc caggtgtccg gccagggcga tagcctgcac gagcacattg ccaatctggc 3240

cggcagcccc gccattaaga agggcatcct gcagacagtg aaggtggtgg acgagctcgt 3300

gaaagtgatg ggccggcaca agcccgagaa catcgtgatc gaaatggcca gagagaacca 3360

gaccacccag aagggacaga agaacagccg cgagagaatg aagcggatcg aagagggcat 3420

caaagagctg ggcagccaga tcctgaaaga acaccccgtg gaaaacaccc agctgcagaa 3480

cgagaagctg tacctgtact acctgcagaa tgggcgggat atgtacgtgg accaggaact 3540

ggacatcaac cggctgtccg actacgatgt ggaccatatc gtgcctcaga gctttctgaa 3600

ggacgactcc atcgacaaca aggtgctgac cagaagcgac aagaaccggg gcaagagcga 3660

caacgtgccc tccgaagagg tcgtgaagaa gatgaagaac tactggcggc agctgctgaa 3720

cgccaagctg attacccaga gaaagttcga caatctgacc aaggccgaga gaggcggcct 3780

gagcgaactg gataaggccg gcttcatcaa gagacagctg gtggaaaccc ggcagatcac 3840

aaagcacgtg gcacagatcc tggactcccg gatgaacact aagtacgacg agaatgacaa 3900

gctgatccgg gaagtgaaag tgatcaccct gaagtccaag ctggtgtccg atttccggaa 3960

ggatttccag ttttacaaag tgcgcgagat caacaactac caccacgccc acgacgccta 4020

cctgaacgcc gtcgtgggaa ccgccctgat caaaaagtac cctaagctgg aaagcgagtt 4080

cgtgtacggc gactacaagg tgtacgacgt gcggaagatg atcgccaaga gcgagcagga 4140

aatcggcaag gctaccgcca agtacttctt ctacagcaac atcatgaact ttttcaagac 4200

cgagattacc ctggccaacg gcgagatccg gaagcggcct ctgatcgaga caaacggcga 4260

aaccggggag atcgtgtggg ataagggccg ggattttgcc accgtgcgga aagtgctgag 4320

catgccccaa gtgaatatcg tgaaaaagac cgaggtgcag acaggcggct tcagcaaaga 4380

gtctatcctg cccaagagga acagcgataa gctgatcgcc agaaagaagg actgggaccc 4440

taagaagtac ggcggcttcg acagccccac cgtggcctat tctgtgctgg tggtggccaa 4500

agtggaaaag ggcaagtcca agaaactgaa gagtgtgaaa gagctgctgg ggatcaccat 4560

catggaaaga agcagcttcg agaagaatcc catcgacttt ctggaagcca agggctacaa 4620

agaagtgaaa aaggacctga tcatcaagct gcctaagtac tccctgttcg agctggaaaa 4680

cggccggaag agaatgctgg cctctgccgg cgaactgcag aagggaaacg aactggccct 4740

gccctccaaa tatgtgaact tcctgtacct ggccagccac tatgagaagc tgaagggctc 4800

ccccgaggat aatgagcaga aacagctgtt tgtggaacag cacaagcact acctggacga 4860

gatcatcgag cagatcagcg agttctccaa gagagtgatc ctggccgacg ctaatctgga 4920

caaagtgctg tccgcctaca acaagcaccg ggataagccc atcagagagc aggccgagaa 4980

tatcatccac ctgtttaccc tgaccaatct gggagcccct gccgccttca agtactttga 5040

caccaccatc gaccggaaga ggtacaccag caccaaagag gtgctggacg ccaccctgat 5100

ccaccagagc atcaccggcc tgtacgagac acggatcgac ctgtctcagc tgggaggcga 5160

caaaaggccg gcggccacga aaaaggccgg ccaggcaaaa aagaaaaagg gcggctccaa 5220

gcggcctgcc gcgacgaaga aagcgggaca ggccaagaaa aagaaaggat ccggcgcaac 5280

aaacttctct ctgctgaaac aagccggaga tgtcgaagag aatcctggac cggtgagcaa 5340

gggcgaggag ctgttcaccg gggtggtgcc catcctggtc gagctggacg gcgacgtaaa 5400

cggccacaag ttcagcgtgt ccggcgaggg cgagggcgat gccacctacg gcaagctgac 5460

cctgaagttc atctgcacca ccggcaagct gcccgtgccc tggcccaccc tcgtgaccac 5520

cctgacctac ggcgtgcagt gcttcagccg ctaccccgac cacatgaagc agcacgactt 5580

cttcaagtcc gccatgcccg aaggctacgt ccaggagcgc accatcttct tcaaggacga 5640

cggcaactac aagacccgcg ccgaggtgaa gttcgagggc gacaccctgg tgaaccgcat 5700

cgagctgaag ggcatcgact tcaaggagga cggcaacatc ctggggcaca agctggagta 5760

caactacaac agccacaacg tctatatcat ggccgacaag cagaagaacg gcatcaaggt 5820

gaacttcaag atccgccaca acatcgagga cggcagcgtg cagctcgccg accactacca 5880

gcagaacacc cccatcggcg acggccccgt gctgctgccc gacaaccact acctgagcac 5940

ccagtccgcc ctgagcaaag accccaacga gaagcgcgat cacatggtcc tgctggagtt 6000

cgtgaccgcc gccgggatca ctctcggcat ggacgagctg tacaagggct ccggcgaggg 6060

caggggaagt cttctaacat gcggggacgt ggaggaaaat cccggcccaa ccgagtacaa 6120

gcccacggtg cgcctcgcca cccgcgacga cgtccccagg gccgtacgca ccctcgccgc 6180

cgcgttcgcc gactaccccg ccacgcgcca caccgtcgat ccggaccgcc acatcgagcg 6240

ggtcaccgag ctgcaagaac tcttcctcac gcgcgtcggg ctcgacatcg gcaaggtgtg 6300

ggtcgcggac gacggcgccg cggtggcggt ctggaccacg ccggagagcg tcgaagcggg 6360

ggcggtgttc gccgagatcg gcccgcgcat ggccgagttg agcggttccc ggctggccgc 6420

gcagcaacag atggaaggcc tcctggcgcc gcaccggccc aaggagcccg cgtggttcct 6480

ggccaccgtc ggagtctcgc ccgaccacca gggcaagggt ctgggcagcg ccgtcgtgct 6540

ccccggagtg gaggcggccg agcgcgccgg ggtgcccgcc ttcctggaga cctccgcgcc 6600

ccgcaacctc cccttctacg agcggctcgg cttcaccgtc accgccgacg tcgaggtgcc 6660

cgaaggaccg cgcacctggt gcatgacccg caagcccggt gcctgaacgc gttaagtcga 6720

caatcaacct ctggattaca aaatttgtga aagattgact ggtattctta actatgttgc 6780

tccttttacg ctatgtggat acgctgcttt aatgcctttg tatcatgcta ttgcttcccg 6840

tatggctttc attttctcct ccttgtataa atcctggttg ctgtctcttt atgaggagtt 6900

gtggcccgtt gtcaggcaac gtggcgtggt gtgcactgtg tttgctgacg caacccccac 6960

tggttggggc attgccacca cctgtcagct cctttccggg actttcgctt tccccctccc 7020

tattgccacg gcggaactca tcgccgcctg ccttgcccgc tgctggacag gggctcggct 7080

gttgggcact gacaattccg tggtgttgtc ggggaaatca tcgtcctttc cttggctgct 7140

cgcctgtgtt gccacctgga ttctgcgcgg gacgtccttc tgctacgtcc cttcggccct 7200

caatccagcg gaccttcctt cccgcggcct gctgccggct ctgcggcctc ttccgcgtct 7260

tcgccttcgc cctcagacga gtcggatctc cctttgggcc gcctccccgc gtcgacttta 7320

agaccaatga cttacaaggc agctgtagat cttagccact ttttaaaaga aaagggggga 7380

ctggaagggc taattcactc ccaacgaaga caagatctgc tttttgcttg tactgggtct 7440

ctctggttag accagatctg agcctgggag ctctctggct aactagggaa cccactgctt 7500

aagcctcaat aaagcttgcc ttgagtgctt caagtagtgt gtgcccgtct gttgtgtgac 7560

tctggtaact agagatccct cagacccttt tagtcagtgt ggaaaatctc tagcagggcc 7620

cgtttaaacc cgctgatcag cctcgactgt gccttctagt tgccagccat ctgttgtttg 7680

cccctccccc gtgccttcct tgaccctgga aggtgccact cccactgtcc tttcctaata 7740

aaatgaggaa attgcatcgc attgtctgag taggtgtcat tctattctgg ggggtggggt 7800

ggggcaggac agcaaggggg aggattggga agacaatagc aggcatgctg gggatgcggt 7860

gggctctatg gcctgcaggg gcgcctgatg cggtattttc tccttacgca tctgtgcggt 7920

atttcacacc gcatacgtca aagcaaccat agtacgcgcc ctgtagcggc gcattaagcg 7980

cggcgggtgt ggtggttacg cgcagcgtga ccgctacact tgccagcgcc ctagcgcccg 8040

ctcctttcgc tttcttccct tcctttctcg ccacgttcgc cggctttccc cgtcaagctc 8100

taaatcgggg gctcccttta gggttccgat ttagtgcttt acggcacctc gaccccaaaa 8160

aacttgattt gggtgatggt tcacgtagtg ggccatcgcc ctgatagacg gtttttcgcc 8220

ctttgacgtt ggagtccacg ttctttaata gtggactctt gttccaaact ggaacaacac 8280

tcaaccctat ctcgggctat tcttttgatt tataagggat tttgccgatt tcggcctatt 8340

ggttaaaaaa tgagctgatt taacaaaaat ttaacgcgaa ttttaacaaa atattaacgt 8400

ttacaatttt atggtgcact ctcagtacaa tctgctctga tgccgcatag ttaagccagc 8460

cccgacaccc gccaacaccc gctgacgcgc cctgacgggc ttgtctgctc ccggcatccg 8520

cttacagaca agctgtgacc gtctccggga gctgcatgtg tcagaggttt tcaccgtcat 8580

caccgaaacg cgcgagacga aagggcctcg tgatacgcct atttttatag gttaatgtca 8640

tgataataat ggtttcttag acgtcaggtg gcacttttcg gggaaatgtg cgcggaaccc 8700

ctatttgttt atttttctaa atacattcaa atatgtatcc gctcatgaga caataaccct 8760

gataaatgct tcaataatat tgaaaaagga agagtatgag tattcaacat ttccgtgtcg 8820

cccttattcc cttttttgcg gcattttgcc ttcctgtttt tgctcaccca gaaacgctgg 8880

tgaaagtaaa agatgctgaa gatcagttgg gtgcacgagt gggttacatc gaactggatc 8940

tcaacagcgg taagatcctt gagagttttc gccccgaaga acgttttcca atgatgagca 9000

cttttaaagt tctgctatgt ggcgcggtat tatcccgtat tgacgccggg caagagcaac 9060

tcggtcgccg catacactat tctcagaatg acttggttga gtactcacca gtcacagaaa 9120

agcatcttac ggatggcatg acagtaagag aattatgcag tgctgccata accatgagtg 9180

ataacactgc ggccaactta cttctgacaa cgatcggagg accgaaggag ctaaccgctt 9240

ttttgcacaa catgggggat catgtaactc gccttgatcg ttgggaaccg gagctgaatg 9300

aagccatacc aaacgacgag cgtgacacca cgatgcctgt agcaatggca acaacgttgc 9360

gcaaactatt aactggcgaa ctacttactc tagcttcccg gcaacaatta atagactgga 9420

tggaggcgga taaagttgca ggaccacttc tgcgctcggc ccttccggct ggctggttta 9480

ttgctgataa atctggagcc ggtgagcgtg gaagccgcgg tatcattgca gcactggggc 9540

cagatggtaa gccctcccgt atcgtagtta tctacacgac ggggagtcag gcaactatgg 9600

atgaacgaaa tagacagatc gctgagatag gtgcctcact gattaagcat tggtaactgt 9660

cagaccaagt ttactcatat atactttaga ttgatttaaa acttcatttt taatttaaaa 9720

ggatctaggt gaagatcctt tttgataatc tcatgaccaa aatcccttaa cgtgagtttt 9780

cgttccactg agcgtcagac cccgtagaaa agatcaaagg atcttcttga gatccttttt 9840

ttctgcgcgt aatctgctgc ttgcaaacaa aaaaaccacc gctaccagcg gtggtttgtt 9900

tgccggatca agagctacca actctttttc cgaaggtaac tggcttcagc agagcgcaga 9960

taccaaatac tgtccttcta gtgtagccgt agttaggcca ccacttcaag aactctgtag 10020

caccgcctac atacctcgct ctgctaatcc tgttaccagt ggctgctgcc agtggcgata 10080

agtcgtgtct taccgggttg gactcaagac gatagttacc ggataaggcg cagcggtcgg 10140

gctgaacggg gggttcgtgc acacagccca gcttggagcg aacgacctac accgaactga 10200

gatacctaca gcgtgagcta tgagaaagcg ccacgcttcc cgaagggaga aaggcggaca 10260

ggtatccggt aagcggcagg gtcggaacag gagagcgcac gagggagctt ccagggggaa 10320

acgcctggta tctttatagt cctgtcgggt ttcgccacct ctgacttgag cgtcgatttt 10380

tgtgatgctc gtcagggggg cggagcctat ggaaaaacgc cagcaacgcg gcctttttac 10440

ggttcctggc cttttgctgg ccttttgctc acatgt 10476

<210> 71

<211> 3120

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 71

gacgaaaggg cctcgtgata cgcctatttt tataggttaa tgtcatgata ataatggttt 60

cttagacgtc aggtggcact tttcggggaa atgtgcgcgg aacccctatt tgtttatttt 120

tctaaataca ttcaaatatg tatccgctca tgagacaata accctgataa atgcttcaat 180

aatattgaaa aaggaagagt atgagtattc aacatttccg tgtcgccctt attccctttt 240

ttgcggcatt ttgccttcct gtttttgctc acccagaaac gctggtgaaa gtaaaagatg 300

ctgaagatca gttgggtgca cgagtgggtt acatcgaact ggatctcaac agcggtaaga 360

tccttgagag ttttcgcccc gaagaacgtt ttccaatgat gagcactttt aaagttctgc 420

tatgtggcgc ggtattatcc cgtattgacg ccgggcaaga gcaactcggt cgccgcatac 480

actattctca gaatgacttg gttgagtact caccagtcac agaaaagcat cttacggatg 540

gcatgacagt aagagaatta tgcagtgctg ccataaccat gagtgataac actgcggcca 600

acttacttct gacaacgatc ggaggaccga aggagctaac cgcttttttg cacaacatgg 660

gggatcatgt aactcgcctt gatcgttggg aaccggagct gaatgaagcc ataccaaacg 720

acgagcgtga caccacgatg cctgtagcaa tggcaacaac gttgcgcaaa ctattaactg 780

gcgaactact tactctagct tcccggcaac aattaataga ctggatggag gcggataaag 840

ttgcaggacc acttctgcgc tcggcccttc cggctggctg gtttattgct gataaatctg 900

gagccggtga gcgtgggtct cgcggtatca ttgcagcact ggggccagat ggtaagccct 960

cccgtatcgt agttatctac acgacgggga gtcaggcaac tatggatgaa cgaaatagac 1020

agatcgctga gataggtgcc tcactgatta agcattggta actgtcagac caagtttact 1080

catatatact ttagattgat ttaaaacttc atttttaatt taaaaggatc taggtgaaga 1140

tcctttttga taatctcatg accaaaatcc cttaacgtga gttttcgttc cactgagcgt 1200

cagaccccgt agaaaagatc aaaggatctt cttgagatcc tttttttctg cgcgtaatct 1260

gctgcttgca aacaaaaaaa ccaccgctac cagcggtggt ttgtttgccg gatcaagagc 1320

taccaactct ttttccgaag gtaactggct tcagcagagc gcagatacca aatactgttc 1380

ttctagtgta gccgtagtta ggccaccact tcaagaactc tgtagcaccg cctacatacc 1440

tcgctctgct aatcctgtta ccagtggctg ctgccagtgg cgataagtcg tgtcttaccg 1500

ggttggactc aagacgatag ttaccggata aggcgcagcg gtcgggctga acggggggtt 1560

cgtgcacaca gcccagcttg gagcgaacga cctacaccga actgagatac ctacagcgtg 1620

agctatgaga aagcgccacg cttcccgaag ggagaaaggc ggacaggtat ccggtaagcg 1680

gcagggtcgg aacaggagag cgcacgaggg agcttccagg gggaaacgcc tggtatcttt 1740

atagtcctgt cgggtttcgc cacctctgac ttgagcgtcg atttttgtga tgctcgtcag 1800

gggggcggag cctatggaaa aacgccagca acgcggcctt tttacggttc ctggcctttt 1860

gctggccttt tgctcacatg ttctttcctg cgttatcccc tgattctgtg gataaccgta 1920

ttaccgcctt tgagtgagct gataccgctc gccgcagccg aacgaccgag cgcagcgagt 1980

cagtgagcga ggaagcggaa gagcgcccaa tacgcaaacc gcctctcccc gcgcgttggc 2040

cgattcatta atgcagctgg cacgacaggt ttcccgactg gaaagcgggc agtgagcgca 2100

acgcaattaa tgtgagttag ctcactcatt aggcacccca ggctttacac tttatgcttc 2160

cggctcgtat gttgtgtgga attgtgagcg gataacaatt tcacacagga aacagctatg 2220

accatgatta cgccaagctt gcatgcaggc ctctgcagtc gacgggcccg ggatccgatg 2280

ataaacatgt gagggcctat ttcccatgat tccttcatat ttgcatatac gatacaaggc 2340

tgttagagag ataattggaa ttaatttgac tgtaaacaca aagatattag tacaaaatac 2400

gtgacgtaga aagtaataat ttcttgggta gtttgcagtt ttaaaattat gttttaaaat 2460

ggactatcat atgcttaccg taacttgaaa gtatttcgat ttcttggctt tatatatctt 2520

gtggaaagga cgaaacaccg ggtcttcgag aagacctgtt ttagagctag aaatagcaag 2580

ttaaaataag gctagtccgt tatcaacttg aaaaagtggc accgagtcgg tgcttttttc 2640

tagcgcgtgc gccaattctg cagacaaatg gctctagagg tacccataga tctagatgca 2700

ttcgcgaggt accgagctcg aattcactgg ccgtcgtttt acaacgtcgt gactgggaaa 2760

accctggcgt tacccaactt aatcgccttg cagcacatcc ccctttcgcc agctggcgta 2820

atagcgaaga ggcccgcacc gatcgccctt cccaacagtt gcgcagcctg aatggcgaat 2880

ggcgcctgat gcggtatttt ctccttacgc atctgtgcgg tatttcacac cgcatatggt 2940

gcactctcag tacaatctgc tctgatgccg catagttaag ccagccccga cacccgccaa 3000

cacccgctga cgcgccctga cgggcttgtc tgctcccggc atccgcttac agacaagctg 3060

tgaccgtctc cgggagctgc atgtgtcaga ggttttcacc gtcatcaccg aaacgcgcga 3120

<210> 72

<211> 23

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 72

gggacttcaa cgggtagaac ctg 23

<210> 73

<211> 23

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 73

cccgcacgct tctggtcccg acc 23

<210> 74

<211> 22

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 74

gcagagtgca agagggcccc ac 22

<210> 75

<211> 23

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 75

attcaacgat caggaggtca ggg 23

<210> 76

<211> 20

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 76

ccccacttca acctgagcca 20

<210> 77

<211> 20

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 77

ccttgacctg gtcggagccg 20

<210> 78

<211> 20

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 78

gaccaaagct gtgggccacc 20

<210> 79

<211> 20

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 79

cgggtccaca cgcagcttgt 20

<210> 80

<211> 22

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 80

gcagaggccc tggaaaggtg ag 22

<210> 81

<211> 22

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 81

tcaccagcag gcagtggctc ag 22

<210> 82

<211> 25

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 82

caccgcccca cttcaacctg agcca 25

<210> 83

<211> 25

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 83

aaactggctc aggttgaagt ggggc 25

<210> 84

<211> 25

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 84

caccgccttg acctggtcgg agccg 25

<210> 85

<211> 25

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 85

aaaccggctc cgaccaggtc aaggc 25

<210> 86

<211> 24

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 86

caccgaccaa agctgtgggc cacc 24

<210> 87

<211> 24

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 87

aaacggtggc ccacagcttt ggtc 24

<210> 88

<211> 25

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 88

caccgcgggt ccacacgcag cttgt 25

<210> 89

<211> 25

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 89

aaacacaagc tgcgtgtgga cccgc 25

<210> 90

<211> 23

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 90

taaaaggaag agcagagcca gca 23

<210> 91

<211> 23

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 91

gccacctaca tttgcttctg aca 23

<210> 92

<211> 23

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 92

aacagaggag aacaagagag agt 23

<210> 93

<211> 24

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 93

acttaaaaga gagaagacat cgca 24

<210> 94

<211> 20

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 94

gaggttcttc gagtcctttg 20

<210> 95

<211> 20

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 95

ggcattggac aggtccccaa 20

<210> 96

<211> 20

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 96

tcaggccgtc actgaaggac 20

<210> 97

<211> 20

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 97

gcttagcaaa ggtgcccttg 20

<210> 98

<211> 22

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 98

gtatccaggg cttcaggaga gg 22

<210> 99

<211> 22

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 99

gagctcagcc atgaccaagg ag 22

<210> 100

<211> 24

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 100

caccgaggtt cttcgagtcc tttg 24

<210> 101

<211> 24

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 101

aaaccaaagg actcgaagaa cctc 24

<210> 102

<211> 24

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 102

caccggcatt ggacaggtcc ccaa 24

<210> 103

<211> 24

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 103

aaacttgggg acctgtccaa tgcc 24

<210> 104

<211> 25

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 104

caccgtcagg ccgtcactga aggac 25

<210> 105

<211> 25

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 105

aaacgtcctt cagtgacggc ctgac 25

<210> 106

<211> 24

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 106

caccgcttag caaaggtgcc cttg 24

<210> 107

<211> 24

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 107

aaaccaaggg cacctttgct aagc 24

Claims

A CRISPR/Cas9 system comprising a first gRNA vector, a second gRNA vector, and a Cas9 expression vector,

the target sequence of the first gRNA vector is CCTTGACCTGGTCGGAGCCG, and the target sequence of the second gRNA vector is CGGGTCCACACGCAGCTTGT; the base sequence of the Cas9 expression vector is shown as SEQ ID NO. 70; the molar ratio of the first gRNA vector, the second gRNA vector, and the Cas9 expression vector is 1.5-2.
2. The CRISPR/Cas9 system of claim 1, characterized in that the original vector of the gRNA vector is pKG-U6gRNA.
A CRISPR/Cas9 system comprising a third gRNA vector, a fourth gRNA vector, and a Cas9 expression vector,

the target sequence of the third gRNA vector is GGCATTGGACAGGTCCCCAA, and the target sequence of the fourth gRNA vector is TCAGGCCGTCACTGAAGGAC; the base sequence of the Cas9 expression vector is shown as SEQ ID NO: 70; the molar ratio of the third gRNA vector, the fourth gRNA vector and the Cas9 expression vector is 1.5-2.
4. The CRISPR/Cas9 system of claim 3, characterized in that the original vector of the gRNA vector is pKG-U6gRNA.
A CRISPR/Cas9 system comprising a first gRNA vector, a second gRNA vector, a third gRNA vector, a fourth gRNA vector and a Cas9 expression vector,

the target sequence of the first gRNA vector is CCTTGACCTGGTCGGAGCCG, and the target sequence of the second gRNA vector is CGGGTCCACACGCAGCTTGT;

the target sequence of the third gRNA vector is GGCATTGGACAGGTCCCCAA, and the target sequence of the fourth gRNA vector is TCAGGCCGTCACTGAAGGAC;

the base sequence of the Cas9 expression vector is shown as SEQ ID NO: 70;

the molar ratio of the first gRNA vector, the second gRNA vector, the third gRNA vector, the fourth gRNA vector and the Cas9 expression vector is 0.75 to 1.
6. The CRISPR/Cas9 system according to claim 5, characterized in that the original vector of gRNA vector is pKG-U6gRNA.
7. The method for constructing the thalassemia model pig cell line is characterized by comprising the following steps of: transferring the CRISPR/Cas9 system of claim 1or 2 into a pig ear primary fibroblast, and screening gene mutation monoclonal cells.
8. The alpha thalassemia model pig cell line constructed according to the method of claim 7.
9. The method for constructing the thalassemia model pig cell line is characterized by comprising the following steps of: transferring the CRISPR/Cas9 system of claim 3 or 4 into a pig ear primary fibroblast, and screening gene mutation monoclonal cells.
10. The beta thalassemia model pig cell line constructed according to the method of claim 9.
11. The method for constructing the thalassemia model pig cell line is characterized by comprising the following steps of: transferring the CRISPR/Cas9 system of claim 5 or 6 into a pig ear primary fibroblast, and screening gene mutation monoclonal cells.
12. The alpha & beta thalassemia model pig cell line constructed according to the method of claim 11.