CN112941038B - Novel recombinant coronavirus based on vesicular stomatitis virus vector, and preparation method and application thereof - Google Patents

Novel recombinant coronavirus based on vesicular stomatitis virus vector, and preparation method and application thereof Download PDF

Info

Publication number
CN112941038B
CN112941038B CN202011576878.1A CN202011576878A CN112941038B CN 112941038 B CN112941038 B CN 112941038B CN 202011576878 A CN202011576878 A CN 202011576878A CN 112941038 B CN112941038 B CN 112941038B
Authority
CN
China
Prior art keywords
envelope protein
ncov
leu
thr
val
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN202011576878.1A
Other languages
Chinese (zh)
Other versions
CN112941038A (en
Inventor
郑爱华
赵超越
李虹悦
张毓航
金万洙
赵建国
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Institute of Zoology of CAS
Original Assignee
Institute of Zoology of CAS
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Institute of Zoology of CAS filed Critical Institute of Zoology of CAS
Publication of CN112941038A publication Critical patent/CN112941038A/en
Application granted granted Critical
Publication of CN112941038B publication Critical patent/CN112941038B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N7/00—Viruses; Bacteriophages; Compositions thereof; Preparation or purification thereof
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/12—Viral antigens
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12—Antivirals
    • A61P31/14—Antivirals for RNA viruses
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/005—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/65—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression using markers
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/51—Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
    • A61K2039/525—Virus
    • A61K2039/5256—Virus expressing foreign proteins
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2760/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses negative-sense
    • C12N2760/00011—Details
    • C12N2760/20011—Rhabdoviridae
    • C12N2760/20211—Vesiculovirus, e.g. vesicular stomatitis Indiana virus
    • C12N2760/20221—Viruses as such, e.g. new isolates, mutants or their genomic sequences
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2760/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses negative-sense
    • C12N2760/00011—Details
    • C12N2760/20011—Rhabdoviridae
    • C12N2760/20211—Vesiculovirus, e.g. vesicular stomatitis Indiana virus
    • C12N2760/20222—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2760/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses negative-sense
    • C12N2760/00011—Details
    • C12N2760/20011—Rhabdoviridae
    • C12N2760/20211—Vesiculovirus, e.g. vesicular stomatitis Indiana virus
    • C12N2760/20251—Methods of production or purification of viral material
    • C12N2760/20252—Methods of production or purification of viral material relating to complementing cells and packaging systems for producing virus or viral particles
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2770/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses positive-sense
    • C12N2770/00011—Details
    • C12N2770/20011—Coronaviridae
    • C12N2770/20022—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2770/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses positive-sense
    • C12N2770/00011—Details
    • C12N2770/20011—Coronaviridae
    • C12N2770/20034—Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2800/00—Nucleic acids vectors
    • C12N2800/10—Plasmid DNA
    • C12N2800/106—Plasmid DNA for vertebrates
    • C12N2800/107—Plasmid DNA for vertebrates for mammalian

Abstract

The invention discloses a novel recombinant coronavirus based on vesicular stomatitis virus vector, and a preparation method and application thereof. The recombinant novel coronavirus is a virus obtained by replacing glycoprotein G of vesicular stomatitis virus with envelope protein S; the envelope protein S comprises an extracellular region of the envelope protein S of 2019-nCoV (SARS-CoV-2) or a partial sequence thereof. Experiments prove that: the recombinant novel coronavirus can simulate the process of 2019-nCoV (SARS-CoV-2) invading cells and can stimulate an organism to generate an immune response aiming at the 2019-nCoV (SARS-CoV-2), so that the recombinant novel coronavirus is not only an ideal tool for researching the 2019-nCoV (SARS-CoV-2) infection process, but also can be developed into a vaccine, and has important significance for screening inhibitors for inhibiting virus invasion and vaccine development.

Description

Novel recombinant coronavirus based on vesicular stomatitis virus vector, and preparation method and application thereof
Technical Field
The invention relates to the technical field of biomedicine, in particular to a replication type recombinant novel coronavirus based on a vesicular stomatitis virus vector, and a preparation method and application thereof.
Background
The new type coronavirus 2019-nCoV is also called SARS-CoV-2 or HCoV-19, and is a new emerging beta genus coronavirus. The virus genome analysis shows that the virus is very close to SARS-CoV (Severe acid metabolism syndrome-coronavirus) virus (89.1 percent of nucleotide similarity), and the virus can cause symptoms such as human pneumonia after being infected with the novel coronavirus 2019-nCoV. The novel coronavirus 2019-nCoV (SARS-CoV-2) belongs to a single-stranded positive-strand RNA virus and has an envelope. The virus particles are circular or elliptical and have radial protrusions when observed under an electron microscope. This radial bulge is a characteristic structure of coronaviruses and is composed of the envelope protein spike (S). The S protein is an important structural protein of coronavirus, and plays a key role in the process of virus invasion into host cells.
A novel coronavirus pneumonia (COVID-19) caused by a novel coronavirus 2019-nCoV (SARS-CoV-2) is spreading worldwide. The disease is brought into the infectious disease B specified in infectious disease prevention and control Law of the people's republic of China, and prevention and control measures of the infectious disease A are taken. The epidemiological characteristics are as follows: the current infection source is mainly pneumonia patients infected by novel coronavirus 2019-nCoV (SARS-CoV-2); the main transmission route is transmission through respiratory droplets and can also be transmission through contact; the population is common and susceptible, the disease of the old and the people with basic diseases is serious after infection, and children and infants also have diseases. Based on current epidemiological investigations, the patient latency is typically 3-7 days, up to 14 days. The clinical manifestations are fever, hypodynamia and dry cough. A few patients have nasal obstruction, watery nasal discharge, diarrhea, etc. Severe patients manifest with dyspnea, acute respiratory distress syndrome, septic shock, uncorrectable metabolic acidosis, and hemorrhagic clotting dysfunction.
At present, the novel coronavirus 2019-nCoV (SARS-CoV-2) is in an accumulated cognition stage, and the symptomatic treatment and the supportive treatment are mainly carried out on patients, so that specific medicines and treatment means are lacked. To thwart the development of 2019-nCoV (SARS-CoV-2) vaccines is not slow enough.
Disclosure of Invention
The invention aims to provide a replication type recombinant novel coronavirus based on a vesicular stomatitis virus vector, and a preparation method and application thereof.
In order to achieve the above object, the present invention first provides a recombinant virus.
The recombinant virus provided by the invention is obtained by replacing glycoprotein G of vesicular stomatitis virus with envelope protein S; the envelope protein S comprises an extracellular region of the envelope protein S of 2019-nCoV (SARS-CoV-2) or a partial sequence thereof;
the amino acid sequence of the envelope protein S extracellular region of the 2019-nCoV (SARS-CoV-2) is a) or b) or c):
a) the amino acid sequence is protein shown in 1 st-1210 th site of a sequence 2 in a sequence table;
b) the protein with the same function is obtained by substituting and/or deleting and/or adding one or more amino acid residues of the amino acid sequence shown in the 1 st to 1210 th sites of the sequence 2 in the sequence table;
c) protein which has 85 percent or more than 85 percent of homology with the amino acid sequence shown in the 1 st to 1210 th sites of the sequence 2 in the sequence table and has the same function.
Further, the recombinant virus is 1) or 2) or 3) as follows:
1) replacing glycoprotein G of vesicular stomatitis virus with envelope protein S of 2019-nCoV (SARS-CoV-2) to obtain virus;
the amino acid sequence of the cyst membrane protein S of the 2019-nCoV (SARS-CoV-2) is the sequence 2 in the sequence table;
2) replacing glycoprotein G of vesicular stomatitis virus with envelope protein S which is formed by chimeric envelope protein S extracellular region of envelope protein S of 2019-nCoV (SARS-CoV-2) and envelope protein S transmembrane region and intracellular region of SARS-CoV to obtain virus;
the amino acid sequence of the cyst membrane protein S formed by the cyst membrane protein S extracellular region of 2019-nCoV (SARS-CoV-2) and the cyst membrane protein S transmembrane region and intracellular region of SARS-CoV through chimeric is sequence 4 in the sequence table;
3) the virus is obtained by replacing glycoprotein G of vesicular stomatitis virus with a cyst membrane protein S formed by the chimeric extracellular region of a cyst membrane protein S of 2019-nCoV (SARS-CoV-2) and the transmembrane region and the intracellular region of glycoprotein G of vesicular stomatitis virus;
the amino acid sequence of the cyst membrane protein S formed by the chimeric cyst membrane protein S extracellular region of 2019-nCoV (SARS-CoV-2) and the glycoprotein G transmembrane region and intracellular region of vesicular stomatitis virus is sequence 6 in the sequence table.
Further, in the 1), the recombinant virus is a virus obtained by replacing a coding gene sequence of glycoprotein G in a genome sequence of the vesicular stomatitis virus with a coding gene sequence of a cyst membrane protein S of 2019-nCoV (SARS-CoV-2);
in the step 2), the recombinant virus is a virus obtained by replacing the coding gene sequence of glycoprotein G in the genome sequence of the vesicular stomatitis virus with the coding gene sequence of the envelope protein S formed by the chimeric of the extracellular region of the envelope protein S of 2019-nCoV (SARS-CoV-2) and the transmembrane region and the intracellular region of the envelope protein S of SARS-CoV;
in the step 3), the recombinant virus is obtained by replacing the coding gene sequence of glycoprotein G in the genome sequence of the vesicular stomatitis virus with the coding gene sequence of the cyst membrane protein S formed by the chimeric extracellular region of the cyst membrane protein S of 2019-nCoV (SARS-CoV-2) and the transmembrane region and the intracellular region of the glycoprotein G of the vesicular stomatitis virus.
In order to achieve the above object, the present invention further provides a recombinant virus.
The recombinant virus provided by the invention is obtained by transfecting a recombinant virus vector into a virus packaging cell and then carrying out cell culture; the recombinant viral vector is A) or B) or C) or D) as follows:
A) replacing the coding gene sequence of glycoprotein G in the genome sequence of the vesicular stomatitis virus in the vesicular stomatitis virus vector with the coding gene sequence of the envelope protein S of 2019-nCoV (SARS-CoV-2) to obtain a vector;
B) replacing the coding gene sequence of glycoprotein G in the genome sequence of the vesicular stomatitis virus in the vesicular stomatitis virus vector with the coding gene sequence of the envelope protein S formed by the chimeric extracellular region of the envelope protein S of 2019-nCoV (SARS-CoV-2) and the transmembrane region and the intracellular region of the envelope protein S of SARS-CoV;
C) the vector is obtained by replacing the coding gene sequence of glycoprotein G in the genome sequence of the vesicular stomatitis virus in the vesicular stomatitis virus vector with the coding gene sequence of the envelope protein S formed by the chimeric extracellular region of the envelope protein S of 2019-nCoV (SARS-CoV-2) and the transmembrane region and the intracellular region of the glycoprotein G of the vesicular stomatitis virus.
D) A vector obtained by inserting a reporter gene into the recombinant viral vector described in A), B) or C).
Furthermore, the coding gene sequence of the envelope protein S of the 2019-nCoV (SARS-CoV-2) is the sequence 1 in the sequence table;
the coding gene sequence of the envelope protein S formed by the chimeric extracellular region of the envelope protein S of 2019-nCoV (SARS-CoV-2) and the transmembrane region and the intracellular region of the envelope protein S of SARS-CoV is a sequence 3 in the sequence table;
the coding gene sequence of the envelope protein S formed by the chimeric interaction of the extracellular region of the envelope protein S of 2019-nCoV (SARS-CoV-2) and the transmembrane region and the intracellular region of glycoprotein G of vesicular stomatitis virus is a sequence 5 in the sequence table.
The reporter gene can be a reporter gene commonly used in the prior art, such as a GFP gene (shown as a sequence 14 in a sequence table).
In the A), the recombinant virus vector is obtained by inserting the DNA molecule shown in the sequence 1 between the restriction enzyme sites MluI and NotI of the rVSV delta G vector.
In the step B), the recombinant virus vector is obtained by inserting the DNA molecule shown in the sequence 3 into the restriction enzyme site MluI and NotI of the rVSV delta G vector.
In the step C), the recombinant virus vector is obtained by inserting the DNA molecule shown in the sequence 5 between the restriction enzyme sites MluI and NotI of the rVSV delta G vector.
In the step D), the recombinant virus vector is obtained by inserting a GFP gene sequence shown as a sequence 14 in a sequence table between the 62 th nucleotide and the 63 rd nucleotide in the nucleotide sequence of the recombinant virus vector in the step A).
The rVSV delta G vector comprises a T7 promoter sequence, a VSV Indiana strain whole genome sequence deleting a glycoprotein G coding gene sequence and an HDV terminator sequence, and the nucleotide sequence is a sequence 7 in the sequence table.
The virus packaging cell can be a cell line commonly used for virus packaging in the prior art, such as 293T cell, Vero cell and BHK cell, and can be Vero cell.
The recombinant virus is obtained by transfecting the virus packaging cell with the recombinant virus vector, a plasmid for expressing the N protein of VSV, a plasmid for expressing the P protein of VSV, a plasmid for expressing the L protein of VSV, a plasmid for expressing the M protein of VSV, a plasmid for expressing the G protein of VSV and a plasmid for expressing T7RNA polymerase together, and then carrying out cell culture.
The plasmid for expressing the N protein of the VSV is specifically a plasmid obtained by cloning a N protein coding gene sequence (sequence 8 in a sequence table) in a VSV genome into a eukaryotic expression plasmid pCDNA3.1(+) through a BamHI-EcoRI enzyme cutting site. The plasmid for expressing the P protein of the VSV is specifically a plasmid obtained by cloning a P protein coding gene sequence (sequence 9 in a sequence table) in a VSV genome into a eukaryotic expression plasmid pCDNA3.1(+) through a BamHI-EcoRI enzyme cutting site. The plasmid for expressing the VSV L protein is specifically a plasmid obtained by cloning an L protein coding gene sequence (sequence 10 in a sequence table) in a VSV genome into a eukaryotic expression plasmid pCDNA3.1(+) through a BamHI-EcoRI enzyme cutting site. The plasmid for expressing the M protein of the VSV is specifically a plasmid obtained by cloning an M protein coding gene sequence (a sequence 11 in a sequence table) in a VSV genome into a eukaryotic expression plasmid pCDNA3.1(+) through a BamHI-EcoRI enzyme cutting site. The plasmid for expressing the G protein of the VSV is specifically a plasmid obtained by cloning a G protein coding gene sequence (sequence 12 in a sequence table) in a VSV genome into a eukaryotic expression plasmid pCDNA3.1(+) through a BamHI-EcoRI enzyme cutting site. The plasmid for expressing the T7RNA polymerase is specifically a plasmid obtained by cloning a T7RNA polymerase coding gene sequence (sequence 13 in a sequence table) into a eukaryotic expression plasmid pCDNA3.1(+) through a BamHI-EcoRI enzyme cutting site.
The 2019-nCoV (SARS-CoV-2) is specifically a 2019-nCoV Wuhan-Hu-1 strain (GenBank: NC-045512.2).
The SARS-CoV is SARS-CoV BJ01 strain (GenBank: AY 278488.2).
The vesicular stomatitis virus is specifically vesicular stomatitis virus Indiana strain (GenBank: KF 935251.1).
The recombinant viral vectors described above also fall within the scope of the present invention.
In order to achieve the above object, the present invention also provides a novel use of the above recombinant virus or the above recombinant viral vector.
The invention provides the application of the recombinant virus or the recombinant viral vector in any one of the following X1) -X3):
x1) preparing a novel coronavirus vaccine;
x2) for the preparation of a product for the prevention and/or treatment of diseases caused by novel coronaviruses;
x3) screening for novel coronavirus invasion inhibitors.
In the above application, the screening of the novel coronavirus invasion inhibitor is embodied in the detection of the titer of the neutralizing antibody induced by the novel coronavirus vaccine.
In order to achieve the above objects, the present invention also provides a product for preventing and/or treating diseases caused by the novel coronavirus.
The active ingredient of the product for preventing and/or treating diseases caused by the novel coronavirus is the recombinant virus or the recombinant virus vector.
In any of the uses or products described above, the product is a novel coronavirus vaccine.
In any of the above applications or products, the novel coronavirus is particularly 2019-nCoV (SARS-CoV-2).
The disease caused by the novel coronavirus is particularly COVID-19 caused by the novel coronavirus.
The concept involved in the present invention is as follows:
the vaccine is an automatic immune preparation for preventing infectious diseases, which is prepared by artificially attenuating and inactivating pathogenic microorganisms (such as bacteria, rickettsia, viruses and the like) and metabolites thereof or by utilizing genetic engineering and other methods. The vaccine retains the property of pathogenic bacteria to stimulate the immune system of an animal. When an animal body is contacted with the pathogen without harm, the immune system can generate certain protective substances, such as antibodies and the like; when the animal is exposed to the pathogenic bacteria again, the immune system of the animal will follow its original memory and produce more protective substances to prevent the pathogenic bacteria from harming.
The novel coronavirus belongs to a novel coronavirus of beta genus, and has an envelope, and the particle is circular or elliptical and has a diameter of 60-140 nm. The infected patients are mainly manifested by fever, hypodynamia and dry cough, and the serious patients can progress to acute respiratory distress syndrome, septic shock, metabolic acidosis which is difficult to correct and blood coagulation dysfunction, and some severe patients die.
Vesicular Stomatitis Virus (VSV) is a single negative strand non-segmented RNA Virus with a genome length of about 11Kb and a simple structure. 5 mRNAs are transcribed sequentially from 3 'to 5', encoding 5 proteins: nucleocapsid protein N (nucleocapsid protein), phosphoprotein P (phosphoprotein), matrix protein M (matrix protein), glycoprotein G (glycoprotein), large polymerase L (large protein). The G protein is an integral membrane protein of type I, exists in a trimer form on the surface of virion and performs the functions of binding with a target cell receptor and membrane fusion. In animals infected with VSV, the majority of the antibodies produced are directed against the G protein. VSV is a representative model virus species of the rhabdoviridae family and is widely used to study the mechanisms of entry, replication, and assembly of enveloped viruses into cells. Vesicular stomatitis caused by VSV virus is a benign disease of contact infection, primarily infecting rodents, cattle, pigs and horses, and can also infect humans and other animals. Humans are only infected by chance, but often with few symptoms or only mild fever. The rate of VSV antibodies in the population is very low, and only those who are exposed to VSV frequently have a higher seroprevalence, e.g., some researchers, farmers who are veterinarians who are exposed to sick animals. The neutralizing antibody target of VSV is the G protein, and once the G protein is replaced with the envelope protein of the foreign virus, the recombinant virus will not be affected by pre-existing immunity (pre-existing immunity) in the human body. Absence of preexisting immunity and lack of apparent pathogenicity are prerequisites for VSV as a vaccine vector.
Among the existing live Virus vaccine vectors, Vesicular Stomatitis Virus (VSV) has a low seroprevalence among the population; can induce mucosal immunity; the virus vaccine vector has the outstanding advantages of simple genome, easy large-scale production and the like, and is considered to be one of the virus vaccine vectors with development potential. Successful recovery of infectious VSV virus from DNA makes genetic manipulation of VSV possible. Exogenous viral functional envelope proteins with appropriate cytoplasmic tails can be efficiently packaged into the envelope of the virus to form various chimeric recombinant VSVs packaging heterologous envelope proteins. The non-coding region between each transcription unit of the recombinant VSV can tolerate the insertion of foreign genes with the length of 4.5kb and obtain high-efficiency expression. These properties confer potential for VSV applications as live virus vaccine vectors.
As an emerging live vector vaccine, VSV has the following advantages: (1) easy culture: VSV is available in very high titers on most mammalian cells and is easily prepared in large quantities. (2) High efficiency: in a mouse model of VSV-HA infection, 10 infectious viral particles induced an immune response and 105The immune response elicited by each infectious particle was equally significant. (3) The use is easy: immunization can be carried out by various vaccination routes, and often one vaccination can cause a strong immune response. (4) And (3) generating stronger immune response: can stimulate organism to generate strong cellular immune response and humoral immune response, can also cause stronger mucosal immune response, and is particularly suitable for the development of vaccines of respiratory pathogens infected through mucosa. (5) The safety is good: since VSV virus replicates completely in the cytoplasm, only from RNA → RNA, it does not integrate into the DNA of the host cell and is eventually cleared by the host immune system. Moreover, genome mutation and/or modification can be carried out by reverse genetic manipulation, so that the VSV virus can be weakened appropriately, and becomes a safer recombinant vaccine vector.
The VSV recombinant virus prepared by the invention is different from a VSV pseudovirus, and the most difference is that the VSV recombinant virus prepared by the invention can be replicated after infecting cells, and the VSV pseudovirus only can infect the cells but cannot replicate. In addition, the preparation method and the application range of the two are also different. Although both can be used for screening of viral inhibitors and for basic study of viral infection mechanism, the VSV recombinant virus produced by the present invention can also be used for producing vaccines, whereas VSV pseudoviruses cannot be used for producing vaccines.
The invention takes vesicular stomatitis virus VSV as a vector, and constructs three replication type recombinant viruses: replacing the coding gene sequence of glycoprotein G of VSV virus with the coding gene sequence of envelope protein S of 2019-nCoV (SARS-CoV-2); replacing the coding gene sequence of the glycoprotein G of the VSV virus with the coding gene sequence of the envelope protein S formed by the chimeric extracellular region of the envelope protein S of 2019-nCoV (SARS-CoV-2) and the transmembrane region and the intracellular region of the envelope protein S of SARS-CoV; and thirdly, replacing the coding gene sequence of the glycoprotein G of the VSV virus with the coding gene sequence of the envelope protein S formed by the chimeric extracellular region of the envelope protein S of 2019-nCoV (SARS-CoV-2) and the transmembrane region and the intracellular region of the glycoprotein G of the vesicular stomatitis virus. Experiments prove that: the three recombinant viruses can be replicated in Vero cells, have no pathogenicity of 2019-nCoV (SARS-CoV-2), can simulate the process of 2019-nCoV invading cells, and can stimulate the organism to generate immune response against 2019-nCoV (SARS-CoV-2). The virus invasion and neutralizing antibody target is mainly the extracellular region of the S protein, so the infection mechanism and induced immune response of the recombinant virus are theoretically very similar to 2019-nCoV (SARS-CoV-2). The recombinant virus can be developed into a vaccine, can also be used as an ideal tool for researching the 2019-nCoV (SARS-CoV-2) infection process, and has important significance for screening inhibitors (such as antibodies, serum, small peptides, small molecules and the like) for inhibiting virus invasion and developing novel coronavirus vaccines.
Drawings
FIG. 1 is a schematic structural diagram of recombinant virus rVSV-2019-nCoV (rVSV-SARS-CoV-2).
FIG. 2 is a schematic diagram of the chimeric interaction between the envelope protein S extracellular region of 2019-nCoV (SARS-CoV-2) and the envelope protein S transmembrane region and intracellular region of SARS-CoV.
FIG. 3 is the replication curves of recombinant viruses rVSV-2019-nCoV (rVSV-SARS-CoV-2) and rVSV-2019-nCoV-SARS in Vero cells. The control is VSV recombinant Ebola virus rVSV-EBOV.
FIG. 4 shows the expression of the S protein in recombinant viruses rVSV-2019-nCoV (rVSV-SARS-CoV-2) and rVSV-2019-nCoV-SARS.
FIG. 5 shows plaques formed by recombinant viruses rVSV-2019-nCoV (rVSV-SARS-CoV-2) and rVSV-2019-nCoV-SARS infected Vero cells. The control is VSV recombinant Ebola virus rVSV-EBOV. The scale bar represents 100 μm.
FIG. 6 shows neutralizing antibodies produced by single nasal drip vaccination of cynomolgus monkey with recombinant virus rVSV-2019-nCoV (rVSV-SARS-CoV-2).
FIG. 7 shows the virus load of throat swabs of cynomolgus monkeys vaccinated with the recombinant virus rVSV-2019-nCoV (rVSV-SARS-CoV-2) after challenge with SARS-CoV-2.
FIG. 8 shows the anal swab viral load of cynomolgus monkeys vaccinated with the recombinant virus rVSV-2019-nCoV (rVSV-SARS-CoV-2) after challenge with SARS-CoV-2.
FIG. 9 shows lung tissue viral load on day 7 after challenge with SARS-CoV-2 in cynomolgus monkeys vaccinated with the recombinant virus rVSV-2019-nCoV (rVSV-SARS-CoV-2).
Detailed Description
The following examples are given to facilitate a better understanding of the invention, but do not limit the invention. The experimental procedures in the following examples are conventional unless otherwise specified. The test materials used in the following examples were purchased from a conventional biochemical reagent store unless otherwise specified. The quantitative tests in the following examples, all set up three replicates and the results averaged.
The control virus rVSV-EBOV in the following examples is described in the literature "Live attenuated recombinant vaccine viruses non-human viruses against natural animals Ebola and Marburg viruses. Nature Med. (2005)11,786-790", publicly available from animal research institutes of Chinese sciences, and the biomaterial is only used for repeating the relevant experiments of the present invention and is not used for other purposes.
The plasmid for expressing the N protein of VSV in the following examples is obtained by cloning the N protein coding gene sequence (sequence 8 in the sequence table) in the VSV genome into the eukaryotic expression plasmid pCDNA3.1(+) (Beijing Shengyue Gegen Biotech Co., Ltd.) through a BamHI-EcoRI cleavage site.
The plasmid expressing the P protein of VSV in the following examples is obtained by cloning the P protein coding gene sequence (sequence 9 in the sequence table) in the VSV genome into the eukaryotic expression plasmid pCDNA3.1(+) (Beijing Shengyue Gegen Biotech Co., Ltd.) through a BamHI-EcoRI cleavage site.
The plasmid expressing the L protein of VSV in the following examples was obtained by cloning the gene sequence encoding the L protein in the VSV genome (SEQ ID NO: 10 in the sequence Listing) into the eukaryotic expression plasmid pCDNA3.1(+) (Beijing Shengyue Gegen Biotech Co., Ltd.) through a BamHI-EcoRI cleavage site.
The plasmid expressing the M protein of VSV in the following examples was obtained by cloning the M protein coding gene sequence (sequence 11 in the sequence listing) in the VSV genome into the eukaryotic expression plasmid pCDNA3.1(+) (Beijing Shengyue Gegen Biotech Co., Ltd.) through a BamHI-EcoRI cleavage site.
The plasmid expressing the G protein of VSV in the following examples is obtained by cloning the G protein coding gene sequence (sequence 12 in the sequence table) in the VSV genome into the eukaryotic expression plasmid pCDNA3.1(+) (Beijing Shengyue Gegen Biotech Co., Ltd.) through a BamHI-EcoRI cleavage site.
The plasmid expressing T7RNA polymerase in the following examples was obtained by cloning a gene sequence encoding T7RNA polymerase (SEQ ID NO: 13 in the sequence Listing) into a eukaryotic expression plasmid pCDNA3.1(+) (Beijing Shengyue Gegen Biotech Co., Ltd.) through a BamHI-EcoRI cleavage site.
rVSV Δ G vectors in the following examples are described in the literature "Single dose of a rVSV-based vaccine experiments complete protection against virus vector farm mover with a thrombocytotropia syndrome virus NPJ vaccines.2019Jan 25; 4:5 ", the biological material is only used for repeating the relevant experiments of the present invention and is not used for other purposes. The nucleotide sequence of the rVSV delta G vector is a sequence 7 in a sequence table, and comprises a T7 promoter sequence, a VSV Indiana strain whole genome sequence deleting a glycoprotein G coding gene sequence and an HDV terminator sequence.
The Vero cells in the following examples are ATCC (American type culture collection) products, and the product number is CCL-81.
Example 1 preparation of recombinant Virus rVSV-2019-nCoV (rVSV-SARS-CoV-2)
Preparation of recombinant vector VSV-2019-nCoV
1. Optimization of envelope protein S sequence
In order to develop the 2019-nCoV vaccine, the sequence of the complete envelope protein S of the 2019-nCoV is subjected to humanized optimization, and the optimized sequence is shown as a sequence 1 in a sequence table. The complete envelope protein S of the 2019-nCoV is the envelope protein S (GenBank: YP _009724390.1) of a 2019-nCoV Wuhan-Hu-1 strain (GenBank: NC _045512.2), and the amino acid sequence of the complete envelope protein S is shown as a sequence 2 in a sequence table.
2. Construction of recombinant vector VSV-2019-nCoV
Inserting the sequence optimized in the step 1 (sequence 1 in a sequence table) between the restriction enzyme sites MluI and NotI of the rVSV delta G vector to obtain a recombinant vector, and naming the recombinant vector as VSV-2019-nCoV.
Secondly, preparation of recombinant virus rVSV-2019-nCoV (rVSV-SARS-CoV-2)
And (2) co-transfecting the recombinant vector VSV-2019-nCoV in the step one and auxiliary plasmids (a plasmid for expressing the N protein of VSV, a plasmid for expressing the P protein of VSV, a plasmid for expressing the L protein of VSV, a plasmid for expressing the M protein of VSV, a plasmid for expressing the G protein of VSV and a plasmid for expressing T7RNA polymerase) into Vero cells to prepare the recombinant virus rVSV-2019-nCoV. A schematic structural diagram of recombinant virus rVSV-2019-nCoV is shown in FIG. 1. The method comprises the following specific steps:
1. and (3) subculturing the Vero cells into a culture dish, and when the cell density reaches 70-80% the next day, replacing the complete culture medium with a DMEM (Thermo Fisher, the product number is SH30243.01B) medium containing 2% (volume fraction) fetal bovine serum (FBS, Thermo Fisher, the product number is 10091) to obtain a Vero cell culture system.
2. After completion of step 1, 36. mu.L of FuGENE 6 (Promega, cat # E2692) was incubated with Opti-MEM medium (Thermo Fisher, cat # 51985091) at room temperature for 5 minutes, and mixed with the recombinant vector VSV-2019-nCoV (1.59. mu.g), plasmid expressing N protein of VSV (1.286. mu.g), plasmid expressing P protein of VSV (639ng), plasmid expressing L protein of VSV (159.9ng), plasmid expressing M protein of VSV (159.9ng), plasmid expressing G protein of VSV (159.9ng), and plasmid expressing VSV T7RNA polymerase (8.1. mu.g) in step one, and incubated at room temperature for 15 minutes to obtain a post-incubation solution (total volume of 600. mu.L).
3. And (3) after the step 2 is finished, adding the solution incubated in the step 2 into the Vero cell culture system in the step 1, and replacing the fresh culture medium after 6 hours. Cell supernatants were harvested 3 days after transfection and contained recombinant virus rVSV-2019-nCoV (rVSV-SARS-CoV-2). The obtained supernatant is used for infecting new Vero cells to realize the amplification of recombinant virus rVSV-2019-nCoV (rVSV-SARS-CoV-2). The recombinant virus rVSV-2019-nCoV (rVSV-SARS-CoV-2) is obtained by replacing the coding gene sequence of glycoprotein G in the genome sequence of vesicular stomatitis virus with the coding gene sequence of envelope protein S of 2019-nCoV (SARS-CoV-2).
Example 2 preparation of recombinant Virus rVSV-2019-nCoV-SARS
Preparation of recombinant vector VSV-2019-nCoV-SARS
1. Optimization of chimeric S sequences
In order to develop a 2019-nCoV vaccine, the sequence of the envelope protein S which is formed by chimeric envelope protein S extracellular region of the 2019-nCoV and envelope protein S transmembrane region and intracellular region of SARS-CoV is subjected to humanized optimization, and the optimized sequence is shown as sequence 3 in the sequence table. The envelope protein S extracellular region of the 2019-nCoV is the envelope protein S extracellular region of the 2019-nCoV Wuhan-Hu-1 strain (the 1 st to 1210 th positions of the amino acid sequence of the envelope protein S of the Wuhan-Hu-1 strain), and the envelope protein S transmembrane region and the intracellular region of the SARS-CoV are the envelope protein S transmembrane region and the intracellular region of the SARS-CoV (Severe acid metabolism syndrome-coronavirus) BJ01 strain (GenBank: AY278488.2) (the 1202 th position 1267 of the amino acid sequence of the envelope protein S of the BJ01 strain). The amino acid sequence of the envelope protein S formed by the chimeric envelope protein S extracellular region of 2019-nCoV and the envelope protein S transmembrane region and intracellular region of SARS-CoV is shown as the sequence 4 in the sequence table. The chimeric schematic diagram of the envelope protein S extracellular region of 2019-nCoV and the envelope protein S transmembrane region and intracellular region of SARS-CoV is shown in FIG. 2.
2. Construction of recombinant vector VSV-2019-nCoV-SARS
Inserting the optimized sequence (sequence 3 in the sequence table) in the step 1 between the restriction enzyme sites MluI and NotI of the rVSV delta G vector to obtain a recombinant vector, and naming the recombinant vector as VSV-2019-nCoV-SARS.
Preparation of recombinant virus rVSV-2019-nCoV-SARS
The recombinant vector VSV-2019-nCoV-SARS and the helper plasmid in step one were co-transfected into Vero cells to prepare recombinant virus rVSV-2019-nCoV-SARS according to the method in step two of example 1. The structure schematic diagram of recombinant virus rVSV-2019-nCoV-SARS is shown in FIG. 2. The recombinant virus rVSV-2019-nCoV-SARS is a virus obtained by replacing the coding gene sequence of glycoprotein G in the genome of vesicular stomatitis virus with the coding gene sequence of envelope protein S formed by chimeric envelope protein S extracellular region of 2019-nCoV (SARS-CoV-2) and envelope protein S transmembrane region and intracellular region of SARS-CoV.
Example 3 preparation of recombinant Virus rVSV-2019-nCoV
Preparation of recombinant vector VSV-2019-nCoV
1. Optimization of envelope protein S sequence
In order to develop a 2019-nCoV vaccine, a sequence coding for a cyst membrane protein S formed by chimeric extracellular region of the cyst membrane protein S of 2019-nCoV and transmembrane region and intracellular region of glycoprotein G of VSV is subjected to humanized optimization, and the optimized sequence is shown as a sequence 5 in a sequence table. The envelope protein S extracellular region of the 2019-nCoV is the envelope protein S extracellular region of the 2019-nCOV Wuhan-Hu-1 strain. The glycoprotein G transmembrane and intracellular region of VSV is that of the VSV Indiana strain. The amino acid sequence of the envelope protein S formed by the chimeric extracellular region of the envelope protein S of 2019-nCoV and the transmembrane region and the intracellular region of the glycoprotein G of VSV is shown as a sequence 6 in the sequence table.
2. Construction of recombinant vector VSV-2019-nCoV
Inserting the sequence (sequence 5 in the sequence table) optimized in the step 1 between the restriction enzyme sites MluI and NotI of the rVSV delta G vector to obtain a recombinant vector, and naming the recombinant vector as VSV-2019-nCoV'.
II, recovery of recombinant virus rVSV-2019-nCoV
According to the method in the second step of example 1, the recombinant vector VSV-2019-nCoV 'in the first step and the helper plasmid are co-transfected into Vero cells to prepare recombinant virus rVSV-2019-nCoV'. The recombinant virus rVSV-2019-nCoV' is a virus obtained by replacing the coding gene sequence of glycoprotein G in the genome of the vesicular stomatitis virus with the coding gene sequence of the cyst membrane protein S formed by the chimeric extracellular region of the cyst membrane protein S of 2019-nCoV (SARS-CoV-2) and the transmembrane region and the intracellular region of the glycoprotein G of the vesicular stomatitis virus.
Example 4 growth curves of recombinant viruses
Vero cells were passaged at a ratio of 1:3 in 10cm cell culture dishes. The recombinant virus rVSV-2019-nCoV (rVSV-SARS-CoV-2) prepared in example 1 or rVSV-2019-nCoV-SARS or control virus rVSV-EBOV prepared in example 2 was added when the cells grew to a density of about 80% on the next day, and the medium was changed to DMEM containing 2% (volume fraction) FBS 2 hours after infection. Samples were taken every 12 hours post-infection until 144 hours post-infection. The virus titer in the supernatants at different infection times was determined by immunofluorescence.
The operation method for measuring the virus titer by the immunofluorescence method comprises the following steps: vero cells were passaged in 96-well plates at 1.0 ten thousand cells per well. And adding the supernatant of the virus to be detected when the cells grow to about 80-90% of the density on the next day. The virus supernatant was diluted 10-fold in gradient, i.e. 30. mu.l of virus stock was mixed with 270. mu.l of virus diluent, and so on for a total of 6-7 gradients. The virus dilution was DMEM medium containing 2% (volume fraction) FBS. Add 100. mu.l of virus solution to each well, and repeat for 3 wells for each dilution. Will be thinThe cells were placed in a 37 ℃ cell culture chamber and the medium was changed to contain 20mM NH 2 hours after infection4DMEM medium of Cl and 2% (volume fraction) FBS, the cells were placed in a cell culture chamber at 28 ℃. Virus titers (in FFU/ml) were detected 24 hours after infection by staining with anti-S protein antibody (Beijing Quizhou technologies, Inc., rabbit anti-SARS-CoV S polyclonal antibody, cat # 10150-RP 01). Selection of fluorescence number in 96-well plates at 102Counting the left and right holes, wherein the calculation method comprises the following steps: mean fluorescence number in three wells x dilution factor x 10. For example, a dilution factor of 104The fluorescence in the wells of (1) was 21, and the virus titer was 21X 104×10＝2.1×106FFU/ml。
The results are shown in FIG. 3. The results show that: amplification of rVSV-2019-nCoV (rVSV-SARS-CoV-2) was faster than that of rVSV-2019-nCoV-SARS 60 hours after infection. The highest titer of rVSV-2019-nCoV (rVSV-SARS-CoV-2) can reach 1.0 x 106FFU/ml, and highest titer of rVSV-2019-nCoV-SARS (1.0X 10)5FFU/ml) was 10-fold lower than rVSV-2019-nCoV. The control virus rVSV-EBOV titer peaked 48 hours post-infection, approaching 1.0X 107FFU/ml。
Example 5 identification of recombinant viruses
In order to identify the expression of the S protein on the recombinant virus particles, the Vero cell supernatant infected by the recombinant virus rVSV-2019-nCoV (rVSV-SARS-CoV-2) prepared in example 1 or the recombinant virus rVSV-2019-nCoV-SARS prepared in example 2 is collected, centrifuged for 3 hours at 39,000 revolutions by an ultracentrifugation method to obtain a virus precipitate, and the virus precipitate is resuspended to obtain a concentrated virus; then, Western Blot (Beijing Yiqiao Shenzhou science and technology Co., Ltd., rabbit anti-SARS-CoV S polyclonal; product number is 10150-RP01) is adopted to detect the expression condition of the S protein on the recombinant virus. Untransfected Vero cells were used as Control (CON).
The results are shown in FIG. 4. The results show that: the recombinant virus rVSV-2019-nCoV (rVSV-SARS-CoV-2) and rVSV-2019-nCoV-SARS can detect the expression of S protein after concentration, and the expression product of S protein has two bands with the size of about 180KD and 100 KD. This result demonstrates successful packaging of the S protein into the recombinant viruses rVSV-2019-nCoV (rVSV-SARS-CoV-2) and rVSV-2019-nCoV-SARS.
Example 6 plaque assay
Vero cells were infected with 10-fold gradient-diluted recombinant virus (rVSV-2019-nCoV (rVSV-SARS-CoV-2) prepared in example 1 or rVSV-2019-nCoV-SARS prepared in example 2), and plaque formation was detected by plaque assay. Specific procedures for plaque assays are described in "A VSV-based Zika virus vaccine technologies microbial from complete laboratory exchange. Sci Rep. (2018)8,11043". After the Vero cell virus is infected for six days, crystal violet staining is carried out, and plaques formed by the Vero cell infected by recombinant viruses rVSV-2019-nCoV (rVSV-SARS-CoV-2) and rVSV-2019-nCoV-SARS are observed. Meanwhile, the Ebola recombinant virus rVSV-EBOV is used as a control, and crystal violet staining observation is carried out two days after virus infection.
The plaque assay results are shown in figure 5. The results show that: both recombinant viruses (rVSV-2019-nCoV (rVSV-SARS-CoV-2) prepared in example 1 or rVSV-2019-nCoV-SARS prepared in example 2) formed very small plaques six days after infection of Vero cells (FIG. 5, see arrows). While rVSV-EBOV can form larger plaques two days after infecting Vero cells.
Example 7 cynomolgus monkey immunization experiment
Test animals and methods: by 107Recombinant virus rVSV-2019-nCoV (rVSV-SARS-CoV-2) prepared in example 1 of FFU 6 cynomolgus monkeys (3 males and females each, from Guangxi Male Primates laboratory animal Breeding and development Co., Ltd.) aged 2 to 6 years were inoculated by single nasal drip. Sera at day 14, day 21 and day 46 before, after immunization were taken for detection of neutralizing antibody titers, respectively.
The specific steps of the method for detecting the titer of the neutralizing antibody are as follows: vero cells were passaged in 96-well plates at 1.0 ten thousand cells per well. The next day the cells grew to around 80% -90% and were ready for testing. The serum is first diluted by a 5-fold dilution method, e.g., 1:10, 1:50, 1:250, 1: 1250. Simultaneously diluting rVSV-GFP-SARS-CoV-2 virus to 2X 103FFU/ml, resulting in a final number of 100FFU per well. Adding the diluted virus solution into each empty 96-well plate, and diluting the blood according to the corresponding dilution ratioThe same amount of the serum is added one by one, and then the serum is uniformly mixed, and the dilution times of the serum are correspondingly changed to two times of the original dilution times after the serum is uniformly mixed. After incubation at room temperature for 30min, 100. mu.l of the mixture was applied to the Vero cell layer. After 2 hours, the reaction solution was replaced with 20mM NH4Cl medium, after 24 hours the number of GFP positive cells in each well was read under a fluorescent microscope. Calculation of neutralizing antibody Titers (FRNT) according to Reed Muench method50). Calculating the formula: FRNT50＝【1/10】(less than 50% cell infection number dilution logarithm + distance ratio x dilution factor logarithm). Distance ratio (50% -less than 50% positive rate of cell infection number)/(more than 50% positive rate of cell infection number-less than 50% positive rate of cell infection number). The dilution coefficient is the multiple dilution gradient.
The rVSV-GFP-SARS-CoV-2(rVSV-GFP-2019-nCoV) was prepared as follows: 1) and inserting a GFP gene sequence shown as a sequence 14 in a sequence table between the 62 th nucleotide and the 63 rd nucleotide in the nucleotide sequence of the recombinant vector VSV-2019-nCoV to obtain the recombinant vector VSV-GFP-2019-nCoV. 2) A recombinant virus rVSV-GFP-SARS-CoV-2(rVSV-GFP-2019-nCoV) was prepared by replacing the recombinant vector VSV-2019-nCoV with the recombinant vector VSV-GFP-2019-nCoV according to the method in step two of example 1.
The results are shown in FIG. 6, where 3 out of 6 monkeys at 14 days after the single immunization had neutralized antibody titers of 1:1000 or more at 14 days after the vaccination. The sera of the other 3 monkeys also had a certain neutralizing activity with a titer of 1:327 to 1: 73. At 46 days post immunization, the neutralizing activity of the serum was reduced but a relatively high neutralizing antibody titer was maintained. These results demonstrate that recombinant virus rVSV-2019-nCoV (rVSV-SARS-CoV-2) stimulates high levels of SARS-CoV-2 neutralizing antibodies in monkeys.
Example 8 challenge experiment
Test animals and methods: cynomolgus monkeys 2-6 years old (male, from the company Limited, institute of biological resources, Chaojingxin) were divided into 2 groups (experimental and control), 2 each. Experimental group (immunization group) was 5X 106Recombinant virus rVSV-2019-nCoV (rVSV-SARS-CoV-2) prepared in example 1 of FFU was inoculated by single nasal drip and the control group was inoculated with an equal volume of PBS. 6 months after immunizationSARS-CoV-2 virus challenge experiment was carried out in Kunming animal institute of Chinese academy of sciences P3 laboratory with a dose of 1.0 × 107TCID50The mode of counteracting toxic pathogen is 40% nose drop (20%/nostril) + 60% trachea drop. Pharynx swab samples and anus swab samples were collected on day 0 before challenge and day 1, 3, 5, and 7 after challenge, respectively. Animals were euthanized on day 7 after challenge and lung tissue samples (7 lobes) were taken.
One Step TB Using the qRT-PCR method
Figure GDA0003276497080000101
PrimeScriptTMThe RT-PCR Kit (cat # RR066A, manufacturer: TaKaRa) Kit detected the viral load in each sample. The primer information is as follows:
N-F：CGGAGGATTGACGACTAATGC；
N-R：ACCATCCGAGCCATTCGA。
the reaction system is shown in Table 1.
TABLE 1 reaction System
Reagent Volume of
One Step TB Green RT-PCR BufferIII 5μl
TaKaRa Ex Taq HS(5U/μl) 0.2μl
PrimeScript RT enzyme MixII 0.2μl
PCR Forward Primer(10μM) 0.4μl
PCR Reverse Primer(10μM) 0.4μl
Total RNA 1μl
RNase Free dH2O 2.8μl
The reaction procedure is as follows:
(1) reverse transcription reaction: 5min at 42 ℃ and 10sec at 95 ℃.
(2) And (3) PCR reaction: the number of cycles: 40, 95 ℃ for 5sec, 60 ℃ for 30 sec.
The results are shown in FIGS. 7-9, where the virus load of pharyngeal swabs after challenge was 1-2 orders of magnitude lower in the experimental group than in the control group (FIG. 7). The results for anal swabs were also similar, with the viral loads on days 1, 5 and 7 of the experimental group after challenge being reduced by 2 orders of magnitude compared to the control group (fig. 8). At day 7 after challenge, the viral load in lung tissue was significantly reduced in the experimental group compared to the control group (fig. 9), and SARS-CoV-2 viral RNA was essentially undetectable in the lung. These results demonstrate that immunization with the recombinant virus rVSV-2019-nCoV (rVSV-SARS-CoV-2) is effective in protecting SARS-CoV-2 from infecting cynomolgus monkeys.
The foregoing is only a preferred embodiment of the present invention, and it should be noted that, for those skilled in the art, various modifications and decorations can be made without departing from the technical principle of the present invention, and these modifications and decorations should also be regarded as the protection scope of the present invention.
Sequence listing
<110> institute of animal research of Chinese academy of sciences
<120> novel recombinant coronavirus based on vesicular stomatitis virus vector, and preparation method and application thereof
<160>14
<170>PatentIn version 3.5
<210>1
<211>3822
<212>DNA
<213>Artificial Sequence
<400>1
atgttcgtgt tcctcgtgct cctgcctctg gtgtctagcc agtgcgtgaa cctgaccaca 60
cggacccagc tccctcccgc ctacacaaac tctttcaccc ggggcgtgta ctaccccgac 120
aaggtgttcc ggtctagcgt gctccactct acacaggacc tgttcctccc tttcttcagc 180
aacgtgacat ggttccacgc catccacgtg tctggcacaa acggcacaaa gcggttcgac 240
aaccccgtgc tccctttcaa cgacggcgtg tacttcgcca gcaccgagaa gtctaacatt 300
atccggggct ggattttcgg caccacactc gactctaaga cacagtccct cctgattgtg 360
aacaacgcca caaacgtggt gattaaggtg tgcgagttcc agttctgcaa cgaccctttc 420
ctgggcgtgt actaccacaa gaacaacaag tcttggatgg agtctgagtt cagagtgtac 480
tctagcgcca acaactgcac cttcgagtac gtgtcccagc ctttcctcat ggacctggag 540
ggcaagcagg gcaacttcaa gaacctgaga gagttcgtgt tcaagaacat tgacggctac 600
ttcaagattt actctaagca caccccaatt aacctcgtga gggacctccc tcagggcttc 660
tccgccttag aaccactggt ggacctccct attggcatta acatcacacg cttccagaca 720
ctgctcgccc tccaccggtc ttacctgacc ccaggcgact ctagctctgg ctggacagcc 780
ggcgccgccg cctactacgt gggctacctg cagcctagga ccttcctcct gaagtacaac 840
gagaacggca caattaccga cgccgtggac tgcgccctgg acccactgtc cgagacaaag 900
tgcacactga agtccttcac agtggagaag ggcatttacc agacatctaa cttccgggtg 960
cagcctacag agtctattgt gcggttccca aacatcacaa acctgtgccc tttcggcgag 1020
gtgttcaacg ccacccggtt cgcctctgtg tacgcctgga accggaagcg gatctctaac 1080
tgcgtggccg actactccgt gctgtacaac tccgcctctt tctctacatt caagtgctac 1140
ggcgtgtccc ctacaaagct gaacgacctg tgcttcacca acgtgtacgc cgactctttc 1200
gtgattagag gcgacgaggt gaggcagatt gcccccggcc agacaggcaa gatcgccgac 1260
tacaactaca agctgcccga cgacttcaca ggctgcgtga tcgcctggaa ctctaacaac 1320
ctggactcta aggtgggcgg caactacaac tacctgtaca gactgttccg gaagtctaac 1380
ctgaagccat tcgagaggga cattagcacc gagatttacc aggccggctc taccccatgc 1440
aacggcgtgg agggcttcaa ctgctacttc ccactgcagt cctacggctt ccagcctaca 1500
aacggcgtgg gctaccagcc ttaccgggtg gtggtgctgt ctttcgagct gctccacgcc 1560
cccgccacag tgtgcggccc aaagaagagc acaaacctcg tgaagaacaa gtgcgtgaac 1620
ttcaacttca acggcctcac aggcacaggc gtgctcaccg agtctaacaa gaagttcctc 1680
cctttccagc agttcggccg cgacattgcc gacaccaccg acgccgtgcg ggaccctcag 1740
acactggaaa ttctcgacat caccccttgc agcttcggcg gcgtgtccgt gatcacccca 1800
ggcacaaaca catctaacca ggtggccgtg ctgtaccagg acgtgaactg caccgaggtg 1860
ccagtggcca tccacgccga ccagctcacc ccaacatgga gggtgtacag cacaggctct 1920
aacgtgttcc agacccgggc cggctgcctc attggcgccg agcacgtgaa caactcttac 1980
gagtgcgaca tccctattgg cgccggcatt tgcgcctctt accagaccca gacaaactct 2040
ccacggagag cccggtctgt ggcctctcag agcattattg cctacaccat gtctctgggc 2100
gccgagaact ctgtggccta ctctaacaac tctattgcca tccctacaaa cttcacaatt 2160
tctgtgacca ccgagattct cccagtgtct atgaccaaga catctgtgga ctgcaccatg 2220
tacatttgcg gcgactccac cgagtgctct aacctcctgc tccagtacgg ctctttctgc 2280
acccagctca accgcgccct gacaggcatc gccgtggagc aggacaagaa cacccaggag 2340
gtgttcgccc aggtgaagca gatttacaag acccccccaa ttaaggactt cggcggcttc 2400
aacttctctc agattctccc cgacccatcc aagcctagca agcggtcctt cattgaggac 2460
ctcctgttca acaaggtgac actggccgac gccggcttca ttaagcagta cggcgactgc 2520
ctgggcgaca ttgccgcccg ggacctgatt tgcgcccaga agttcaacgg cctcacagtg 2580
ctccccccac tgctcaccga cgagatgatt gcccagtaca catctgccct cctggccggc 2640
acaattacat ctggctggac cttcggcgcc ggcgccgccc tgcagatccc tttcgccatg 2700
cagatggcct accgcttcaa cggcatcggc gtgacacaga acgtgctgta cgagaaccag 2760
aagctgatcg ccaaccagtt caacagcgcc attggcaaga ttcaggactc tctgagcagc 2820
acagccagcg ccctgggcaa gctgcaggac gtggtgaacc agaacgccca ggccctgaac 2880
acactggtga agcagctgtc ttctaacttc ggcgccattt ctagcgtgct gaacgacatt 2940
ctgtcgcggc tggacaaggt ggaggccgag gtgcagattg acaggctcat cacaggcaga 3000
ctgcagtctc tgcagacata cgtgacccag cagctgatta gagccgccga gattagagcc 3060
tccgccaacc tggccgccac caagatgagc gagtgcgtgc tcggccagtc taagcgggtg 3120
gacttctgcg gcaagggcta ccacctcatg tctttccctc agtccgcccc tcacggcgtg 3180
gtgttcctcc acgtgacata cgtgcccgcc caggagaaga acttcaccac agcccccgcc 3240
atttgccacg acggcaaggc ccacttccct agggagggcg tgttcgtgtc taacggcacc 3300
cactggttcg tgacccagcg gaacttctac gagcctcaga ttattaccac agacaacaca 3360
ttcgtgagcg gcaactgcga cgtggtgatt ggcattgtga acaacacagt gtacgaccca 3420
ctgcagcctg agttggactc tttcaaggag gaactcgaca agtacttcaa gaaccacaca 3480
tctcctgacg tggacctggg cgacattagc ggcattaacg cctctgtggt gaacattcag 3540
aaggagattg acagactgaa cgaggtggcc aagaacctga acgagtctct cattgacctg 3600
caggagctgg gcaagtacga gcagtacatt aagtggcctt ggtacatttg gctgggcttc 3660
attgccggcc tgatcgccat tgtgatggtg accatcatgc tgtgctgcat gacatcttgc 3720
tgcagctgcc tgaagggctg ctgctcttgc ggctcttgct gcaagttcga cgaggacgac 3780
tctgagcccg tgctgaaggg cgtgaagctc cactacacct ga 3822
<210>2
<211>1273
<212>PRT
<213>Artificial Sequence
<400>2
Met Phe Val Phe Leu Val Leu Leu Pro Leu Val Ser Ser Gln Cys Val
1 5 10 15
Asn Leu Thr Thr Arg Thr Gln Leu Pro Pro Ala Tyr Thr Asn Ser Phe
20 25 30
Thr Arg Gly Val Tyr Tyr Pro Asp Lys Val Phe Arg Ser Ser Val Leu
35 40 45
His Ser Thr Gln Asp Leu Phe Leu Pro Phe Phe Ser Asn Val Thr Trp
50 55 60
Phe His Ala Ile His Val Ser Gly Thr Asn Gly Thr Lys Arg Phe Asp
65 70 75 80
Asn Pro Val Leu Pro Phe Asn Asp Gly Val Tyr Phe Ala Ser Thr Glu
85 90 95
Lys Ser Asn Ile Ile Arg Gly Trp Ile Phe Gly Thr Thr Leu Asp Ser
100 105 110
Lys Thr Gln Ser Leu Leu Ile Val Asn Asn Ala Thr Asn Val Val Ile
115 120 125
Lys Val Cys Glu Phe Gln Phe Cys Asn Asp Pro Phe Leu Gly Val Tyr
130 135 140
Tyr His Lys Asn Asn Lys Ser Trp Met Glu Ser Glu Phe Arg Val Tyr
145 150 155 160
Ser Ser Ala Asn Asn Cys Thr Phe Glu Tyr Val Ser Gln Pro Phe Leu
165 170 175
Met Asp Leu Glu Gly Lys Gln Gly Asn Phe Lys Asn Leu Arg Glu Phe
180 185 190
Val Phe Lys Asn Ile Asp Gly Tyr Phe Lys Ile Tyr Ser Lys His Thr
195 200 205
Pro Ile Asn Leu Val Arg Asp Leu Pro Gln Gly Phe Ser Ala Leu Glu
210 215 220
Pro Leu Val Asp Leu Pro Ile Gly Ile Asn Ile Thr Arg Phe Gln Thr
225 230 235 240
Leu Leu Ala Leu His Arg Ser Tyr Leu Thr Pro Gly Asp Ser Ser Ser
245 250 255
Gly Trp Thr Ala Gly Ala Ala Ala Tyr Tyr Val Gly Tyr Leu Gln Pro
260 265 270
Arg Thr Phe Leu Leu Lys Tyr Asn Glu Asn Gly Thr Ile Thr Asp Ala
275 280 285
Val Asp Cys Ala Leu Asp Pro Leu Ser Glu Thr Lys Cys Thr Leu Lys
290 295 300
Ser Phe Thr Val Glu Lys Gly Ile Tyr Gln Thr Ser Asn Phe Arg Val
305 310 315 320
Gln Pro Thr Glu Ser Ile Val Arg Phe Pro Asn Ile Thr Asn Leu Cys
325 330 335
Pro Phe Gly Glu Val Phe Asn Ala Thr Arg Phe Ala Ser Val Tyr Ala
340 345 350
Trp Asn Arg Lys Arg Ile Ser Asn Cys Val Ala Asp Tyr Ser Val Leu
355 360 365
Tyr Asn Ser Ala Ser Phe Ser Thr Phe Lys Cys Tyr Gly Val Ser Pro
370 375 380
Thr Lys Leu Asn Asp Leu Cys Phe Thr Asn Val Tyr Ala Asp Ser Phe
385 390 395 400
Val Ile Arg Gly Asp Glu Val Arg Gln Ile Ala Pro Gly Gln Thr Gly
405 410 415
Lys Ile Ala Asp Tyr Asn Tyr Lys Leu Pro Asp Asp Phe Thr Gly Cys
420 425 430
Val Ile Ala Trp Asn Ser Asn Asn Leu Asp Ser Lys Val Gly Gly Asn
435 440 445
Tyr Asn Tyr Leu Tyr Arg Leu Phe Arg Lys Ser Asn Leu Lys Pro Phe
450 455 460
Glu Arg Asp Ile Ser Thr Glu Ile Tyr Gln Ala Gly Ser Thr Pro Cys
465 470 475 480
Asn Gly Val Glu Gly Phe Asn Cys Tyr Phe Pro Leu Gln Ser Tyr Gly
485 490 495
Phe Gln Pro Thr Asn Gly Val Gly Tyr Gln Pro Tyr Arg Val Val Val
500 505 510
Leu Ser Phe Glu Leu Leu His Ala Pro Ala Thr Val Cys Gly Pro Lys
515 520 525
Lys Ser Thr Asn Leu Val Lys Asn Lys Cys Val Asn Phe Asn Phe Asn
530 535 540
Gly Leu Thr Gly Thr Gly Val Leu Thr Glu Ser Asn Lys Lys Phe Leu
545 550 555 560
Pro Phe Gln Gln Phe Gly Arg Asp Ile Ala Asp Thr Thr Asp Ala Val
565 570 575
Arg Asp Pro Gln Thr Leu Glu Ile Leu Asp Ile Thr Pro Cys Ser Phe
580 585 590
Gly Gly Val Ser Val Ile Thr Pro Gly Thr Asn Thr Ser Asn Gln Val
595 600 605
Ala Val Leu Tyr Gln Asp Val Asn Cys Thr Glu Val Pro Val Ala Ile
610 615 620
His Ala Asp Gln Leu Thr Pro Thr Trp Arg Val Tyr Ser Thr Gly Ser
625 630 635 640
Asn Val Phe Gln Thr Arg Ala Gly Cys Leu Ile Gly Ala Glu His Val
645 650 655
Asn Asn Ser Tyr Glu Cys Asp Ile Pro Ile Gly Ala Gly Ile Cys Ala
660 665 670
Ser Tyr Gln Thr Gln Thr Asn Ser Pro Arg Arg Ala Arg Ser Val Ala
675 680 685
Ser Gln Ser Ile Ile Ala Tyr Thr Met Ser Leu Gly Ala Glu Asn Ser
690 695 700
Val Ala Tyr Ser Asn Asn Ser Ile Ala Ile Pro Thr Asn Phe Thr Ile
705 710 715 720
Ser Val Thr Thr Glu Ile Leu Pro Val Ser Met Thr Lys Thr Ser Val
725 730 735
Asp Cys Thr Met Tyr Ile Cys Gly Asp Ser Thr Glu Cys Ser Asn Leu
740 745 750
Leu Leu Gln Tyr Gly Ser Phe Cys Thr Gln Leu Asn Arg Ala Leu Thr
755 760 765
Gly Ile Ala Val Glu Gln Asp Lys Asn Thr Gln Glu Val Phe Ala Gln
770 775 780
Val Lys Gln Ile Tyr Lys Thr Pro Pro Ile Lys Asp Phe Gly Gly Phe
785 790 795 800
Asn Phe Ser Gln Ile Leu Pro Asp Pro Ser Lys Pro Ser Lys Arg Ser
805 810 815
Phe Ile Glu Asp Leu Leu Phe Asn Lys Val Thr Leu Ala Asp Ala Gly
820 825 830
Phe Ile Lys Gln Tyr Gly Asp Cys Leu Gly Asp Ile Ala Ala Arg Asp
835 840 845
Leu Ile Cys Ala Gln Lys Phe Asn Gly Leu Thr Val Leu Pro Pro Leu
850 855 860
Leu Thr Asp Glu Met Ile Ala Gln Tyr Thr Ser Ala Leu Leu Ala Gly
865 870 875 880
Thr Ile Thr Ser Gly Trp Thr Phe Gly Ala Gly Ala Ala Leu Gln Ile
885 890 895
Pro Phe Ala Met Gln Met Ala Tyr Arg Phe Asn Gly Ile Gly Val Thr
900 905 910
Gln Asn Val Leu Tyr Glu Asn Gln Lys Leu Ile Ala Asn Gln Phe Asn
915 920 925
Ser Ala Ile Gly Lys Ile Gln Asp Ser Leu Ser Ser Thr Ala Ser Ala
930 935 940
Leu Gly Lys Leu Gln Asp Val Val Asn Gln Asn Ala Gln Ala Leu Asn
945 950 955 960
Thr Leu Val Lys Gln Leu Ser Ser Asn Phe Gly Ala Ile Ser Ser Val
965 970 975
Leu Asn Asp Ile Leu Ser Arg Leu Asp Lys Val Glu Ala Glu Val Gln
980 985 990
Ile Asp Arg Leu Ile Thr Gly Arg Leu Gln Ser Leu Gln Thr Tyr Val
995 1000 1005
Thr Gln Gln Leu Ile Arg Ala Ala Glu Ile Arg Ala Ser Ala Asn
1010 1015 1020
Leu Ala Ala Thr Lys Met Ser Glu Cys Val Leu Gly Gln Ser Lys
1025 1030 1035
Arg Val Asp Phe Cys Gly Lys Gly Tyr His Leu Met Ser Phe Pro
1040 1045 1050
Gln Ser Ala Pro His Gly Val Val Phe Leu His Val Thr Tyr Val
1055 1060 1065
Pro Ala Gln Glu Lys Asn Phe Thr Thr Ala Pro Ala Ile Cys His
1070 1075 1080
Asp Gly Lys Ala His Phe Pro Arg Glu Gly Val Phe Val Ser Asn
1085 1090 1095
Gly Thr His Trp Phe Val Thr Gln Arg Asn Phe Tyr Glu Pro Gln
1100 1105 1110
Ile Ile Thr Thr Asp Asn Thr Phe Val Ser Gly Asn Cys Asp Val
1115 1120 1125
Val Ile Gly Ile Val Asn Asn Thr Val Tyr Asp Pro Leu Gln Pro
1130 1135 1140
Glu Leu Asp Ser Phe Lys Glu Glu Leu Asp Lys Tyr Phe Lys Asn
1145 1150 1155
His Thr Ser Pro Asp Val Asp Leu Gly Asp Ile Ser Gly Ile Asn
1160 1165 1170
Ala Ser Val Val Asn Ile Gln Lys Glu Ile Asp Arg Leu Asn Glu
1175 1180 1185
Val Ala Lys Asn Leu Asn Glu Ser Leu Ile Asp Leu Gln Glu Leu
1190 1195 1200
Gly Lys Tyr Glu Gln Tyr Ile Lys Trp Pro Trp Tyr Ile Trp Leu
1205 1210 1215
Gly Phe Ile Ala Gly Leu Ile Ala Ile Val Met Val Thr Ile Met
1220 1225 1230
Leu Cys Cys Met Thr Ser Cys Cys Ser Cys Leu Lys Gly Cys Cys
1235 1240 1245
Ser Cys Gly Ser Cys Cys Lys Phe Asp Glu Asp Asp Ser Glu Pro
1250 1255 1260
Val Leu Lys Gly Val Lys Leu His Tyr Thr
1265 1270
<210>3
<211>3864
<212>DNA
<213>Artificial Sequence
<400>3
atgttcgtgt tcctcgtgct cctgcctctg gtgtctagcc agtgcgtgaa cctgaccaca 60
cggacccagc tccctcccgc ctacacaaac tctttcaccc ggggcgtgta ctaccccgac 120
aaggtgttcc ggtctagcgt gctccactct acacaggacc tgttcctccc tttcttcagc 180
aacgtgacat ggttccacgc catccacgtg tctggcacaa acggcacaaa gcggttcgac 240
aaccccgtgc tccctttcaa cgacggcgtg tacttcgcca gcaccgagaa gtctaacatt 300
atccggggct ggattttcgg caccacactc gactctaaga cacagtccct cctgattgtg 360
aacaacgcca caaacgtggt gattaaggtg tgcgagttcc agttctgcaa cgaccctttc 420
ctgggcgtgt actaccacaa gaacaacaag tcttggatgg agtctgagtt cagagtgtac 480
tctagcgcca acaactgcac cttcgagtac gtgtcccagc ctttcctcat ggacctggag 540
ggcaagcagg gcaacttcaa gaacctgaga gagttcgtgt tcaagaacat tgacggctac 600
ttcaagattt actctaagca caccccaatt aacctcgtga gggacctccc tcagggcttc 660
tccgccttag aaccactggt ggacctccct attggcatta acatcacacg cttccagaca 720
ctgctcgccc tccaccggtc ttacctgacc ccaggcgact ctagctctgg ctggacagcc 780
ggcgccgccg cctactacgt gggctacctg cagcctagga ccttcctcct gaagtacaac 840
gagaacggca caattaccga cgccgtggac tgcgccctgg acccactgtc cgagacaaag 900
tgcacactga agtccttcac agtggagaag ggcatttacc agacatctaa cttccgggtg 960
cagcctacag agtctattgt gcggttccca aacatcacaa acctgtgccc tttcggcgag 1020
gtgttcaacg ccacccggtt cgcctctgtg tacgcctgga accggaagcg gatctctaac 1080
tgcgtggccg actactccgt gctgtacaac tccgcctctt tctctacatt caagtgctac 1140
ggcgtgtccc ctacaaagct gaacgacctg tgcttcacca acgtgtacgc cgactctttc 1200
gtgattagag gcgacgaggt gaggcagatt gcccccggcc agacaggcaa gatcgccgac 1260
tacaactaca agctgcccga cgacttcaca ggctgcgtga tcgcctggaa ctctaacaac 1320
ctggactcta aggtgggcgg caactacaac tacctgtaca gactgttccg gaagtctaac 1380
ctgaagccat tcgagaggga cattagcacc gagatttacc aggccggctc taccccatgc 1440
aacggcgtgg agggcttcaa ctgctacttc ccactgcagt cctacggctt ccagcctaca 1500
aacggcgtgg gctaccagcc ttaccgggtg gtggtgctgt ctttcgagct gctccacgcc 1560
cccgccacag tgtgcggccc aaagaagagc acaaacctcg tgaagaacaa gtgcgtgaac 1620
ttcaacttca acggcctcac aggcacaggc gtgctcaccg agtctaacaa gaagttcctc 1680
cctttccagc agttcggccg cgacattgcc gacaccaccg acgccgtgcg ggaccctcag 1740
acactggaaa ttctcgacat caccccttgc agcttcggcg gcgtgtccgt gatcacccca 1800
ggcacaaaca catctaacca ggtggccgtg ctgtaccagg acgtgaactg caccgaggtg 1860
ccagtggcca tccacgccga ccagctcacc ccaacatgga gggtgtacag cacaggctct 1920
aacgtgttcc agacccgggc cggctgcctc attggcgccg agcacgtgaa caactcttac 1980
gagtgcgaca tccctattgg cgccggcatt tgcgcctctt accagaccca gacaaactct 2040
ccacggagag cccggtctgt ggcctctcag agcattattg cctacaccat gtctctgggc 2100
gccgagaact ctgtggccta ctctaacaac tctattgcca tccctacaaa cttcacaatt 2160
tctgtgacca ccgagattct cccagtgtct atgaccaaga catctgtgga ctgcaccatg 2220
tacatttgcg gcgactccac cgagtgctct aacctcctgc tccagtacgg ctctttctgc 2280
acccagctca accgcgccct gacaggcatc gccgtggagc aggacaagaa cacccaggag 2340
gtgttcgccc aggtgaagca gatttacaag acccccccaa ttaaggactt cggcggcttc 2400
aacttctctc agattctccc cgacccatcc aagcctagca agcggtcctt cattgaggac 2460
ctcctgttca acaaggtgac actggccgac gccggcttca ttaagcagta cggcgactgc 2520
ctgggcgaca ttgccgcccg ggacctgatt tgcgcccaga agttcaacgg cctcacagtg 2580
ctccccccac tgctcaccga cgagatgatt gcccagtaca catctgccct cctggccggc 2640
acaattacat ctggctggac cttcggcgcc ggcgccgccc tgcagatccc tttcgccatg 2700
cagatggcct accgcttcaa cggcatcggc gtgacacaga acgtgctgta cgagaaccag 2760
aagctgatcg ccaaccagtt caacagcgcc attggcaaga ttcaggactc tctgagcagc 2820
acagccagcg ccctgggcaa gctgcaggac gtggtgaacc agaacgccca ggccctgaac 2880
acactggtga agcagctgtc ttctaacttc ggcgccattt ctagcgtgct gaacgacatt 2940
ctgtcgcggc tggacaaggt ggaggccgag gtgcagattg acaggctcat cacaggcaga 3000
ctgcagtctc tgcagacata cgtgacccag cagctgatta gagccgccga gattagagcc 3060
tccgccaacc tggccgccac caagatgagc gagtgcgtgc tcggccagtc taagcgggtg 3120
gacttctgcg gcaagggcta ccacctcatg tctttccctc agtccgcccc tcacggcgtg 3180
gtgttcctcc acgtgacata cgtgcccgcc caggagaaga acttcaccac agcccccgcc 3240
atttgccacg acggcaaggc ccacttccct agggagggcg tgttcgtgtc taacggcacc 3300
cactggttcg tgacccagcg gaacttctac gagcctcaga ttattaccac agacaacaca 3360
ttcgtgagcg gcaactgcga cgtggtgatt ggcattgtga acaacacagt gtacgaccca 3420
ctgcagcctg agttggactc tttcaaggag gaactcgaca agtacttcaa gaaccacaca 3480
tctcctgacg tggacctggg cgacattagc ggcattaacg cctctgtggt gaacattcag 3540
aaggagattg acagactgaa cgaggtggcc aagaacctga acgagtctct cattgacctg 3600
caggagctgg gcaagtacga gcagtacatt aagtggccct ggtacgtgtg gctgggcttc 3660
atcgccggcc tgatcgccat cgtgatggtg accatcctgc tgtgctgcat gaccagctgc 3720
tgcagctgcc tgaagagact caaaaggtca atgctaatgg gtaatccaga tgaccgtata 3780
ccgagggaca catatacatt agagccgaag atcagacata tgtacacaaa cggtgggttt 3840
gatgcgatgg ctgagaaaag atga 3864
<210>4
<211>1287
<212>PRT
<213>Artificial Sequence
<400>4
Met Phe Val Phe Leu Val Leu Leu Pro Leu Val Ser Ser Gln Cys Val
1 5 10 15
Asn Leu Thr Thr Arg Thr Gln Leu Pro Pro Ala Tyr Thr Asn Ser Phe
20 25 30
Thr Arg Gly Val Tyr Tyr Pro Asp Lys Val Phe Arg Ser Ser Val Leu
35 40 45
His Ser Thr Gln Asp Leu Phe Leu Pro Phe Phe Ser Asn Val Thr Trp
50 55 60
Phe His Ala Ile His Val Ser Gly Thr Asn Gly Thr Lys Arg Phe Asp
65 70 75 80
Asn Pro Val Leu Pro Phe Asn Asp Gly Val Tyr Phe Ala Ser Thr Glu
85 90 95
Lys Ser Asn Ile Ile Arg Gly Trp Ile Phe Gly Thr Thr Leu Asp Ser
100 105 110
Lys Thr Gln Ser Leu Leu Ile Val Asn Asn Ala Thr Asn Val Val Ile
115 120 125
Lys Val Cys Glu Phe Gln Phe Cys Asn Asp Pro Phe Leu Gly Val Tyr
130 135 140
Tyr His Lys Asn Asn Lys Ser Trp Met Glu Ser Glu Phe Arg Val Tyr
145 150 155 160
Ser Ser Ala Asn Asn Cys Thr Phe Glu Tyr Val Ser Gln Pro Phe Leu
165 170 175
Met Asp Leu Glu Gly Lys Gln Gly Asn Phe Lys Asn Leu Arg Glu Phe
180 185 190
Val Phe Lys Asn Ile Asp Gly Tyr Phe Lys Ile Tyr Ser Lys His Thr
195 200 205
Pro Ile Asn Leu Val Arg Asp Leu Pro Gln Gly Phe Ser Ala Leu Glu
210 215 220
Pro Leu Val Asp Leu Pro Ile Gly Ile Asn Ile Thr Arg Phe Gln Thr
225 230 235 240
Leu Leu Ala Leu His Arg Ser Tyr Leu Thr Pro Gly Asp Ser Ser Ser
245 250 255
Gly Trp Thr Ala Gly Ala Ala Ala Tyr Tyr Val Gly Tyr Leu Gln Pro
260 265 270
Arg Thr Phe Leu Leu Lys Tyr Asn Glu Asn Gly Thr Ile Thr Asp Ala
275 280 285
Val Asp Cys Ala Leu Asp Pro Leu Ser Glu Thr Lys Cys Thr Leu Lys
290 295 300
Ser Phe Thr Val Glu Lys Gly Ile Tyr Gln Thr Ser Asn Phe Arg Val
305 310 315 320
Gln Pro Thr Glu Ser Ile Val Arg Phe Pro Asn Ile Thr Asn Leu Cys
325 330 335
Pro Phe Gly Glu Val Phe Asn Ala Thr Arg Phe Ala Ser Val Tyr Ala
340 345 350
Trp Asn Arg Lys Arg Ile Ser Asn Cys Val Ala Asp Tyr Ser Val Leu
355 360 365
Tyr Asn Ser Ala Ser Phe Ser Thr Phe Lys Cys Tyr Gly Val Ser Pro
370 375 380
Thr Lys Leu Asn Asp Leu Cys Phe Thr Asn Val Tyr Ala Asp Ser Phe
385 390 395 400
Val Ile Arg Gly Asp Glu Val Arg Gln Ile Ala Pro Gly Gln Thr Gly
405 410 415
Lys Ile Ala Asp Tyr Asn Tyr Lys Leu Pro Asp Asp Phe Thr Gly Cys
420 425 430
Val Ile Ala Trp Asn Ser Asn Asn Leu Asp Ser Lys Val Gly Gly Asn
435 440 445
Tyr Asn Tyr Leu Tyr Arg Leu Phe Arg Lys Ser Asn Leu Lys Pro Phe
450 455 460
Glu Arg Asp Ile Ser Thr Glu Ile Tyr Gln Ala Gly Ser Thr Pro Cys
465 470 475 480
Asn Gly Val Glu Gly Phe Asn Cys Tyr Phe Pro Leu Gln Ser Tyr Gly
485 490 495
Phe Gln Pro Thr Asn Gly Val Gly Tyr Gln Pro Tyr Arg Val Val Val
500 505 510
Leu Ser Phe Glu Leu Leu His Ala Pro Ala Thr Val Cys Gly Pro Lys
515 520 525
Lys Ser Thr Asn Leu Val Lys Asn Lys Cys Val Asn Phe Asn Phe Asn
530 535 540
Gly Leu Thr Gly Thr Gly Val Leu Thr Glu Ser Asn Lys Lys Phe Leu
545 550 555 560
Pro Phe Gln Gln Phe Gly Arg Asp Ile Ala Asp Thr Thr Asp Ala Val
565 570 575
Arg Asp Pro Gln Thr Leu Glu Ile Leu Asp Ile Thr Pro Cys Ser Phe
580 585 590
Gly Gly Val Ser Val Ile Thr Pro Gly Thr Asn Thr Ser Asn Gln Val
595 600 605
Ala Val Leu Tyr Gln Asp Val Asn Cys Thr Glu Val Pro Val Ala Ile
610 615 620
His Ala Asp Gln Leu Thr Pro Thr Trp Arg Val Tyr Ser Thr Gly Ser
625 630 635 640
Asn Val Phe Gln Thr Arg Ala Gly Cys Leu Ile Gly Ala Glu His Val
645 650 655
Asn Asn Ser Tyr Glu Cys Asp Ile Pro Ile Gly Ala Gly Ile Cys Ala
660 665 670
Ser Tyr Gln Thr Gln Thr Asn Ser Pro Arg Arg Ala Arg Ser Val Ala
675 680 685
Ser Gln Ser Ile Ile Ala Tyr Thr Met Ser Leu Gly Ala Glu Asn Ser
690 695 700
Val Ala Tyr Ser Asn Asn Ser Ile Ala Ile Pro Thr Asn Phe Thr Ile
705 710 715 720
Ser Val Thr Thr Glu Ile Leu Pro Val Ser Met Thr Lys Thr Ser Val
725 730 735
Asp Cys Thr Met Tyr Ile Cys Gly Asp Ser Thr Glu Cys Ser Asn Leu
740 745 750
Leu Leu Gln Tyr Gly Ser Phe Cys Thr Gln Leu Asn Arg Ala Leu Thr
755 760 765
Gly Ile Ala Val Glu Gln Asp Lys Asn Thr Gln Glu Val Phe Ala Gln
770 775 780
Val Lys Gln Ile Tyr Lys Thr Pro Pro Ile Lys Asp Phe Gly Gly Phe
785 790 795 800
Asn Phe Ser Gln Ile Leu Pro Asp Pro Ser Lys Pro Ser Lys Arg Ser
805 810 815
Phe Ile Glu Asp Leu Leu Phe Asn Lys Val Thr Leu Ala Asp Ala Gly
820 825 830
Phe Ile Lys Gln Tyr Gly Asp Cys Leu Gly Asp Ile Ala Ala Arg Asp
835 840 845
Leu Ile Cys Ala Gln Lys Phe Asn Gly Leu Thr Val Leu Pro Pro Leu
850 855 860
Leu Thr Asp Glu Met Ile Ala Gln Tyr Thr Ser Ala Leu Leu Ala Gly
865 870 875 880
Thr Ile Thr Ser Gly Trp Thr Phe Gly Ala Gly Ala Ala Leu Gln Ile
885 890 895
Pro Phe Ala Met Gln Met Ala Tyr Arg Phe Asn Gly Ile Gly Val Thr
900 905 910
Gln Asn Val Leu Tyr Glu Asn Gln Lys Leu Ile Ala Asn Gln Phe Asn
915 920 925
Ser Ala Ile Gly Lys Ile Gln Asp Ser Leu Ser Ser Thr Ala Ser Ala
930 935 940
Leu Gly Lys Leu Gln Asp Val Val Asn Gln Asn Ala Gln Ala Leu Asn
945 950 955 960
Thr Leu Val Lys Gln Leu Ser Ser Asn Phe Gly Ala Ile Ser Ser Val
965 970 975
Leu Asn Asp Ile Leu Ser Arg Leu Asp Lys Val Glu Ala Glu Val Gln
980 985 990
Ile Asp Arg Leu Ile Thr Gly Arg Leu Gln Ser Leu Gln Thr Tyr Val
995 1000 1005
Thr Gln Gln Leu Ile Arg Ala Ala Glu Ile Arg Ala Ser Ala Asn
1010 1015 1020
Leu Ala Ala Thr Lys Met Ser Glu Cys Val Leu Gly Gln Ser Lys
1025 1030 1035
Arg Val Asp Phe Cys Gly Lys Gly Tyr His Leu Met Ser Phe Pro
1040 1045 1050
Gln Ser Ala Pro His Gly Val Val Phe Leu His Val Thr Tyr Val
1055 1060 1065
Pro Ala Gln Glu Lys Asn Phe Thr Thr Ala Pro Ala Ile Cys His
1070 1075 1080
Asp Gly Lys Ala His Phe Pro Arg Glu Gly Val Phe Val Ser Asn
1085 1090 1095
Gly Thr His Trp Phe Val Thr Gln Arg Asn Phe Tyr Glu Pro Gln
1100 1105 1110
Ile Ile Thr Thr Asp Asn Thr Phe Val Ser Gly Asn Cys Asp Val
1115 1120 1125
Val Ile Gly Ile Val Asn Asn Thr Val Tyr Asp Pro Leu Gln Pro
1130 1135 1140
Glu Leu Asp Ser Phe Lys Glu Glu Leu Asp Lys Tyr Phe Lys Asn
1145 1150 1155
His Thr Ser Pro Asp Val Asp Leu Gly Asp Ile Ser Gly Ile Asn
1160 1165 1170
Ala Ser Val Val Asn Ile Gln Lys Glu Ile Asp Arg Leu Asn Glu
1175 1180 1185
Val Ala Lys Asn Leu Asn Glu Ser Leu Ile Asp Leu Gln Glu Leu
1190 1195 1200
Gly Lys Tyr Glu Gln Tyr Ile Lys Trp Pro Trp Tyr Val Trp Leu
1205 1210 1215
Gly Phe Ile Ala Gly Leu Ile Ala Ile Val Met Val Thr Ile Leu
1220 1225 1230
Leu Cys Cys Met Thr Ser Cys Cys Ser Cys Leu Lys Arg Leu Lys
1235 1240 1245
Arg Ser Met Leu Met Gly Asn Pro Asp Asp Arg Ile Pro Arg Asp
1250 1255 1260
Thr Tyr Thr Leu Glu Pro Lys Ile Arg His Met Tyr Thr Asn Gly
1265 1270 1275
Gly Phe Asp Ala Met Ala Glu Lys Arg
1280 1285
<210>5
<211>3765
<212>DNA
<213>Artificial Sequence
<400>5
atgttcgtgt tcctcgtgct cctgcctctg gtgtctagcc agtgcgtgaa cctgaccaca 60
cggacccagc tccctcccgc ctacacaaac tctttcaccc ggggcgtgta ctaccccgac 120
aaggtgttcc ggtctagcgt gctccactct acacaggacc tgttcctccc tttcttcagc 180
aacgtgacat ggttccacgc catccacgtg tctggcacaa acggcacaaa gcggttcgac 240
aaccccgtgc tccctttcaa cgacggcgtg tacttcgcca gcaccgagaa gtctaacatt 300
atccggggct ggattttcgg caccacactc gactctaaga cacagtccct cctgattgtg 360
aacaacgcca caaacgtggt gattaaggtg tgcgagttcc agttctgcaa cgaccctttc 420
ctgggcgtgt actaccacaa gaacaacaag tcttggatgg agtctgagtt cagagtgtac 480
tctagcgcca acaactgcac cttcgagtac gtgtcccagc ctttcctcat ggacctggag 540
ggcaagcagg gcaacttcaa gaacctgaga gagttcgtgt tcaagaacat tgacggctac 600
ttcaagattt actctaagca caccccaatt aacctcgtga gggacctccc tcagggcttc 660
tccgccttag aaccactggt ggacctccct attggcatta acatcacacg cttccagaca 720
ctgctcgccc tccaccggtc ttacctgacc ccaggcgact ctagctctgg ctggacagcc 780
ggcgccgccg cctactacgt gggctacctg cagcctagga ccttcctcct gaagtacaac 840
gagaacggca caattaccga cgccgtggac tgcgccctgg acccactgtc cgagacaaag 900
tgcacactga agtccttcac agtggagaag ggcatttacc agacatctaa cttccgggtg 960
cagcctacag agtctattgt gcggttccca aacatcacaa acctgtgccc tttcggcgag 1020
gtgttcaacg ccacccggtt cgcctctgtg tacgcctgga accggaagcg gatctctaac 1080
tgcgtggccg actactccgt gctgtacaac tccgcctctt tctctacatt caagtgctac 1140
ggcgtgtccc ctacaaagct gaacgacctg tgcttcacca acgtgtacgc cgactctttc 1200
gtgattagag gcgacgaggt gaggcagatt gcccccggcc agacaggcaa gatcgccgac 1260
tacaactaca agctgcccga cgacttcaca ggctgcgtga tcgcctggaa ctctaacaac 1320
ctggactcta aggtgggcgg caactacaac tacctgtaca gactgttccg gaagtctaac 1380
ctgaagccat tcgagaggga cattagcacc gagatttacc aggccggctc taccccatgc 1440
aacggcgtgg agggcttcaa ctgctacttc ccactgcagt cctacggctt ccagcctaca 1500
aacggcgtgg gctaccagcc ttaccgggtg gtggtgctgt ctttcgagct gctccacgcc 1560
cccgccacag tgtgcggccc aaagaagagc acaaacctcg tgaagaacaa gtgcgtgaac 1620
ttcaacttca acggcctcac aggcacaggc gtgctcaccg agtctaacaa gaagttcctc 1680
cctttccagc agttcggccg cgacattgcc gacaccaccg acgccgtgcg ggaccctcag 1740
acactggaaa ttctcgacat caccccttgc agcttcggcg gcgtgtccgt gatcacccca 1800
ggcacaaaca catctaacca ggtggccgtg ctgtaccagg acgtgaactg caccgaggtg 1860
ccagtggcca tccacgccga ccagctcacc ccaacatgga gggtgtacag cacaggctct 1920
aacgtgttcc agacccgggc cggctgcctc attggcgccg agcacgtgaa caactcttac 1980
gagtgcgaca tccctattgg cgccggcatt tgcgcctctt accagaccca gacaaactct 2040
ccacggagag cccggtctgt ggcctctcag agcattattg cctacaccat gtctctgggc 2100
gccgagaact ctgtggccta ctctaacaac tctattgcca tccctacaaa cttcacaatt 2160
tctgtgacca ccgagattct cccagtgtct atgaccaaga catctgtgga ctgcaccatg 2220
tacatttgcg gcgactccac cgagtgctct aacctcctgc tccagtacgg ctctttctgc 2280
acccagctca accgcgccct gacaggcatc gccgtggagc aggacaagaa cacccaggag 2340
gtgttcgccc aggtgaagca gatttacaag acccccccaa ttaaggactt cggcggcttc 2400
aacttctctc agattctccc cgacccatcc aagcctagca agcggtcctt cattgaggac 2460
ctcctgttca acaaggtgac actggccgac gccggcttca ttaagcagta cggcgactgc 2520
ctgggcgaca ttgccgcccg ggacctgatt tgcgcccaga agttcaacgg cctcacagtg 2580
ctccccccac tgctcaccga cgagatgatt gcccagtaca catctgccct cctggccggc 2640
acaattacat ctggctggac cttcggcgcc ggcgccgccc tgcagatccc tttcgccatg 2700
cagatggcct accgcttcaa cggcatcggc gtgacacaga acgtgctgta cgagaaccag 2760
aagctgatcg ccaaccagtt caacagcgcc attggcaaga ttcaggactc tctgagcagc 2820
acagccagcg ccctgggcaa gctgcaggac gtggtgaacc agaacgccca ggccctgaac 2880
acactggtga agcagctgtc ttctaacttc ggcgccattt ctagcgtgct gaacgacatt 2940
ctgtcgcggc tggacaaggt ggaggccgag gtgcagattg acaggctcat cacaggcaga 3000
ctgcagtctc tgcagacata cgtgacccag cagctgatta gagccgccga gattagagcc 3060
tccgccaacc tggccgccac caagatgagc gagtgcgtgc tcggccagtc taagcgggtg 3120
gacttctgcg gcaagggcta ccacctcatg tctttccctc agtccgcccc tcacggcgtg 3180
gtgttcctcc acgtgacata cgtgcccgcc caggagaaga acttcaccac agcccccgcc 3240
atttgccacg acggcaaggc ccacttccct agggagggcg tgttcgtgtc taacggcacc 3300
cactggttcg tgacccagcg gaacttctac gagcctcaga ttattaccac agacaacaca 3360
ttcgtgagcg gcaactgcga cgtggtgatt ggcattgtga acaacacagt gtacgaccca 3420
ctgcagcctg agttggactc tttcaaggag gaactcgaca agtacttcaa gaaccacaca 3480
tctcctgacg tggacctggg cgacattagc ggcattaacg cctctgtggt gaacattcag 3540
aaggagattg acagactgaa cgaggtggcc aagaacctga acgagtctct cattgacctg 3600
caggagctgg gcaagtacga gcagtacatt ttttgcttta tcatagggtt aatcattgga 3660
ctattcttgg ttctccgagt tggtatttat ctttgcatta aattaaagca caccaagaaa 3720
agacagattt atacagacat agagatgaac cgacttggaa agtga 3765
<210>6
<211>1254
<212>PRT
<213>Artificial Sequence
<400>6
Met Phe Val Phe Leu Val Leu Leu Pro Leu Val Ser Ser Gln Cys Val
1 5 10 15
Asn Leu Thr Thr Arg Thr Gln Leu Pro Pro Ala Tyr Thr Asn Ser Phe
20 25 30
Thr Arg Gly Val Tyr Tyr Pro Asp Lys Val Phe Arg Ser Ser Val Leu
35 40 45
His Ser Thr Gln Asp Leu Phe Leu Pro Phe Phe Ser Asn Val Thr Trp
50 55 60
Phe His Ala Ile His Val Ser Gly Thr Asn Gly Thr Lys Arg Phe Asp
65 70 75 80
Asn Pro Val Leu Pro Phe Asn Asp Gly Val Tyr Phe Ala Ser Thr Glu
85 90 95
Lys Ser Asn Ile Ile Arg Gly Trp Ile Phe Gly Thr Thr Leu Asp Ser
100 105 110
Lys Thr Gln Ser Leu Leu Ile Val Asn Asn Ala Thr Asn Val Val Ile
115 120 125
Lys Val Cys Glu Phe Gln Phe Cys Asn Asp Pro Phe Leu Gly Val Tyr
130 135 140
Tyr His Lys Asn Asn Lys Ser Trp Met Glu Ser Glu Phe Arg Val Tyr
145 150 155 160
Ser Ser Ala Asn Asn Cys Thr Phe Glu Tyr Val Ser Gln Pro Phe Leu
165 170 175
Met Asp Leu Glu Gly Lys Gln Gly Asn Phe Lys Asn Leu Arg Glu Phe
180 185 190
Val Phe Lys Asn Ile Asp Gly Tyr Phe Lys Ile Tyr Ser Lys His Thr
195 200 205
Pro Ile Asn Leu Val Arg Asp Leu Pro Gln Gly Phe Ser Ala Leu Glu
210 215 220
Pro Leu Val Asp Leu Pro Ile Gly Ile Asn Ile Thr Arg Phe Gln Thr
225 230 235 240
Leu Leu Ala Leu His Arg Ser Tyr Leu Thr Pro Gly Asp Ser Ser Ser
245 250 255
Gly Trp Thr Ala Gly Ala Ala Ala Tyr Tyr Val Gly Tyr Leu Gln Pro
260 265 270
Arg Thr Phe Leu Leu Lys Tyr Asn Glu Asn Gly Thr Ile Thr Asp Ala
275 280 285
Val Asp Cys Ala Leu Asp Pro Leu Ser Glu Thr Lys Cys Thr Leu Lys
290 295 300
Ser Phe Thr Val Glu Lys Gly Ile Tyr Gln Thr Ser Asn Phe Arg Val
305 310 315 320
Gln Pro Thr Glu Ser Ile Val Arg Phe Pro Asn Ile Thr Asn Leu Cys
325 330 335
Pro Phe Gly Glu Val Phe Asn Ala Thr Arg Phe Ala Ser Val Tyr Ala
340 345 350
Trp Asn Arg Lys Arg Ile Ser Asn Cys Val Ala Asp Tyr Ser Val Leu
355 360 365
Tyr Asn Ser Ala Ser Phe Ser Thr Phe Lys Cys Tyr Gly Val Ser Pro
370 375 380
Thr Lys Leu Asn Asp Leu Cys Phe Thr Asn Val Tyr Ala Asp Ser Phe
385 390 395 400
Val Ile Arg Gly Asp Glu Val Arg Gln Ile Ala Pro Gly Gln Thr Gly
405 410 415
Lys Ile Ala Asp Tyr Asn Tyr Lys Leu Pro Asp Asp Phe Thr Gly Cys
420 425 430
Val Ile Ala Trp Asn Ser Asn Asn Leu Asp Ser Lys Val Gly Gly Asn
435 440 445
Tyr Asn Tyr Leu Tyr Arg Leu Phe Arg Lys Ser Asn Leu Lys Pro Phe
450 455 460
Glu Arg Asp Ile Ser Thr Glu Ile Tyr Gln Ala Gly Ser Thr Pro Cys
465 470 475 480
Asn Gly Val Glu Gly Phe Asn Cys Tyr Phe Pro Leu Gln Ser Tyr Gly
485 490 495
Phe Gln Pro Thr Asn Gly Val Gly Tyr Gln Pro Tyr Arg Val Val Val
500 505 510
Leu Ser Phe Glu Leu Leu His Ala Pro Ala Thr Val Cys Gly Pro Lys
515 520 525
Lys Ser Thr Asn Leu Val Lys Asn Lys Cys Val Asn Phe Asn Phe Asn
530 535 540
Gly Leu Thr Gly Thr Gly Val Leu Thr Glu Ser Asn Lys Lys Phe Leu
545 550 555 560
Pro Phe Gln Gln Phe Gly Arg Asp Ile Ala Asp Thr Thr Asp Ala Val
565 570 575
Arg Asp Pro Gln Thr Leu Glu Ile Leu Asp Ile Thr Pro Cys Ser Phe
580 585 590
Gly Gly Val Ser Val Ile Thr Pro Gly Thr Asn Thr Ser Asn Gln Val
595 600 605
Ala Val Leu Tyr Gln Asp Val Asn Cys Thr Glu Val Pro Val Ala Ile
610 615 620
His Ala Asp Gln Leu Thr Pro Thr Trp Arg Val Tyr Ser Thr Gly Ser
625 630 635 640
Asn Val Phe Gln Thr Arg Ala Gly Cys Leu Ile Gly Ala Glu His Val
645 650 655
Asn Asn Ser Tyr Glu Cys Asp Ile Pro Ile Gly Ala Gly Ile Cys Ala
660 665 670
Ser Tyr Gln Thr Gln Thr Asn Ser Pro Arg Arg Ala Arg Ser Val Ala
675 680 685
Ser Gln Ser Ile Ile Ala Tyr Thr Met Ser Leu Gly Ala Glu Asn Ser
690 695 700
Val Ala Tyr Ser Asn Asn Ser Ile Ala Ile Pro Thr Asn Phe Thr Ile
705 710 715 720
Ser Val Thr Thr Glu Ile Leu Pro Val Ser Met Thr Lys Thr Ser Val
725 730 735
Asp Cys Thr Met Tyr Ile Cys Gly Asp Ser Thr Glu Cys Ser Asn Leu
740 745 750
Leu Leu Gln Tyr Gly Ser Phe Cys Thr Gln Leu Asn Arg Ala Leu Thr
755 760 765
Gly Ile Ala Val Glu Gln Asp Lys Asn Thr Gln Glu Val Phe Ala Gln
770 775 780
Val Lys Gln Ile Tyr Lys Thr Pro Pro Ile Lys Asp Phe Gly Gly Phe
785 790 795 800
Asn Phe Ser Gln Ile Leu Pro Asp Pro Ser Lys Pro Ser Lys Arg Ser
805 810 815
Phe Ile Glu Asp Leu Leu Phe Asn Lys Val Thr Leu Ala Asp Ala Gly
820 825 830
Phe Ile Lys Gln Tyr Gly Asp Cys Leu Gly Asp Ile Ala Ala Arg Asp
835 840 845
Leu Ile Cys Ala Gln Lys Phe Asn Gly Leu Thr Val Leu Pro Pro Leu
850 855 860
Leu Thr Asp Glu Met Ile Ala Gln Tyr Thr Ser Ala Leu Leu Ala Gly
865 870 875 880
Thr Ile Thr Ser Gly Trp Thr Phe Gly Ala Gly Ala Ala Leu Gln Ile
885 890 895
Pro Phe Ala Met Gln Met Ala Tyr Arg Phe Asn Gly Ile Gly Val Thr
900 905 910
Gln Asn Val Leu Tyr Glu Asn Gln Lys Leu Ile Ala Asn Gln Phe Asn
915 920 925
Ser Ala Ile Gly Lys Ile Gln Asp Ser Leu Ser Ser Thr Ala Ser Ala
930 935 940
Leu Gly Lys Leu Gln Asp Val Val Asn Gln Asn Ala Gln Ala Leu Asn
945 950 955 960
Thr Leu Val Lys Gln Leu Ser Ser Asn Phe Gly Ala Ile Ser Ser Val
965 970 975
Leu Asn Asp Ile Leu Ser Arg Leu Asp Lys Val Glu Ala Glu Val Gln
980 985 990
Ile Asp Arg Leu Ile Thr Gly Arg Leu Gln Ser Leu Gln Thr Tyr Val
995 1000 1005
Thr Gln Gln Leu Ile Arg Ala Ala Glu Ile Arg Ala Ser Ala Asn
1010 1015 1020
Leu Ala Ala Thr Lys Met Ser Glu Cys Val Leu Gly Gln Ser Lys
1025 1030 1035
Arg Val Asp Phe Cys Gly Lys Gly Tyr His Leu Met Ser Phe Pro
1040 1045 1050
Gln Ser Ala Pro His Gly Val Val Phe Leu His Val Thr Tyr Val
1055 1060 1065
Pro Ala Gln Glu Lys Asn Phe Thr Thr Ala Pro Ala Ile Cys His
1070 1075 1080
Asp Gly Lys Ala His Phe Pro Arg Glu Gly Val Phe Val Ser Asn
1085 1090 1095
Gly Thr His Trp Phe Val Thr Gln Arg Asn Phe Tyr Glu Pro Gln
1100 1105 1110
Ile Ile Thr Thr Asp Asn Thr Phe Val Ser Gly Asn Cys Asp Val
1115 1120 1125
Val Ile Gly Ile Val Asn Asn Thr Val Tyr Asp Pro Leu Gln Pro
1130 1135 1140
Glu Leu Asp Ser Phe Lys Glu Glu Leu Asp Lys Tyr Phe Lys Asn
1145 1150 1155
His Thr Ser Pro Asp Val Asp Leu Gly Asp Ile Ser Gly Ile Asn
1160 1165 1170
Ala Ser Val Val Asn Ile Gln Lys Glu Ile Asp Arg Leu Asn Glu
1175 1180 1185
Val Ala Lys Asn Leu Asn Glu Ser Leu Ile Asp Leu Gln Glu Leu
1190 1195 1200
Gly Lys Tyr Glu Gln Tyr Ile Phe Cys Phe Ile Ile Gly Leu Ile
1205 1210 1215
Ile Gly Leu Phe Leu Val Leu Arg Val Gly Ile Tyr Leu Cys Ile
1220 1225 1230
Lys Leu Lys His Thr Lys Lys Arg Gln Ile Tyr Thr Asp Ile Glu
1235 1240 1245
Met Asn Arg Leu Gly Lys
1250
<210>7
<211>12687
<212>DNA
<213>Artificial Sequence
<400>7
acgaagacaa acaaaccatt attatcatta aaaggctcag gagaaacttt aacagtaatc 60
aaaatgtctg ttacagtcaa gagaatcatt gacaacacag tcatagttcc aaaacttcct 120
gcaaatgagg atccagtgga atacccggca gattacttca gaaaatcaaa ggagattcct 180
ctttacatca atactacaaa aagtttgtca gatctaagag gatatgtcta ccaaggcctc 240
aaatccggaa atgtatcaat catacatgtc aacagctact tgtatggagc attaaaggac 300
atccggggta agttggataa agattggtca agtttcggaa taaacatcgg gaaagcaggg 360
gatacaatcg gaatatttga ccttgtatcc ttgaaagccc tggacggcgt acttccagat 420
ggagtatcgg atgcttccag aaccagcgca gatgacaaat ggttgccttt gtatctactt 480
ggcttataca gagtgggcag aacacaaatg cctgaataca gaaaaaagct catggatggg 540
ctgacaaatc aatgcaaaat gatcaatgaa cagtttgaac ctcttgtgcc agaaggtcgt 600
gacatttttg atgtgtgggg aaatgacagt aattacacaa aaattgtcgc tgcagtggac 660
atgttcttcc acatgttcaa aaaacatgaa tgtgcctcgt tcagatacgg aactattgtt 720
tccagattca aagattgtgc tgcattggca acatttggac acctctgcaa aataaccgga 780
atgtctacag aagatgtaac gacctggatc ttgaaccgag aagttgcaga tgaaatggtc 840
caaatgatgc ttccaggcca agaaattgac aaggccgatt catacatgcc ttatttgatc 900
gactttggat tgtcttctaa gtctccatat tcttccgtca aaaaccctgc cttccacttc 960
tgggggcaat tgacagctct tctgctcaga tccaccagag caaggaatgc ccgacagcct 1020
gatgacattg agtatacatc tcttactaca gcaggtttgt tgtacgctta tgcagtagga 1080
tcctctgccg acttggcaca acagttttgt gttggagata acaaatacac tccagatgat 1140
agtaccggag gattgacgac taatgcaccg ccacaaggca gagatgtggt cgaatggctc 1200
ggatggtttg aagatcaaaa cagaaaaccg actcctgata tgatgcagta tgcgaaaaga 1260
gcagtcatgt cactgcaagg cctaagagag aagacaattg gcaagtatgc taagtcagaa 1320
tttgacaaat gaccctataa ttctcagatc acctattata tattatgcta catatgaaaa 1380
aaactaacag atatcatgga taatctcaca aaagttcgtg agtatctcaa gtcctactct 1440
cgtctagatc aggcggtagg agagatagat gagatcgaag cacaacgagc tgaaaagtcc 1500
aattatgagt tgttccaaga ggacggagtg gaagagcata ctaggccctc ttattttcag 1560
gcagcagatg attctgacac agaatctgaa ccagaaattg aagacaatca aggcttgtat 1620
gtaccagatc cggaagctga gcaagttgaa ggctttatac aggggccttt agatgactat 1680
gcagatgagg acgtggatgt tgtattcact tcggactgga aacagcctga gcttgaatcc 1740
gacgagcatg gaaagacctt acggttgaca ttgccagagg gtttaagtgg agagcagaaa 1800
tcccagtggc ttttgacgat taaagcagtc gttcaaagtg ccaaacactg gaatctggca 1860
gagtgcacat ttgaagcatc gggagaaggg gtcatcataa aaaagcgcca gataactccg 1920
gatgtatata aggtcactcc agtgatgaac acacatccgt accaatcaga agccgtatca 1980
gatgtttggt ctctctcaaa gacatccatg actttccaac ccaagaaagc aagtcttcag 2040
cctctcacca tatccttgga tgaattgttc tcatctagag gagaattcat ctctgtcgga 2100
ggtaacggac gaatgtctca taaagaggcc atcctgctcg gtctgaggta caaaaagttg 2160
tacaatcagg cgagagtcaa atattctctg tagactatga aaaaaagtaa cagatatcac 2220
aatctaagtg ttatcccaat ccattcatca tgagttcctt aaagaagatt ctcggtctga 2280
aggggaaagg taagaaatct aagaaattag ggatcgcacc acccccttat gaagaggaca 2340
ctagcatgga gtatgctccg agcgctccaa ttgacaaatc ctattttgga gttgacgaga 2400
tggacaccta tgatccgaat caattaagat atgagaaatt cttctttaca gtgaaaatga 2460
cggttagatc taatcgtccg ttcagaacat actcagatgt ggcagccgct gtatcccatt 2520
gggatcacat gtacatcgga atggcaggga aacgtccctt ctacaaaatc ttggcttttt 2580
tgggttcttc taatctaaag gccactccag cggtattggc agatcaaggt caaccagagt 2640
atcacgctca ctgcgaaggc agggcttatt tgccacatag gatggggaag acccctccca 2700
tgctcaatgt accagagcac ttcagaagac cattcaatat aggtctttac aagggaacga 2760
ttgagctcac aatgaccatc tacgatgatg agtcactgga agcagctcct atgatctggg 2820
atcatttcaa ttcttccaaa ttttctgatt tcagagagaa ggccttaatg tttggcctga 2880
ttgtcgagaa aaaggcatct ggagcgtggg tcctggattc tatcagccac ttcaaatgag 2940
ctagtctagc ttccagcttc tgaacaatcc ccggtttact cagtctctcc taattccagc 3000
ctttcgaaca actaatatcc tgtcttttct atccctatga aaaaaactaa cagagatcga 3060
tctgtttcct tgaccctgca caacagattc ttcatgtttg aaccaaatca acttgtgata 3120
tcatgctcaa agaggcctta attatatttt aatttttaat ttttatgaaa aaaactaaca 3180
gcaatcatgg aagtccacga ttttgagacc gacgagttca atgatttcaa tgaagatgac 3240
tatgccacaa gagaattcct gaatcccgat gagcgcatga cgtacttgaa tcatgctgat 3300
tacaatttga attctcctct aattagtgat gatattgaca atttgatcag gaaattcaat 3360
tctcttccga ttccctcgat gtgggatagt aagaactggg atggagttct tgagatgtta 3420
acatcatgtc aagccaatcc catctcaaca tctcagatgc ataaatggat gggaagttgg 3480
ttaatgtctg ataatcatga tgccagtcaa gggtatagtt ttttacatga agtggacaaa 3540
gaggcagaaa taacatttga cgtggtggag accttcatcc gcggctgggg caacaaacca 3600
attgaataca tcaaaaagga aagatggact gactcattca aaattctcgc ttatttgtgt 3660
caaaagtttt tggacttaca caagttgaca ttaatcttaa atgctgtctc tgaggtggaa 3720
ttgctcaact tggcgaggac tttcaaaggc aaagtcagaa gaagttctca tggaacgaac 3780
atatgcagga ttagggttcc cagcttgggt cctactttta tttcagaagg atgggcttac 3840
ttcaagaaac ttgatattct aatggaccga aactttctgt taatggtcaa agatgtgatt 3900
atagggagga tgcaaacggt gctatccatg gtatgtagaa tagacaacct gttctcagag 3960
caagacatct tctcccttct aaatatctac agaattggag ataaaattgt ggagaggcag 4020
ggaaattttt cttatgactt gattaaaatg gtggaaccga tatgcaactt gaagctgatg 4080
aaattagcaa gagaatcaag gcctttagtc ccacaattcc ctcattttga aaatcatatc 4140
aagacttctg ttgatgaagg ggcaaaaatt gaccgaggta taagattcct ccatgatcag 4200
ataatgagtg tgaaaacagt ggatctcaca ctggtgattt atggatcgtt cagacattgg 4260
ggtcatcctt ttatagatta ttacactgga ctagaaaaat tacattccca agtaaccatg 4320
aagaaagata ttgatgtgtc atatgcaaaa gcacttgcaa gtgatttagc tcggattgtt 4380
ctatttcaac agttcaatga tcataaaaag tggttcgtga atggagactt gctccctcat 4440
gatcatccct ttaaaagtca tgttaaagaa aatacatggc ccacagctgc tcaagttcaa 4500
gattttggag ataaatggca tgaacttccg ctgattaaat gttttgaaat acccgactta 4560
ctagacccat cgataatata ctctgacaaa agtcattcaa tgaataggtc agaggtgttg 4620
aaacatgtcc gaatgaatcc gaacactcct atccctagta aaaaggtgtt gcagactatg 4680
ttggacacaa aggctaccaa ttggaaagaa tttcttaaag agattgatga gaagggctta 4740
gatgatgatg atctaattat tggtcttaaa ggaaaggaga gggaactgaa gttggcaggt 4800
agatttttct ccctaatgtc ttggaaattg cgagaatact ttgtaattac cgaatatttg 4860
ataaagactc atttcgtccc tatgtttaaa ggcctgacaa tggcggacga tctaactgca 4920
gtcattaaaa agatgttaga ttcctcatcc ggccaaggat tgaagtcata tgaggcaatt 4980
tgcatagcca atcacattga ttacgaaaaa tggaataacc accaaaggaa gttatcaaac 5040
ggcccagtgt tccgagttat gggccagttc ttaggttatc catccttaat cgagagaact 5100
catgaatttt ttgagaaaag tcttatatac tacaatggaa gaccagactt gatgcgtgtt 5160
cacaacaaca cactgatcaa ttcaacctcc caacgagttt gttggcaagg acaagagggt 5220
ggactggaag gtctacggca aaaaggatgg agtatcctca atctactggt tattcaaaga 5280
gaggctaaaa tcagaaacac tgctgtcaaa gtcttggcac aaggtgataa tcaagttatt 5340
tgcacacagt ataaaacgaa gaaatcgaga aacgttgtag aattacaggg tgctctcaat 5400
caaatggttt ctaataatga gaaaattatg actgcaatca aaatagggac agggaagtta 5460
ggacttttga taaatgacga tgagactatg caatctgcag attacttgaa ttatggaaaa 5520
ataccgattt tccgtggagt gattagaggg ttagagacca agagatggtc acgagtgact 5580
tgtgtcacca atgaccaaat acccacttgt gctaatataa tgagctcagt ttccacaaat 5640
gctctcaccg tagctcattt tgctgagaac ccaatcaatg ccatgataca gtacaattat 5700
tttgggacat ttgctagact cttgttgatg atgcatgatc ctgctcttcg tcaatcattg 5760
tatgaagttc aagataagat accgggcttg cacagttcta ctttcaaata cgccatgttg 5820
tatttggacc cttccattgg aggagtgtcg ggcatgtctt tgtccaggtt tttgattaga 5880
gccttcccag atcccgtaac agaaagtctc tcattctgga gattcatcca tgtacatgct 5940
cgaagtgagc atctgaagga gatgagtgca gtatttggaa accccgagat agccaagttt 6000
cgaataactc acatagacaa gctagtagaa gatccaacct ctctgaacat cgctatggga 6060
atgagtccag cgaacttgtt aaagactgag gttaaaaaat gcttaatcga atcaagacaa 6120
accatcagga accaggtgat taaggatgca accatatatt tgtatcatga agaggatcgg 6180
ctcagaagtt tcttatggtc aataaatcct ctgttcccta gatttttaag tgaattcaaa 6240
tcaggcactt ttttgggagt cgcagacggg ctcatcagtc tatttcaaaa ttctcgtact 6300
attcggaact cctttaagaa aaagtatcat agggaattgg atgatttgat tgtgaggagt 6360
gaggtatcct ctttgacaca tttagggaaa cttcatttga gaaggggatc atgtaaaatg 6420
tggacatgtt cagctactca tgctgacaca ttaagataca aatcctgggg ccgtacagtt 6480
attgggacaa ctgtacccca tccattagaa atgttgggtc cacaacatcg aaaagagact 6540
ccttgtgcac catgtaacac atcagggttc aattatgttt ctgtgcattg tccagacggg 6600
atccatgacg tctttagttc acggggacca ttgcctgctt atctagggtc taaaacatct 6660
gaatctacat ctattttgca gccttgggaa agggaaagca aagtcccact gattaaaaga 6720
gctacacgtc ttagagatgc tatctcttgg tttgttgaac ccgactctaa actagcaatg 6780
actatacttt ctaacatcca ctctttaaca ggcgaagaat ggaccaaaag gcagcatggg 6840
ttcaaaagaa cagggtctgc ccttcatagg ttttcgacat ctcggatgag ccatggtggg 6900
ttcgcatctc agagcactgc agcattgacc aggttgatgg caactacaga caccatgagg 6960
gatctgggag atcagaattt cgacttttta ttccaagcaa cgttgctcta tgctcaaatt 7020
accaccactg ttgcaagaga cggatggatc accagttgta cagatcatta tcatattgcc 7080
tgtaagtcct gtttgagacc catagaagag atcaccctgg actcaagtat ggactacacg 7140
cccccagatg tatcccatgt gctgaagaca tggaggaatg gggaaggttc gtggggacaa 7200
gagataaaac agatctatcc tttagaaggg aattggaaga atttagcacc tgctgagcaa 7260
tcctatcaag tcggcagatg tataggtttt ctatatggag acttggcgta tagaaaatct 7320
actcatgccg aggacagttc tctatttcct ctatctatac aaggtcgtat tagaggtcga 7380
ggtttcttaa aagggttgct agacggatta atgagagcaa gttgctgcca agtaatacac 7440
cggagaagtc tggctcattt gaagaggccg gccaacgcag tgtacggagg tttgatttac 7500
ttgattgata aattgagtgt atcacctcca ttcctttctc ttactagatc aggacctatt 7560
agagacgaat tagaaacgat tccccacaag atcccaacct cctatccgac aagcaaccgt 7620
gatatggggg tgattgtcag aaattacttc aaataccaat gccgtctaat tgaaaaggga 7680
aaatacagat cacattattc acaattatgg ttattctcag atgtcttatc catagacttc 7740
attggaccat tctctatttc caccaccctc ttgcaaatcc tatacaagcc atttttatct 7800
gggaaagata agaatgagtt gagagagctg gcaaatcttt cttcattgct aagatcagga 7860
gaggggtggg aagacataca tgtgaaattc ttcaccaagg acatattatt gtgtccagag 7920
gaaatcagac atgcttgcaa gttcgggatt gctaaggata ataataaaga catgagctat 7980
cccccttggg gaagggaatc cagagggaca attacaacaa tccctgttta ttatacgacc 8040
accccttacc caaagatgct agagatgcct ccaagaatcc aaaatcccct gctgtccgga 8100
atcaggttgg gccaattacc aactggcgct cattataaaa ttcggagtat attacatgga 8160
atgggaatcc attacaggga cttcttgagt tgtggagacg gctccggagg gatgactgct 8220
gcattactac gagaaaatgt gcatagcaga ggaatattca atagtctgtt agaattatca 8280
gggtcagtca tgcgaggcgc ctctcctgag ccccccagtg ccctagaaac tttaggagga 8340
gataaatcga gatgtgtaaa tggtgaaaca tgttgggaat atccatctga cttatgtgac 8400
ccaaggactt gggactattt cctccgactc aaagcaggct tggggcttca aattgattta 8460
attgtaatgg atatggaagt tcgggattct tctactagcc tgaaaattga gacgaatgtt 8520
agaaattatg tgcaccggat tttggatgag caaggagttt taatctacaa gacttatgga 8580
acatatattt gtgagagcga aaagaatgca gtaacaatcc ttggtcccat gttcaagacg 8640
gtcgacttag ttcaaacaga atttagtagt tctcaaacgt ctgaagtata tatggtatgt 8700
aaaggtttga agaaattaat cgatgaaccc aatcccgatt ggtcttccat caatgaatcc 8760
tggaaaaacc tgtacgcatt ccagtcatca gaacaggaat ttgccagagc aaagaaggtt 8820
agtacatact ttaccttgac aggtattccc tcccaattca ttcctgatcc ttttgtaaac 8880
attgagacta tgctacaaat attcggagta cccacgggtg tgtctcatgc ggctgcctta 8940
aaatcatctg atagacctgc agatttattg accattagcc ttttttatat ggcgattata 9000
tcgtattata acatcaatca tatcagagta ggaccgatac ctccgaaccc cccatcagat 9060
ggaattgcac aaaatgtggg gatcgctata actggtataa gcttttggct gagtttgatg 9120
gagaaagaca ttccactata tcaacagtgt ttggcagtta tccagcaatc atttccgatt 9180
aggtgggagg ctatttcagt aaaaggagga tacaagcaga agtggagtac tagaggtgat 9240
gggctcccaa aagatacccg aatttcagac tccttggccc caatcgggaa ctggatcaga 9300
tctttggaat tggtccgaaa ccaagttcgt ctaaatccat tcaataagat cttgttcaat 9360
cagctatgtc gtacagtgga taatcatttg aagtggtcaa atttgcgaaa aaacacagga 9420
atgattgaat ggatcaatgg gcgaatttca aaagaagacc ggtctatact gatgttgaag 9480
agtgacctac atgaggaaaa ctcttggaga gattaaaaaa tcaggaggag actccaaact 9540
ttaagtatga aaaaaacttt gatccttaag accctcttgt ggtttttatt tttttatctg 9600
gttttgtggt cttcgtgggt cggcatggca tctccacctc ctcgcggtcc gacctgggca 9660
tccgaaggag gacgtcgtcc actcggatgg ctaagggaga gctcggatcc ggctgctaac 9720
aaagcccgaa aggaagctga gttggctgct gccaccgctg agcaataact agcataaccc 9780
cttggggcct ctaaacgggt cttgaggggt tttttgctga aaggaggaac tatatccgga 9840
tcgagatcct ctagagtcga cctgcaggca tgcaagcttg tattctatag tgtcacctaa 9900
atcgtatgtg tatgatacat aaggttatgt attaattgta gccgcgttct aacgacaata 9960
tgtacaagcc taattgtgta gcatctggct tactgaagca gaccctatca tctctctcgt 10020
aaactgccgt cagagtcggt ttggttggac gaaccttctg agtttctggt aacgccgtcc 10080
cgcacccgga aatggtcagc gaaccaatca gcagggtcat cgctagccag atcctctacg 10140
ccggacgcat cgtggccggc atcaccggcg ccacaggtgc ggttgctggc gcctatatcg 10200
ccgacatcac cgatggggaa gatcgggctc gccacttcgg gctcatgagc gcttgtttcg 10260
gcgtgggtat ggtggcaggc cccgtggccg ggggactgtt gggcgccatc tccttgcacc 10320
attccttgcg gcggcggtgc tcaacggcct caacctacta ctgggctgct tcctaatgca 10380
ggagtcgcat aagggagagc gtcgaatggt gcactctcag tacaatctgc tctgatgccg 10440
catagttaag ccagccccga cacccgccaa cacccgctga cgcgccctga cgggcttgtc 10500
tgctcccggc atccgcttac agacaagctg tgaccgtctc cgggagctgc atgtgtcaga 10560
ggttttcacc gtcatcaccg aaacgcgcga gacgaaaggg cctcgtgata cgcctatttt 10620
tataggttaa tgtcatgata ataatggttt cttagacgtc aggtggcact tttcggggaa 10680
atgtgcgcgg aacccctatt tgtttatttt tctaaataca ttcaaatatg tatccgctca 10740
tgagacaata accctgataa atgcttcaat aatattgaaa aaggaagagt atgagtattc 10800
aacatttccg tgtcgccctt attccctttt ttgcggcatt ttgccttcct gtttttgctc 10860
acccagaaac gctggtgaaa gtaaaagatg ctgaagatca gttgggtgca cgagtgggtt 10920
acatcgaact ggatctcaac agcggtaaga tccttgagag ttttcgcccc gaagaacgtt 10980
ttccaatgat gagcactttt aaagttctgc tatgtggcgc ggtattatcc cgtattgacg 11040
ccgggcaaga gcaactcggt cgccgcatac actattctca gaatgacttg gttgagtact 11100
caccagtcac agaaaagcat cttacggatg gcatgacagt aagagaatta tgcagtgctg 11160
ccataaccat gagtgataac actgcggcca acttacttct gacaacgatc ggaggaccga 11220
aggagctaac cgcttttttg cacaacatgg gggatcatgt aactcgcctt gatcgttggg 11280
aaccggagct gaatgaagcc ataccaaacg acgagcgtga caccacgatg cctgtagcaa 11340
tggcaacaac gttgcgcaaa ctattaactg gcgaactact tactctagct tcccggcaac 11400
aattaataga ctggatggag gcggataaag ttgcaggacc acttctgcgc tcggcccttc 11460
cggctggctg gtttattgct gataaatctg gagccggtga gcgtgggtct cgcggtatca 11520
ttgcagcact ggggccagat ggtaagccct cccgtatcgt agttatctac acgacgggga 11580
gtcaggcaac tatggatgaa cgaaatagac agatcgctga gataggtgcc tcactgatta 11640
agcattggta actgtcagac caagtttact catatatact ttagattgat ttaaaacttc 11700
atttttaatt taaaaggatc taggtgaaga tcctttttga taatctcatg accaaaatcc 11760
cttaacgtga gttttcgttc cactgagcgt cagaccccgt agaaaagatc aaaggatctt 11820
cttgagatcc tttttttctg cgcgtaatct gctgcttgca aacaaaaaaa ccaccgctac 11880
cagcggtggt ttgtttgccg gatcaagagc taccaactct ttttccgaag gtaactggct 11940
tcagcagagc gcagatacca aatactgttc ttctagtgta gccgtagtta ggccaccact 12000
tcaagaactc tgtagcaccg cctacatacc tcgctctgct aatcctgtta ccagtggctg 12060
ctgccagtgg cgataagtcg tgtcttaccg ggttggactc aagacgatag ttaccggata 12120
aggcgcagcg gtcgggctga acggggggtt cgtgcacaca gcccagcttg gagcgaacga 12180
cctacaccga actgagatac ctacagcgtg agctatgaga aagcgccacg cttcccgaag 12240
ggagaaaggc ggacaggtat ccggtaagcg gcagggtcgg aacaggagag cgcacgaggg 12300
agcttccagg gggaaacgcc tggtatcttt atagtcctgt cgggtttcgc cacctctgac 12360
ttgagcgtcg atttttgtga tgctcgtcag gggggcggag cctatggaaa aacgccagca 12420
acgcggcctt tttacggttc ctggcctttt gctggccttt tgctcacatg ttctttcctg 12480
cgttatcccc tgattctgtg gataaccgta ttaccgcctt tgagtgagct gataccgctc 12540
gccgcagccg aacgaccgag cgcagcgagt cagtgagcga ggaagcggaa gagcgcccaa 12600
tacgcaaacc gcctctcccc gcgcgttggc cgattcatta atgcaggggg atctcgatcc 12660
cgcgaaatta atacgactca ctatagg 12687
<210>8
<211>1269
<212>DNA
<213>Artificial Sequence
<400>8
atgtctgtta cagtcaagag aatcattgac aacacagtca tagttccaaa acttcctgca 60
aatgaggatc cagtggaata cccggcagat tacttcagaa aatcaaagga gattcctctt 120
tacatcaata ctacaaaaag tttgtcagat ctaagaggat atgtctacca aggcctcaaa 180
tccggaaatg tatcaatcat acatgtcaac agctacttgt atggagcatt aaaggacatc 240
cggggtaagt tggataaaga ttggtcaagt ttcggaataa acatcgggaa agcaggggat 300
acaatcggaa tatttgacct tgtatccttg aaagccctgg acggcgtact tccagatgga 360
gtatcggatg cttccagaac cagcgcagat gacaaatggt tgcctttgta tctacttggc 420
ttatacagag tgggcagaac acaaatgcct gaatacagaa aaaagctcat ggatgggctg 480
acaaatcaat gcaaaatgat caatgaacag tttgaacctc ttgtgccaga aggtcgtgac 540
atttttgatg tgtggggaaa tgacagtaat tacacaaaaa ttgtcgctgc agtggacatg 600
ttcttccaca tgttcaaaaa acatgaatgt gcctcgttca gatacggaac tattgtttcc 660
agattcaaag attgtgctgc attggcaaca tttggacacc tctgcaaaat aaccggaatg 720
tctacagaag atgtaacgac ctggatcttg aaccgagaag ttgcagatga aatggtccaa 780
atgatgcttc caggccaaga aattgacaag gccgattcat acatgcctta tttgatcgac 840
tttggattgt cttctaagtc tccatattct tccgtcaaaa accctgcctt ccacttctgg 900
gggcaattga cagctcttct gctcagatcc accagagcaa ggaatgcccg acagcctgat 960
gacattgagt atacatctct tactacagca ggtttgttgt acgcttatgc agtaggatcc 1020
tctgccgact tggcacaaca gttttgtgtt ggagataaca aatacactcc agatgatagt 1080
accggaggat tgacgactaa tgcaccgcca caaggcagag atgtggtcga atggctcgga 1140
tggtttgaag atcaaaacag aaaaccgact cctgatatga tgcagtatgc gaaaagagca 1200
gtcatgtcac tgcaaggcct aagagagaag acaattggca agtatgctaa gtcagaattt 1260
gacaaatga 1269
<210>9
<211>798
<212>DNA
<213>Artificial Sequence
<400>9
atggataatc tcacaaaagt tcgtgagtat ctcaagtcct actctcgtct agatcaggcg 60
gtaggagaga tagatgagat cgaagcacaa cgagctgaaa agtccaatta tgagttgttc 120
caagaggacg gagtggaaga gcatactagg ccctcttatt ttcaggcagc agatgattct 180
gacacagaat ctgaaccaga aattgaagac aatcaaggct tgtatgtacc agatccggaa 240
gctgagcaag ttgaaggctt tatacagggg cctttagatg actatgcaga tgaggacgtg 300
gatgttgtat tcacttcgga ctggaaacag cctgagcttg aatccgacga gcatggaaag 360
accttacggt tgacattgcc agagggttta agtggagagc agaaatccca gtggcttttg 420
acgattaaag cagtcgttca aagtgccaaa cactggaatc tggcagagtg cacatttgaa 480
gcatcgggag aaggggtcat cataaaaaag cgccagataa ctccggatgt atataaggtc 540
actccagtga tgaacacaca tccgtaccaa tcagaagccg tatcagatgt ttggtctctc 600
tcaaagacat ccatgacttt ccaacccaag aaagcaagtc ttcagcctct caccatatcc 660
ttggatgaat tgttctcatc tagaggagaa ttcatctctg tcggaggtaa cggacgaatg 720
tctcataaag aggccatcct gctcggtctg aggtacaaaa agttgtacaa tcaggcgaga 780
gtcaaatatt ctctgtag 798
<210>10
<211>6330
<212>DNA
<213>Artificial Sequence
<400>10
atggaagtcc acgattttga gaccgacgag ttcaatgatt tcaatgaaga tgactatgcc 60
acaagagaat tcctgaatcc cgatgagcgc atgacgtact tgaatcatgc tgattacaat 120
ttgaattctc ctctaattag tgatgatatt gacaatttga tcaggaaatt caattctctt 180
ccgattccct cgatgtggga tagtaagaac tgggatggag ttcttgagat gttaacatca 240
tgtcaagcca atcccatctc aacatctcag atgcataaat ggatgggaag ttggttaatg 300
tctgataatc atgatgccag tcaagggtat agttttttac atgaagtgga caaagaggca 360
gaaataacat ttgacgtggt ggagaccttc atccgcggct ggggcaacaa accaattgaa 420
tacatcaaaa aggaaagatg gactgactca ttcaaaattc tcgcttattt gtgtcaaaag 480
tttttggact tacacaagtt gacattaatc ttaaatgctg tctctgaggt ggaattgctc 540
aacttggcga ggactttcaa aggcaaagtc agaagaagtt ctcatggaac gaacatatgc 600
aggattaggg ttcccagctt gggtcctact tttatttcag aaggatgggc ttacttcaag 660
aaacttgata ttctaatgga ccgaaacttt ctgttaatgg tcaaagatgt gattataggg 720
aggatgcaaa cggtgctatc catggtatgt agaatagaca acctgttctc agagcaagac 780
atcttctccc ttctaaatat ctacagaatt ggagataaaa ttgtggagag gcagggaaat 840
ttttcttatg acttgattaa aatggtggaa ccgatatgca acttgaagct gatgaaatta 900
gcaagagaat caaggccttt agtcccacaa ttccctcatt ttgaaaatca tatcaagact 960
tctgttgatg aaggggcaaa aattgaccga ggtataagat tcctccatga tcagataatg 1020
agtgtgaaaa cagtggatct cacactggtg atttatggat cgttcagaca ttggggtcat 1080
ccttttatag attattacac tggactagaa aaattacatt cccaagtaac catgaagaaa 1140
gatattgatg tgtcatatgc aaaagcactt gcaagtgatt tagctcggat tgttctattt 1200
caacagttca atgatcataa aaagtggttc gtgaatggag acttgctccc tcatgatcat 1260
ccctttaaaa gtcatgttaa agaaaataca tggcccacag ctgctcaagt tcaagatttt 1320
ggagataaat ggcatgaact tccgctgatt aaatgttttg aaatacccga cttactagac 1380
ccatcgataa tatactctga caaaagtcat tcaatgaata ggtcagaggt gttgaaacat 1440
gtccgaatga atccgaacac tcctatccct agtaaaaagg tgttgcagac tatgttggac 1500
acaaaggcta ccaattggaa agaatttctt aaagagattg atgagaaggg cttagatgat 1560
gatgatctaa ttattggtct taaaggaaag gagagggaac tgaagttggc aggtagattt 1620
ttctccctaa tgtcttggaa attgcgagaa tactttgtaa ttaccgaata tttgataaag 1680
actcatttcg tccctatgtt taaaggcctg acaatggcgg acgatctaac tgcagtcatt 1740
aaaaagatgt tagattcctc atccggccaa ggattgaagt catatgaggc aatttgcata 1800
gccaatcaca ttgattacga aaaatggaat aaccaccaaa ggaagttatc aaacggccca 1860
gtgttccgag ttatgggcca gttcttaggt tatccatcct taatcgagag aactcatgaa 1920
ttttttgaga aaagtcttat atactacaat ggaagaccag acttgatgcg tgttcacaac 1980
aacacactga tcaattcaac ctcccaacga gtttgttggc aaggacaaga gggtggactg 2040
gaaggtctac ggcaaaaagg atggagtatc ctcaatctac tggttattca aagagaggct 2100
aaaatcagaa acactgctgt caaagtcttg gcacaaggtg ataatcaagt tatttgcaca 2160
cagtataaaa cgaagaaatc gagaaacgtt gtagaattac agggtgctct caatcaaatg 2220
gtttctaata atgagaaaat tatgactgca atcaaaatag ggacagggaa gttaggactt 2280
ttgataaatg acgatgagac tatgcaatct gcagattact tgaattatgg aaaaataccg 2340
attttccgtg gagtgattag agggttagag accaagagat ggtcacgagt gacttgtgtc 2400
accaatgacc aaatacccac ttgtgctaat ataatgagct cagtttccac aaatgctctc 2460
accgtagctc attttgctga gaacccaatc aatgccatga tacagtacaa ttattttggg 2520
acatttgcta gactcttgtt gatgatgcat gatcctgctc ttcgtcaatc attgtatgaa 2580
gttcaagata agataccggg cttgcacagt tctactttca aatacgccat gttgtatttg 2640
gacccttcca ttggaggagt gtcgggcatg tctttgtcca ggtttttgat tagagccttc 2700
ccagatcccg taacagaaag tctctcattc tggagattca tccatgtaca tgctcgaagt 2760
gagcatctga aggagatgag tgcagtattt ggaaaccccg agatagccaa gtttcgaata 2820
actcacatag acaagctagt agaagatcca acctctctga acatcgctat gggaatgagt 2880
ccagcgaact tgttaaagac tgaggttaaa aaatgcttaa tcgaatcaag acaaaccatc 2940
aggaaccagg tgattaagga tgcaaccata tatttgtatc atgaagagga tcggctcaga 3000
agtttcttat ggtcaataaa tcctctgttc cctagatttt taagtgaatt caaatcaggc 3060
acttttttgg gagtcgcaga cgggctcatc agtctatttc aaaattctcg tactattcgg 3120
aactccttta agaaaaagta tcatagggaa ttggatgatt tgattgtgag gagtgaggta 3180
tcctctttga cacatttagg gaaacttcat ttgagaaggg gatcatgtaa aatgtggaca 3240
tgttcagcta ctcatgctga cacattaaga tacaaatcct ggggccgtac agttattggg 3300
acaactgtac cccatccatt agaaatgttg ggtccacaac atcgaaaaga gactccttgt 3360
gcaccatgta acacatcagg gttcaattat gtttctgtgc attgtccaga cgggatccat 3420
gacgtcttta gttcacgggg accattgcct gcttatctag ggtctaaaac atctgaatct 3480
acatctattt tgcagccttg ggaaagggaa agcaaagtcc cactgattaa aagagctaca 3540
cgtcttagag atgctatctc ttggtttgtt gaacccgact ctaaactagc aatgactata 3600
ctttctaaca tccactcttt aacaggcgaa gaatggacca aaaggcagca tgggttcaaa 3660
agaacagggt ctgcccttca taggttttcg acatctcgga tgagccatgg tgggttcgca 3720
tctcagagca ctgcagcatt gaccaggttg atggcaacta cagacaccat gagggatctg 3780
ggagatcaga atttcgactt tttattccaa gcaacgttgc tctatgctca aattaccacc 3840
actgttgcaa gagacggatg gatcaccagt tgtacagatc attatcatat tgcctgtaag 3900
tcctgtttga gacccataga agagatcacc ctggactcaa gtatggacta cacgccccca 3960
gatgtatccc atgtgctgaa gacatggagg aatggggaag gttcgtgggg acaagagata 4020
aaacagatct atcctttaga agggaattgg aagaatttag cacctgctga gcaatcctat 4080
caagtcggca gatgtatagg ttttctatat ggagacttgg cgtatagaaa atctactcat 4140
gccgaggaca gttctctatt tcctctatct atacaaggtc gtattagagg tcgaggtttc 4200
ttaaaagggt tgctagacgg attaatgaga gcaagttgct gccaagtaat acaccggaga 4260
agtctggctc atttgaagag gccggccaac gcagtgtacg gaggtttgat ttacttgatt 4320
gataaattga gtgtatcacc tccattcctt tctcttacta gatcaggacc tattagagac 4380
gaattagaaa cgattcccca caagatccca acctcctatc cgacaagcaa ccgtgatatg 4440
ggggtgattg tcagaaatta cttcaaatac caatgccgtc taattgaaaa gggaaaatac 4500
agatcacatt attcacaatt atggttattc tcagatgtct tatccataga cttcattgga 4560
ccattctcta tttccaccac cctcttgcaa atcctataca agccattttt atctgggaaa 4620
gataagaatg agttgagaga gctggcaaat ctttcttcat tgctaagatc aggagagggg 4680
tgggaagaca tacatgtgaa attcttcacc aaggacatat tattgtgtcc agaggaaatc 4740
agacatgctt gcaagttcgg gattgctaag gataataata aagacatgag ctatccccct 4800
tggggaaggg aatccagagg gacaattaca acaatccctg tttattatac gaccacccct 4860
tacccaaaga tgctagagat gcctccaaga atccaaaatc ccctgctgtc cggaatcagg 4920
ttgggccaat taccaactgg cgctcattat aaaattcgga gtatattaca tggaatggga 4980
atccattaca gggacttctt gagttgtgga gacggctccg gagggatgac tgctgcatta 5040
ctacgagaaa atgtgcatag cagaggaata ttcaatagtc tgttagaatt atcagggtca 5100
gtcatgcgag gcgcctctcc tgagcccccc agtgccctag aaactttagg aggagataaa 5160
tcgagatgtg taaatggtga aacatgttgg gaatatccat ctgacttatg tgacccaagg 5220
acttgggact atttcctccg actcaaagca ggcttggggc ttcaaattga tttaattgta 5280
atggatatgg aagttcggga ttcttctact agcctgaaaa ttgagacgaa tgttagaaat 5340
tatgtgcacc ggattttgga tgagcaagga gttttaatct acaagactta tggaacatat 5400
atttgtgaga gcgaaaagaa tgcagtaaca atccttggtc ccatgttcaa gacggtcgac 5460
ttagttcaaa cagaatttag tagttctcaa acgtctgaag tatatatggt atgtaaaggt 5520
ttgaagaaat taatcgatga acccaatccc gattggtctt ccatcaatga atcctggaaa 5580
aacctgtacg cattccagtc atcagaacag gaatttgcca gagcaaagaa ggttagtaca 5640
tactttacct tgacaggtat tccctcccaa ttcattcctg atccttttgt aaacattgag 5700
actatgctac aaatattcgg agtacccacg ggtgtgtctc atgcggctgc cttaaaatca 5760
tctgatagac ctgcagattt attgaccatt agcctttttt atatggcgat tatatcgtat 5820
tataacatca atcatatcag agtaggaccg atacctccga accccccatc agatggaatt 5880
gcacaaaatg tggggatcgc tataactggt ataagctttt ggctgagttt gatggagaaa 5940
gacattccac tatatcaaca gtgtttggca gttatccagc aatcatttcc gattaggtgg 6000
gaggctattt cagtaaaagg aggatacaag cagaagtgga gtactagagg tgatgggctc 6060
ccaaaagata cccgaatttc agactccttg gccccaatcg ggaactggat cagatctttg 6120
gaattggtcc gaaaccaagt tcgtctaaat ccattcaata agatcttgtt caatcagcta 6180
tgtcgtacag tggataatca tttgaagtgg tcaaatttgc gaaaaaacac aggaatgatt 6240
gaatggatca atgggcgaat ttcaaaagaa gaccggtcta tactgatgtt gaagagtgac 6300
ctacatgagg aaaactcttg gagagattaa 6330
<210>11
<211>690
<212>DNA
<213>Artificial Sequence
<400>11
atgagttcct taaagaagat tctcggtctg aaggggaaag gtaagaaatc taagaaatta 60
gggatcgcac caccccctta tgaagaggac actagcatgg agtatgctcc gagcgctcca 120
attgacaaat cctattttgg agttgacgag atggacacct atgatccgaa tcaattaaga 180
tatgagaaat tcttctttac agtgaaaatg acggttagat ctaatcgtcc gttcagaaca 240
tactcagatg tggcagccgc tgtatcccat tgggatcaca tgtacatcgg aatggcaggg 300
aaacgtccct tctacaaaat cttggctttt ttgggttctt ctaatctaaa ggccactcca 360
gcggtattgg cagatcaagg tcaaccagag tatcacgctc actgcgaagg cagggcttat 420
ttgccacata ggatggggaa gacccctccc atgctcaatg taccagagca cttcagaaga 480
ccattcaata taggtcttta caagggaacg attgagctca caatgaccat ctacgatgat 540
gagtcactgg aagcagctcc tatgatctgg gatcatttca attcttccaa attttctgat 600
ttcagagaga aggccttaat gtttggcctg attgtcgaga aaaaggcatc tggagcgtgg 660
gtcctggatt ctatcagcca cttcaaatga 690
<210>12
<211>1536
<212>DNA
<213>Artificial Sequence
<400>12
atgaagtgcc ttttgtactt agctttttta ttcatcgggg tgaattgcaa gttcaccata 60
gtttttccac acaaccgaaa aggaaactgg aaaaatgttc cttccaatta ccattattgc 120
ccgtcaagct cagatttaaa ttggcataat gacttaatag gcacagcctt acaagtcaaa 180
atgcccaaga gtcacaaggc tattcaagca gacggttgga tgtgtcatgc ttccaaatgg 240
gtcactactt gtgatttccg ctggtacgga ccggagtata taacacattc catccgatcc 300
ttcactccat ctgtagaaca atgcaaggaa agcattgaac aaacgaaaca aggaacttgg 360
ctgaatccag gcttccctcc tcaaagttgt ggatatgcaa ctgtgacgga tgctgaagca 420
gcgattgtcc aggtgactcc tcaccatgtg cttgttgatg aatacacagg agaatgggtt 480
gattcacagt tcatcaacgg aaaatgcagc aatgacatat gccccactgt ccataactcc 540
acaacctggc attccgacta taaggtcaaa gggctatgtg attctaacct catttccatg 600
gacatcacct tcttctcaga ggacggagag ctatcatccc taggaaagga gggcacaggg 660
ttcagaagta actactttgc ttatgaaact ggagacaagg cctgcaaaat gcagtactgc 720
aagcattggg gagtcagact cccatcaggt gtctggttcg agatggctga taaggatctc 780
tttgctgcag ccagattccc tgaatgccca gaagggtcaa gtatctctgc tccatctcag 840
acctcagtgg atgtaagtct cattcaggac gttgagagga tcttggatta ttccctctgc 900
caagaaacct ggagcaaaat cagagcgggt cttcccatct ctccagtgga tctcagctat 960
cttgctccta aaaacccagg aaccggtcct gtctttacca taatcaatgg taccctaaaa 1020
tactttgaga ccagatacat cagagtcgat attgctgctc caatcctctc aagaatggtc 1080
ggaatgatca gtggaactac cacagaaagg gaactgtggg atgactgggc tccatatgaa 1140
gacgtggaaa ttggacccaa tggagttctg aggaccagtt caggatataa gtttccttta 1200
tatatgattg gacatggtat gttggactcc gatcttcatc ttagctcaaa ggctcaggtg 1260
tttgaacatc ctcacattca agacgctgct tcgcagcttc ctgatgatga gactttattt 1320
tttggtgata ctgggctatc caaaaatcca atcgagtttg tagaaggttg gttcagtagt 1380
tggaagagct ctattgcctc tttttgcttt atcatagggt taatcattgg actattcttg 1440
gttctccgag ttggtattta tctttgcatt aaattaaagc acaccaagaa aagacagatt 1500
tatacagaca tagagatgaa ccgacttgga aagtaa 1536
<210>13
<211>2652
<212>DNA
<213>Artificial Sequence
<400>13
atgaacacga ttaacatcgc taagaacgac ttctctgaca tcgaactggc tgctatcccg 60
ttcaacactc tggctgacca ttacggtgag cgtttagctc gcgaacagtt ggcccttgag 120
catgagtctt acgagatggg tgaagcacgc ttccgcaaga tgtttgagcg tcaacttaaa 180
gctggtgagg ttgcggataa cgctgccgcc aagcctctca tcactaccct actccctaag 240
atgattgcac gcatcaacga ctggtttgag gaagtgaaag ctaagcgcgg caagcgcccg 300
acagccttcc agttcctgca agaaatcaag ccggaagccg tagcgtacat caccattaag 360
accactctgg cttgcctaac cagtgctgac aatacaaccg ttcaggctgt agcaagcgca 420
atcggtcggg ccattgagga cgaggctcgc ttcggtcgta tccgtgacct tgaagctaag 480
cacttcaaga aaaacgttga ggaacaactc aacaagcgcg tagggcacgt ctacaagaaa 540
gcatttatgc aagttgtcga ggctgacatg ctctctaagg gtctactcgg tggcgaggcg 600
tggtcttcgt ggcataagga agactctatt catgtaggag tacgctgcat cgagatgctc 660
attgagtcaa ccggaatggt tagcttacac cgccaaaatg ctggcgtagt aggtcaagac 720
tctgagacta tcgaactcgc acctgaatac gctgaggcta tcgcaacccg tgcaggtgcg 780
ctggctggca tctctccgat gttccaacct tgcgtagttc ctcctaagcc gtggactggc 840
attactggtg gtggctattg ggctaacggt cgtcgtcctc tggcgctggt gcgtactcac 900
agtaagaaag cactgatgcg ctacgaagac gtttacatgc ctgaggtgta caaagcgatt 960
aacattgcgc aaaacaccgc atggaaaatc aacaagaaag tcctagcggt cgccaacgta 1020
atcaccaagt ggaagcattg tccggtcgag gacatccctg cgattgagcg tgaagaactc 1080
ccgatgaaac cggaagacat cgacatgaat cctgaggctc tcaccgcgtg gaaacgtgct 1140
gccgctgctg tgtaccgcaa ggacaaggct cgcaagtctc gccgtatcag ccttgagttc 1200
atgcttgagc aagccaataa gtttgctaac cataaggcca tctggttccc ttacaacatg 1260
gactggcgcg gtcgtgttta cgctgtgtca atgttcaacc cgcaaggtaa cgatatgacc 1320
aaaggactgc ttacgctggc gaaaggtaaa ccaatcggta aggaaggtta ctactggctg 1380
aaaatccacg gtgcaaactg tgcgggtgtc gataaggttc cgttccctga gcgcatcaag 1440
ttcattgagg aaaaccacga gaacatcatg gcttgcgcta agtctccact ggagaacact 1500
tggtgggctg agcaagattc tccgttctgc ttccttgcgt tctgctttga gtacgctggg 1560
gtacagcacc acggcctgag ctataactgc tcccttccgc tggcgtttga cgggtcttgc 1620
tctggcatcc agcacttctc cgcgatgctc cgagatgagg taggtggtcg cgcggttaac 1680
ttgcttccta gtgaaaccgt tcaggacatc tacgggattg ttgctaagaa agtcaacgag 1740
attctacaag cagacgcaat caatgggacc gataacgaag tagttaccgt gaccgatgag 1800
aacactggtg aaatctctga gaaagtcaag ctgggcacta aggcactggc tggtcaatgg 1860
ctggcttacg gtgttactcg cagtgtgact aagcgttcag tcatgacgct ggcttacggg 1920
tccaaagagt tcggcttccg tcaacaagtg ctggaagata ccattcagcc agctattgat 1980
tccggcaagg gtctgatgtt cactcagccg aatcaggctg ctggatacat ggctaagctg 2040
atttgggaat ctgtgagcgt gacggtggta gctgcggttg aagcaatgaa ctggcttaag 2100
tctgctgcta agctgctggc tgctgaggtc aaagataaga agactggaga gattcttcgc 2160
aagcgttgcg ctgtgcattg ggtaactcct gatggtttcc ctgtgtggca ggaatacaag 2220
aagcctattc agacgcgctt gaacctgatg ttcctcggtc agttccgctt acagcctacc 2280
attaacacca acaaagatag cgagattgat gcacacaaac aggagtctgg tatcgctcct 2340
aactttgtac acagccaaga cggtagccac cttcgtaaga ctgtagtgtg ggcacacgag 2400
aagtacggaa tcgaatcttt tgcactgatt cacgactcct tcggtaccat tccggctgac 2460
gctgcgaacc tgttcaaagc agtgcgcgaa actatggttg acacatatga gtcttgtgat 2520
gtactggctg atttctacga ccagttcgct gaccagttgc acgagtctca attggacaaa 2580
atgccagcac ttccggctaa aggtaacttg aacctccgtg acatcttaga gtcggacttc 2640
gcgttcgcgt aa 2652
<210>14
<211>720
<212>DNA
<213>Artificial Sequence
<400>14
atggtgagca agggcgagga gctgttcacc ggggtggtgc ccatcctggt cgagctggac 60
ggcgacgtaa acggccacaa gttcagcgtg tccggcgagg gcgagggcga tgccacctac 120
ggcaagctga ccctgaagtt catctgcacc accggcaagc tgcccgtgcc ctggcccacc 180
ctcgtgacca ccctgaccta cggcgtgcag tgcttcagcc gctaccccga ccacatgaag 240
cagcacgact tcttcaagtc cgccatgccc gaaggctacg tccaggagcg caccatcttc 300
ttcaaggacg acggcaacta caagacccgc gccgaggtga agttcgaggg cgacaccctg 360
gtgaaccgca tcgagctgaa gggcatcgac ttcaaggagg acggcaacat cctggggcac 420
aagctggagt acaactacaa cagccacaac gtctatatca tggccgacaa gcagaagaac 480
ggcatcaagg tgaacttcaa gatccgccac aacatcgagg acggcagcgt gcagctcgcc 540
gaccactacc agcagaacac ccccatcggc gacggccccg tgctgctgcc cgacaaccac 600
tacctgagca cccagtccgc cctgagcaaa gaccccaacg agaagcgcga tcacatggtc 660
ctgctggagt tcgtgaccgc cgccgggatc actctcggca tggacgagct gtacaagtga 720

Claims (11)

1. A recombinant vesicular stomatitis virus is a virus obtained by replacing glycoprotein G of the vesicular stomatitis virus with envelope protein S; the method is characterized in that: the recombinant vesicular stomatitis virus is 1) or 2) or 3) as follows:
1) replacing glycoprotein G of vesicular stomatitis virus with envelope protein S of 2019-nCoV to obtain virus; the envelope protein S consists of an envelope protein S extracellular region, an envelope protein S transmembrane region and an envelope protein S intracellular region of 2019-nCoV;
2) replacing glycoprotein G of vesicular stomatitis virus with envelope protein S formed by chimeric envelope protein S extracellular region of envelope protein S of 2019-nCoV and envelope protein S transmembrane region and intracellular region of SARS-CoV to obtain virus;
3) the virus is obtained by replacing glycoprotein G of vesicular stomatitis virus with a cyst membrane protein S formed by the chimeric extracellular region of the cyst membrane protein S of 2019-nCoV and the transmembrane region and the intracellular region of glycoprotein G of vesicular stomatitis virus.
2. The recombinant vesicular stomatitis virus of claim 1, wherein:
the amino acid sequence of the envelope protein S of the 2019-nCoV is a sequence 2 in the sequence table;
or the amino acid sequence of the envelope protein S formed by the chimeric extracellular region of the envelope protein S of 2019-nCoV and the transmembrane region and the intracellular region of the envelope protein S of SARS-CoV is sequence 4 in the sequence table;
or the amino acid sequence of the envelope protein S formed by the chimeric extracellular region of the envelope protein S of 2019-nCoV and the transmembrane region and the intracellular region of the glycoprotein G of the vesicular stomatitis virus is the sequence 6 in the sequence table.
3. The recombinant vesicular stomatitis virus of claim 2, wherein: in the step 1), the recombinant vesicular stomatitis virus is a virus obtained by replacing a coding gene sequence of glycoprotein G in a genome sequence of the vesicular stomatitis virus with a coding gene sequence of cyst membrane protein S of 2019-nCoV;
in the step 2), the recombinant vesicular stomatitis virus is a virus obtained by replacing the coding gene sequence of glycoprotein G in the genome sequence of the vesicular stomatitis virus with the coding gene sequence of envelope protein S formed by the chimeric of the extracellular region of envelope protein S of 2019-nCoV and the transmembrane region and the intracellular region of envelope protein S of SARS-CoV;
in the step 3), the recombinant vesicular stomatitis virus is a virus obtained by replacing the coding gene sequence of glycoprotein G in the genome sequence of the vesicular stomatitis virus with the coding gene sequence of envelope protein S formed by the chimeric extracellular region of envelope protein S of 2019-nCoV and the transmembrane region and intracellular region of glycoprotein G of the vesicular stomatitis virus.
4. A recombinant vesicular stomatitis virus is obtained by transfecting a recombinant virus vector into a virus packaging cell and then performing cell culture; the recombinant viral vector is A) or B) or C) or D) as follows:
A) replacing the coding gene sequence of glycoprotein G in the genome sequence of the vesicular stomatitis virus in the vesicular stomatitis virus vector with the coding gene sequence of the envelope protein S of 2019-nCoV to obtain the vector; the envelope protein S consists of an envelope protein S extracellular region, an envelope protein S transmembrane region and an envelope protein S intracellular region of 2019-nCoV;
B) replacing the coding gene sequence of glycoprotein G in the genome sequence of the vesicular stomatitis virus in the vesicular stomatitis virus vector with the coding gene sequence of the envelope protein S formed by the chimeric extracellular region of the envelope protein S of 2019-nCoV and the transmembrane region and the intracellular region of the envelope protein S of SARS-CoV;
C) replacing the coding gene sequence of glycoprotein G in the genome sequence of the vesicular stomatitis virus in the vesicular stomatitis virus vector with the coding gene sequence of the envelope protein S formed by the chimeric extracellular region of the envelope protein S of 2019-nCoV and the transmembrane region and the intracellular region of the glycoprotein G of the vesicular stomatitis virus;
D) a vector obtained by inserting a reporter gene into the recombinant viral vector described in A), B) or C).
5. The recombinant vesicular stomatitis virus of claims 3 or 4, wherein: the encoding gene sequence of the envelope protein S of the 2019-nCoV is a sequence 1 in a sequence table;
or the encoding gene sequence of the envelope protein S formed by the chimeric extracellular region of the envelope protein S of 2019-nCoV and the transmembrane region and the intracellular region of the envelope protein S of SARS-CoV is a sequence 3 in the sequence table;
or the encoding gene sequence of the envelope protein S formed by the chimeric extracellular region of the envelope protein S of 2019-nCoV and the transmembrane region and the intracellular region of glycoprotein G of the vesicular stomatitis virus is the sequence 5 in the sequence table;
alternatively, the reporter gene is a GFP gene.
6. The recombinant vesicular stomatitis virus of claims 3 or 4, wherein: the 2019-nCoV is a 2019-nCoV Wuhan-Hu-1 strain;
or, the SARS-CoV is SARS-CoV BJ01 strain;
or, the vesicular stomatitis virus is a vesicular stomatitis virus Indiana strain.
7. The recombinant viral vector of claim 4.
8. Use of the recombinant vesicular stomatitis virus of any one of claims 1 to 6, or the recombinant viral vector of claim 7, in any one of X1) -X3) as follows:
x1) preparing a novel coronavirus vaccine;
x2) for the preparation of a product for the prevention and/or treatment of diseases caused by novel coronaviruses;
x3) screening for novel coronavirus invasion inhibitors.
9. Use according to claim 8, characterized in that: the novel coronavirus is 2019-nCoV;
or, the disease caused by the novel coronavirus is COVID-19 caused by the novel coronavirus.
10. A product for preventing and/or treating a disease caused by a novel coronavirus, which comprises the recombinant vesicular stomatitis virus of any one of claims 1 to 6 or the recombinant viral vector of claim 7 as an active ingredient.
11. The product of claim 10, wherein: the novel coronavirus is 2019-nCoV;
or, the disease caused by the novel coronavirus is COVID-19 caused by the novel coronavirus.
CN202011576878.1A 2020-03-16 2020-12-28 Novel recombinant coronavirus based on vesicular stomatitis virus vector, and preparation method and application thereof Active CN112941038B (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
CN202010180383 2020-03-16
CN2020101803830 2020-03-16

Publications (2)

Publication Number Publication Date
CN112941038A CN112941038A (en) 2021-06-11
CN112941038B true CN112941038B (en) 2021-11-09

Family

ID=76234931

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202011576878.1A Active CN112941038B (en) 2020-03-16 2020-12-28 Novel recombinant coronavirus based on vesicular stomatitis virus vector, and preparation method and application thereof

Country Status (2)

Country Link
CN (1) CN112941038B (en)
WO (1) WO2021184884A1 (en)

Families Citing this family (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN113559254B (en) * 2021-08-09 2023-02-10 苏州大学 Rabies virus vaccine and preparation method thereof
CN114149979A (en) * 2021-11-03 2022-03-08 中山大学肿瘤防治中心（中山大学附属肿瘤医院、中山大学肿瘤研究所） EBV vaccine based on vesicular stomatitis virus, and preparation method and application thereof
CN114427010A (en) * 2021-12-28 2022-05-03 云舟生物科技(广州)股份有限公司 Primer, kit and method for detecting titer of vesicular stomatitis virus
CN114262683B (en) * 2022-03-01 2022-06-17 中国科学院动物研究所 Bacterial preparation for expressing VEGFR 3D 2 polypeptide and construction method and application thereof

Family Cites Families (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN1590552A (en) * 2003-09-01 2005-03-09 北京大学 Recombination VSV virus carrier and recombination VSV virus and its preparation method and use
CN101007168B (en) * 2006-01-23 2010-06-09 北京大学 SARS vaccine and its preparation method
WO2013158263A1 (en) * 2012-04-18 2013-10-24 Mayo Foundation For Medical Education And Research Replication-competent vesicular stomatitis viruses
CN108715866B (en) * 2018-05-31 2021-02-05 中国科学院动物研究所 Recombinant virus vector, vaccine, preparation method and application thereof

Also Published As

Publication number Publication date
WO2021184884A1 (en) 2021-09-23
CN112941038A (en) 2021-06-11

Similar Documents

Publication Publication Date Title
CN112375748B (en) Novel coronavirus chimeric recombinant vaccine based on vesicular stomatitis virus vector, and preparation method and application thereof
CN112941038B (en) Novel recombinant coronavirus based on vesicular stomatitis virus vector, and preparation method and application thereof
CN108570479B (en) Method for mediating down producing goat VEGF gene fixed-point knock-in based on CRISPR/Cas9 technology
CN109563492B (en) Mutant viruses, methods of making and uses thereof
CN112779291B (en) Method for constructing high-quality pig nuclear transplantation donor cells with high lean meat percentage, fast growth, high reproductive capacity and resistance to series epidemic diseases and application thereof
CN112779292B (en) Method for constructing high-quality pig nuclear transplantation donor cells with high lean meat percentage and rapid growth and capable of resisting blue ear diseases and serial diarrhea diseases and application of donor cells
CN106957859A (en) It is a kind of to be used to save measles virus, the system and method for recombinant measles virus
US20030145345A1 (en) LexA DNA binding domain optimized for arabidopsis species
KR101970428B1 (en) Recombinant viral Viral serine Vaccine
CN112251464B (en) Gene point mutation induction method
CN112442515B (en) Application of gRNA target combination in construction of hemophilia model pig cell line
KR102027400B1 (en) Vaccination by means of recombinant yeast by producing a protective humoral immune response against defined antigens
CN112877362A (en) Gene editing system for constructing high-quality porcine nuclear transplantation donor cells with high fertility and capability of resisting porcine reproductive and respiratory syndrome and serial diarrhea diseases and application of gene editing system
CN107988253A (en) Applications of one people miRNA as PRRS virus mortifier
CN114107231B (en) Recombinant adeno-associated virus for realizing whole brain postsynaptic neuron cell body marking and application thereof
CN112725292B (en) AAV-HBV recombinant virus based on S gene breakage, method for establishing hepatitis B virus mouse model and application
CN112442513B (en) Cas9 overexpression vector and construction method and application thereof
CN109880837B (en) Method for degrading lignin in tobacco straw
CN112522313A (en) CRISPR/Cas9 system for constructing depression clone pig nuclear donor cell with TPH2 gene mutation
CN112522310B (en) CRISPR system and application thereof in construction of LRP5 gene mutant osteoporosis clone pig nuclear donor cell
CN112522292B (en) CRISPR/Cas9 system for constructing congenital amaranth clone pig nuclear donor cells and application thereof
CN112538497B (en) CRISPR/Cas9 system and application thereof in construction of alpha, beta and alpha &amp; beta thalassemia model pig cell lines
CN113774047B (en) Fish source protease gene and application thereof
CN112608941B (en) CRISPR system for constructing obese pig nuclear transplantation donor cells with MC4R gene mutation and application of CRISPR system
CN112575033B (en) CRISPR system and application thereof in construction of SCN1A gene mutated epileptic encephalopathy clone pig nuclear donor cell

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant