CN112538491A

CN112538491A - YH 66-08550 gene-based recombinant strain for producing L-isoleucine and construction method and application thereof

Info

Publication number: CN112538491A
Application number: CN202011589602.7A
Authority: CN
Inventors: 孟刚; 魏爱英; 赵春光; 杨立鹏; 贾慧萍; 苏厚波
Original assignee: Ningxia Eppen Biotech Co ltd
Current assignee: Ningxia Eppen Biotech Co ltd
Priority date: 2020-12-28
Filing date: 2020-12-28
Publication date: 2021-03-23
Anticipated expiration: 2040-12-28
Also published as: CN112538491B

Abstract

The invention discloses a YH 66-08550 gene-based recombinant strain for producing L-isoleucine and a construction method and application thereof. The present invention discovers that the product coded by the gene has influence on the L-isoleucine production capacity by knocking out the YH66_08550 gene, and obtains a recombinant strain by introducing a point mutation into a coding sequence, or increasing the copy number or overexpression of the gene, wherein the point mutation is that the 607 th base of the YH66_08550 gene sequence is mutated from guanine (G) to adenine (A), and the 203 th glutamic acid of the coded corresponding amino acid sequence is changed into lysine. The obtained strain is advantageous for producing L-isoleucine at a high concentration as compared with an unmodified strain.

Description

YH 66-08550 gene-based recombinant strain for producing L-isoleucine and construction method and application thereof

Technical Field

The invention belongs to the technical field of genetic engineering and microorganisms, and particularly relates to a YH 66-08550 gene-based recombinant strain for producing L-isoleucine, and a construction method and application thereof.

Background

FISCHER found substances with different optical rotation from L-leucine in protein hydrolysate for the first time in 1901, and L-isoleucine was produced. The L-isoleucine is one of the necessary branched amino acids in human and animal bodies, and has wide market and application prospects in the fields of food, livestock feed, medicine and the like. For example, the functional beverage added with L-isoleucine can effectively prevent muscle damage and improve the endurance of athletes; a proper amount of L-isoleucine is added into the feed of piglets, such as Mao Xiang Bing, so that the ileum barrier function of the piglets can be improved, and diarrhea diseases caused by rotavirus can be effectively prevented; the L-isoleucine can also promote the secretion of insulin in a human body under the synergistic action of glucose, so as to achieve the purpose of quickly reducing the blood sugar concentration in blood, thereby effectively preventing sudden hyperglycemia easily obtained by obese people.

L-isoleucine was first isolated from sugar beet syrup by EHRLICH in 1904. With the intensive and continuing research on the production of L-isoleucine, large-scale production of L-isoleucine has begun industrially. Compared with the method for producing L-isoleucine by using a protein hydrolysis method and a chemical synthesis method, the microbial fermentation method is green and environment-friendly in the production process, greatly reduces the cost, is easy to control the reaction, can be suitable for large-scale production, and is a main method for industrially producing L-isoleucine at present. The microbial fermentation method comprises a precursor addition fermentation method and a direct fermentation method. The precursor added fermentation method can directly participate in the synthesis of L-isoleucine as an intermediate metabolite, so that the feedback regulation effect on key enzymes in the L-isoleucine biosynthesis pathway is small, and the final product can be generated quickly, but the precursor is expensive and is not suitable for large-scale industrial fermentation. Compared with the fermentation method by adding precursors, the direct fermentation method has much lower cost for producing L-isoleucine, and can be adopted by most enterprises for producing L-isoleucine.

The L-isoleucine-producing strains are mainly Corynebacterium glutamicum (Corynebacterium glutamicum) and Escherichia coli (Escherichia coli). Corynebacterium glutamicum has the characteristics of no endotoxin, less metabolic isozymes, contribution to releasing feedback inhibition or transcription attenuation, strong feedback inhibition resistance of key metabolic enzymes and the like, so most researchers tend to research Corynebacterium glutamicum and subspecies thereof, such as Brevibacterium flavum (Brevibacterium flavum), Brevibacterium lactofermentum (Brevibacterium lactofermentum) and the like. The breeding of excellent strains is still the key of high-yield L-isoleucine, and with the development of high-throughput screening technology, the traditional mutagenesis technology is combined, which is helpful for finding out high-yield L-isoleucine mutant strains with unknown characters.

Although some strains have been screened for improved L-isoleucine production, more L-isoleucine-producing mutants still need to be found to meet the increasing demand.

Disclosure of Invention

In view of the disadvantages of the prior art, the present invention provides a polynucleotide and a recombinant strain containing the polynucleotide, and the recombinant strain is used for improving the L-isoleucine-producing ability of bacteria. In order to achieve the above objects, the inventors of the present invention have studied and found that a recombinant strain having an increased L-isoleucine-producing ability, which is stronger than an unmodified wild-type strain, can be obtained by modifying or improving the expression of YH66_08550 gene (GenBank: AKF27595.1) in the genome of Corynebacterium glutamicum ATCC15168 (GenBank: CP011309.1) having an L-isoleucine-producing ability.

The invention is realized by adopting the following technical scheme:

in a first aspect of the present invention, there is provided an L-isoleucine producing bacterium having improved expression of a polynucleotide encoding an amino acid sequence shown as SEQ ID NO. 3. According to the invention, the improved expression is that the expression of the polynucleotide is enhanced, or that the polynucleotide encoding the amino acid sequence of SEQ ID NO. 3 has a point mutation and that the expression is enhanced.

The amino acid sequence of SEQ ID NO. 3 is the protein encoded by gene YH66_ 08550.

The bacterium has an enhanced L-isoleucine-producing ability as compared with an unmodified strain.

In the present invention, the term "bacterium having an L-isoleucine-producing ability" refers to a bacterium having an ability to produce and accumulate L-isoleucine of interest in a medium and/or cells of the bacterium to such an extent that the L-isoleucine can be collected when the bacterium is cultured in the medium. The bacterium having an L-isoleucine-producing ability may be a bacterium capable of accumulating L-isoleucine of interest in a culture medium and/or cells of the bacterium in a larger amount than that obtainable from an unmodified strain.

The term "unmodified strain" refers to a control strain that has not been modified in a manner such that it has particular characteristics. That is, examples of the unmodified strain include a wild-type strain and a parent strain.

In the present invention, the term "L-isoleucine" means L-isoleucine in a free form, a salt thereof or a mixture thereof, unless otherwise specified.

The polynucleotide may encode an amino acid sequence having about 90% or greater, about 92% or greater, about 95% or greater, about 97% or greater, about 98% or greater, or about 99% or greater sequence homology to the amino acid sequence of SEQ ID NO. 3. As used herein, the term "homology" refers to the percent identity between two polynucleotides or two polypeptide modules. Sequence homology between one module and another can be determined by using methods known in the art. Such sequence homology can be determined, for example, by the BLAST algorithm.

Expression of the polynucleotide may be enhanced as follows: expression of regulatory sequences by substitution or mutation, introduction of mutation into polynucleotide sequences, increase in the copy number of polynucleotides by introduction via chromosomal insertion or vectors, or combinations thereof, and the like.

The expression regulatory sequence of the polynucleotide may be modified. Expression regulatory sequences control the expression of the polynucleotide to which they are operably linked and may include, for example, promoters, terminators, enhancers, silencers, and the like. The polynucleotide may have a change in the initiation codon. The polynucleotides may be incorporated into specific sites of the chromosome, thereby increasing copy number. Herein, the specific site may include, for example, a transposon site or an intergenic site. Alternatively, the polynucleotide may be incorporated into an expression vector, which is introduced into a host cell, thereby increasing copy number.

In one embodiment of the invention, the copy number is increased by incorporating the polynucleotide or a polynucleotide having a point mutation into a specific site of the chromosome of the microorganism.

In one embodiment of the invention, the nucleic acid sequence is overexpressed by incorporating a polynucleotide with a promoter sequence or a polynucleotide with a point mutation with a promoter sequence into a specific site of the chromosome of the microorganism.

In one embodiment of the invention, the polynucleotide or the polynucleotide having a point mutation is incorporated into an expression vector, and the expression vector is introduced into a host cell, thereby increasing the copy number.

In one embodiment of the invention, the polynucleotide with a promoter sequence or the polynucleotide with a point mutation with a promoter sequence is incorporated into an expression vector, and the expression vector is introduced into a host cell, thereby overexpressing the amino acid sequence.

In one embodiment of the invention, the polynucleotide may comprise the nucleotide sequence of SEQ ID NO. 1.

In one embodiment of the present invention, the polynucleotide encoding the amino acid sequence of SEQ ID NO. 3 has a point mutation such that the 203 rd glutamic acid of the amino acid sequence of SEQ ID NO. 3 is substituted with a different amino acid.

According to the present invention, it is preferred that the 203 rd glutamic acid is replaced with lysine.

According to the present invention, the amino acid sequence shown in SEQ ID NO. 3, wherein the amino acid sequence in which the 203 rd glutamic acid is substituted with lysine, is shown in SEQ ID NO. 4.

In one embodiment of the present invention, the polynucleotide sequence having a point mutation is formed by mutation at the 607 th base of the polynucleotide sequence shown in SEQ ID NO. 1.

According to the invention, the mutation comprises a mutation of guanine (G) to adenine (A) at base position 607 of the polynucleotide sequence shown in SEQ ID NO. 1.

In one embodiment of the present invention, the polynucleotide sequence having a point mutation comprises the polynucleotide sequence shown in SEQ ID NO. 2.

As used herein, the term "operably linked" refers to a functional linkage between a regulatory sequence and a polynucleotide sequence, whereby the regulatory sequence controls transcription and/or translation of the polynucleotide sequence. The regulatory sequence may be a strong promoter capable of increasing the expression level of the polynucleotide. The regulatory sequence may be a promoter derived from a microorganism belonging to the genus Corynebacterium or may be a promoter derived from other microorganisms. For example, the promoter may be trc promoter, gap promoter, tac promoter, T7 promoter, lac promoter, trp promoter, araBAD promoter, or cj7 promoter.

In a specific embodiment of the present invention, the promoter is the promoter of the polynucleotide encoding the amino acid sequence of SEQ ID NO. 3 (YH 66-08550).

As used herein, the term "vector" refers to a polynucleotide construct containing the regulatory sequences of a gene and the gene sequences and configured to express a target gene in a suitable host cell. Alternatively, a vector may in turn be a polynucleotide construct containing sequences useful for homologous recombination, so that the regulatory sequences of an endogenous gene in the genome of a host cell may be altered or a target gene which may be expressed may be inserted into a specific site in the genome of a host cell as a result of the vector introduced into the host cell. In this regard, the vector used in the present invention may further comprise a selection marker to determine the introduction of the vector into the host cell or the insertion of the vector into the chromosome of the host cell. The selection marker may comprise a marker that confers a selectable phenotype, such as drug resistance, auxotrophy, resistance to a cytotoxic agent, or expression of a surface protein. In the context of treatment with such a selection agent, transformed cells may be selected as cells that only express the selection marker may survive or display a different phenotypic trait.

In some embodiments of the invention, the vector used is the pK18mobsacB plasmid, the pXMJ19 plasmid.

As used herein, the term "transformation" refers to the introduction of a polynucleotide into a host cell such that the polynucleotide can replicate as an extra-genomic element or as an insert into the genome of the host cell. The method of transforming the vector used in the present invention may include a method of introducing a nucleic acid into a cell. In addition, as disclosed in the related art, the electric pulse method may be performed depending on the host cell.

According to the present invention, the bacterium may be a microorganism belonging to the genus Corynebacterium, such as Corynebacterium acetoacidophilum (Corynebacterium acetoacidophilum), Corynebacterium acetoglutamicum (Corynebacterium acetobacter), Corynebacterium melaleucum (Corynebacterium callunae), Corynebacterium glutamicum (Corynebacterium glutamicum), Brevibacterium flavum, Brevibacterium lactofermentum, Corynebacterium ammoniagenes (Corynebacterium ammoniagenes), Corynebacterium beijerinckii (Corynebacterium pekinense), Brevibacterium saccharolyticum (Brevibacterium saccharolyticum), Brevibacterium roseum (Brevibacterium roseum), Brevibacterium thiogenes (Brevibacterium thiogenes), and the like.

In one embodiment of the present invention, the microorganism belonging to the genus Corynebacterium is Corynebacterium glutamicum ATCC 15168.

In one embodiment of the present invention, the microorganism belonging to the genus Corynebacterium is Corynebacterium glutamicum YPILE001, which has been deposited at the general microbiological culture Collection center of the China Committee for culture Collection of microorganisms at 17.08.2020 at the following deposition address: west road No. 1, north chen, chaoyang district, beijing, zip code: 100101, preservation organization abbreviation: CGMCC, with the biological preservation number of CGMCC No. 20437.

In a second aspect of the invention, there is provided a polynucleotide sequence, an amino acid sequence encoded by the polynucleotide sequence, a recombinant vector comprising the polynucleotide sequence, a recombinant strain comprising the polynucleotide sequence.

According to the present invention, the polynucleotide sequence includes a polynucleotide encoding a polypeptide having an amino acid sequence shown in SEQ ID NO. 3 in which glutamic acid at position 203 is substituted with a different amino acid.

According to the present invention, it is preferred that the 203 rd glutamic acid is replaced with lysine. .

According to the present invention, it is preferred that the polynucleotide sequence encoding a polypeptide comprising the amino acid sequence shown in SEQ ID NO. 3 comprises the polynucleotide sequence shown in SEQ ID NO. 1.

In one embodiment of the present invention, the polynucleotide sequence is formed by mutation at base 607 of the polynucleotide sequence shown in SEQ ID NO. 1.

According to the present invention, the mutation refers to a change in the base/nucleotide at the site, and the mutation method may be at least one selected from the group consisting of mutagenesis, PCR site-directed mutagenesis, and/or homologous recombination. In the present invention, PCR site-directed mutagenesis and/or homologous recombination are preferably used.

According to the invention, the mutation comprises a mutation of guanine (G) to adenine (A) at position 607 of the polynucleotide sequence shown in SEQ ID NO. 1.

In one embodiment of the invention, the polynucleotide sequence comprises the polynucleotide sequence shown in SEQ ID NO. 2.

According to the invention, the amino acid sequence comprises the amino acid sequence shown as SEQ ID NO. 4.

According to the invention, the recombinant vector is constructed by introducing the polynucleotide sequence into a plasmid.

In one embodiment of the invention, the plasmid is a pK18mobsacB plasmid.

In another embodiment of the invention, the plasmid is the pXMJ19 plasmid.

In particular, the polynucleotide sequence and the plasmid may be constructed into a recombinant vector by a NEBuider recombination system.

According to the invention, said recombinant strain contains said polynucleotide sequence.

As an embodiment of the invention, the germination bacteria of the recombinant strain is Corynebacterium glutamicum YPILE001, and the biological preservation number is CGMCC No. 20437.

As an embodiment of the present invention, the recombinant strain has an outgrowth of ATCC 15168.

In a third aspect of the present invention, there are provided the above polynucleotide sequence, an amino acid sequence encoded by the polynucleotide sequence, a recombinant vector comprising the polynucleotide sequence, and the use of a recombinant strain comprising the polynucleotide sequence for the production of L-isoleucine.

In the fourth aspect of the invention, a method for constructing a recombinant strain which can generate L-isoleucine is also provided.

According to the invention, the construction method comprises the following steps:

the polynucleotide sequence of the wild type YH66_08550 gene shown as SEQ ID NO. 1 in the host strain is transformed, so that the 607 th base of the polynucleotide sequence is mutated, and the recombinant strain containing the mutant YH66_08550 encoding gene is obtained.

According to the construction method of the invention, the modification comprises at least one of mutagenesis, PCR site-directed mutagenesis, homologous recombination and the like.

According to the construction method of the invention, the mutation is that the 607 th base in SEQ ID NO. 1 is mutated from guanine (G) to adenine (A); specifically, the polynucleotide sequence of the gene encoding mutant YH66_08550 is shown as SEQ ID NO. 2.

Further, the construction method comprises the following steps:

(1) modifying the nucleotide sequence of a wild YH66_08550 gene shown as SEQ ID NO. 1 to make the 607 th base of the gene mutated to obtain the mutated YH66_08550 gene polynucleotide sequence;

(2) connecting the mutated polynucleotide sequence with a plasmid to construct a recombinant vector;

(3) and (3) introducing the recombinant vector into a host strain to obtain the recombinant strain containing the mutant YH 66-08550 encoding gene.

According to the construction method of the present invention, the step (1) includes: construction of point-mutated YH66_08550 Gene: synthesizing two pairs of primers P1 and P2 and P3 and P4 for amplifying YH66_08550 gene fragment according to the genome sequence of an unmodified strain, introducing point mutation in the wild type YH66_08550 gene SEQ ID NO:1 by a PCR (polymerase chain reaction) site-directed mutagenesis method to obtain the nucleotide sequence SEQ ID NO:2 of the point-mutated YH66_08550 gene, which is marked as YH66_08550^G607A。

In one embodiment of the present invention, the genome of the unmodified strain may be derived from ATCC15168 strain, whose genome sequence GenBank: CP011309.1 may be obtained from the NCBI website.

In one embodiment of the present invention, in the step (1), the primers are:

P1:5'CAGTGCCAAGCTTGCATGCCTGCAGGTCGACTCTAGGTTACTCGTTAA GGAAGC 3'(SEQ ID NO:5)

P2:5'TCTACAGTGCCCTCCGCAGCAATCGCAGGCCTCAAAG 3'(SEQ ID NO: 6)

P3:5'CTTTGAGGCCTGCGATTGCTGCGGAGGGCACTGTAGA3'(SEQ ID NO: 7)

P4:5'CAGCTATGACCATGATTACGAATTCGAGCTCGGTACCCCATTGAGCAA GCTTTGAAC3'(SEQ ID NO:8)

in one embodiment of the invention, the PCR amplification is performed as follows: pre-denaturation at 94 ℃ for 5min, denaturation at 94 ℃ for 30s, annealing at 52 ℃ for 30s, and extension at 72 ℃ for 40s (30 cycles), and over-extension at 72 ℃ for 10 min.

In one embodiment of the invention, the overlapping PCR amplification is performed as follows: pre-denaturation at 94 ℃ for 5min, denaturation at 94 ℃ for 30s, annealing at 52 ℃ for 30s, and extension at 72 ℃ for 90s (30 cycles), and over-extension at 72 ℃ for 10 min.

According to the construction method of the present invention, the step (2) comprises construction of a recombinant plasmid comprising: separating and purifying YH66_08550^G607AAnd pK18mobsacB plasmid, and assembling through a NEBuider recombination system to obtain a recombinant plasmid.

According to the construction method of the present invention, the step (3) includes constructing a recombinant strain, and transforming the recombinant plasmid into a host strain to obtain the recombinant strain.

In one embodiment of the present invention, the conversion of step (3) is an electrical conversion process.

In one embodiment of the present invention, the host strain is ATCC 15168.

In one embodiment of the invention, the host strain is Corynebacterium glutamicum YPILE001 with the biological collection number of CGMCC No. 20437.

In one embodiment of the invention, the recombination is effected by homologous recombination.

In the fifth aspect of the present invention, there is also provided a method for constructing a recombinant strain that produces L-isoleucine.

the upstream and downstream homologous arm fragment of YH66_08550, the coding region of YH66_08550 gene and its promoter region sequence were amplified, and YH66_08550 or YH66_08550 was introduced into the genome of the host strain by homologous recombination^G607AGenes to achieve overexpression of YH66_08550 or YH66_08550 in said strains^G607AA gene.

In one embodiment of the invention, the primers for amplifying the upstream homology arm fragments are:

P7:5'CAGTGCCAAGCTTGCATGCCTGCAGGTCGACTCTAGGAAGGAAAAA AGCTTCTC3'(SEQ ID NO:11)

P8:5'CATCTCAGAAGAACACTAAACTAAGATGGTGAAACGG3'(SEQ ID NO: 12)

in one embodiment of the invention, the primers for amplifying the downstream homology arm fragments are:

P11:5'GAGTGATGTGAGAACCCAACACATGACCAACTAAGGC 3'(SEQ ID NO:15)

P12:5'CAGCTATGACCATGATTACGAATTCGAGCTCGGTACCCCGTCAACAC CAATTTCAG 3'(SEQ ID NO:16)

in one embodiment of the present invention, the primers for amplifying the coding region of the gene and the sequence of its promoter region are:

P9:5'CCGTTTCACCATCTTAGTTTAGTGTTCTTCTGAGATG 3'(SEQ ID NO: 13)

P10:5'GCCTTAGTTGGTCATGTGTTGGGTTCTCACATCACTC 3'(SEQ ID N O:14)

in one embodiment of the present invention, the integrated homologous arm fragment is obtained by amplifying the three amplified fragments of the upstream homologous arm fragment, the downstream homologous arm fragment, the gene coding region and the promoter region sequence fragment thereof by using the P7/P12 as primers.

In one embodiment of the present invention, a PCR system is used: 10 XEx Taq Buffer 5. mu.L, dNTP mix (2.5 mM each) 4. mu.L, Mg²⁺4. mu.L (25mM), 2. mu.L each of primers (10. mu.M), 0.25. mu.L of Ex Taq (5U/. mu.L), and a total volume of 50. mu.L; PCR amplification was performed as follows: pre-denaturation at 94 ℃ for 5min, denaturation at 94 ℃ for 30s, annealing at 52 ℃ for 30s, extension at 72 ℃ for 180s (30 cycles), and over-extension at 72 ℃ for 10 min.

In one embodiment of the present invention, shuttle plasmid PK18mobsacB and the integration homology arm fragment were assembled using the NEBuider recombination system to obtain an integrated plasmid.

In one embodiment of the present invention, the integration plasmid is transfected into the host strain, and YH 66-08550 or YH 66-08550 is introduced into the genome of the host strain by homologous recombination^G607AA gene.

In one embodiment of the invention, the host strain is Corynebacterium glutamicum YPILE001 with the biological collection number CGMCC No. 20437.

In one embodiment of the present invention, the host strain is ATCC 15168.

In one embodiment of the present invention, the host strain is a strain carrying the polynucleotide sequence shown in SEQ ID NO. 2.

In the sixth aspect of the invention, a method for constructing a recombinant strain for producing L-isoleucine is also provided.

amplification of coding region and promoter region sequences of YH66_08550 Gene, or YH66_08550^G607AGene coding region and promoter region sequence, constructing over-expression plasmid vector, transferring the vector into host strain to realize the over-expression of YH 66-08550 or YH 66-08550^G607AA gene.

P17:5'GCTTGCATGCCTGCAGGTCGACTCTAGAGGATCCCCTTAGTGTTCTTCT GAGATG 3'(SEQ ID NO:21)

P18:5'ATCAGGCTGAAAATCTTCTCTCATCCGCCAAAACTTGGGTTCTCACAT CACTC 3'(SEQ ID NO:22)。

in one embodiment of the present invention, the PCR system: 10 XEx Taq Buffer 5. mu.L, dNTP mix (2.5 mM each) 4. mu.L, Mg²⁺4. mu.L (25mM), 2. mu.L each of primers (10. mu.M), 0.25. mu.L of Ex Taq (5U/. mu.L), and a total volume of 50. mu.L; the PCR amplification was performed as follows: pre-denaturation at 94 ℃ for 5min, denaturation at 94 ℃ for 30s, annealing at 52 ℃ for 30s, extension at 72 ℃ for 120s (30 cycles), and over-extension at 72 ℃ for 10 min.

In one embodiment of the present invention, shuttle plasmid pXMJ19 and YH66_08550 or YH66_08550 with their own promoter were ligated using the NEBuider recombination system^G607AAssembling the fragments to obtain an overexpression plasmid.

In one embodiment of the present invention, the host strain is ATCC 15168.

The recombinant strain obtained by the invention can be independently applied to the fermentation production of L-isoleucine, and can also be mixed with other L-isoleucine-producing bacteria for fermentation production of L-isoleucine.

Another aspect of the present invention provides a method for producing L-isoleucine, which comprises culturing said bacterium; and obtaining L-isoleucine from the culture.

The cultivation of the bacteria may be carried out in a suitable medium under culture conditions known in the art. The culture medium may comprise: carbon sources, nitrogen sources, trace elements, and combinations thereof. In the culture, the pH of the culture may be adjusted. Further, prevention of bubble generation, for example, by using an antifoaming agent, may be included in the culture. In addition, the culturing may include injecting a gas into the culture. The gas may include any gas capable of maintaining aerobic conditions of the culture. In the culture, the temperature of the culture may be 20 to 45 ℃. The produced L-isoleucine can be recovered from the culture by treating the culture with sulfuric acid or hydrochloric acid or the like, followed by a combination of methods such as anion exchange chromatography, concentration, crystallization and isoelectric precipitation.

The invention has the advantages of

According to the invention, through knocking out YH66_08550 gene, the encoded product of the gene is found to influence the L-isoleucine production capacity, and through introducing point mutation into a coding sequence, or increasing the copy number or overexpression of the gene, a recombinant strain is obtained, and compared with an unmodified strain, the obtained strain is favorable for producing high-concentration L-isoleucine.

Biological preservation Instructions

Corynebacterium glutamicum (Corynebacterium glutamicum), which is deposited in the China general microbiological culture Collection center, with the deposition address: west road No. 1, north chen, chaoyang district, beijing, zip code: 100101, preservation organization abbreviation: CGMCC, the preservation date is 2020, 08 and 17 days, the biological preservation number is CGMCC number 20437, and the strain is named: YPILE 001.

Detailed Description

The technical solution of the present invention will be further described in detail with reference to specific embodiments. It is to be understood that the following examples are only illustrative and explanatory of the present invention and should not be construed as limiting the scope of the present invention. All the technologies realized based on the above-mentioned contents of the present invention are covered in the protection scope of the present invention.

Unless otherwise indicated, the raw materials and reagents used in the following examples are all commercially available products or can be prepared by known methods. Experimental procedures without specific conditions noted in the following examples, molecular cloning is generally performed according to conventional conditions such as Sambrook et al: the conditions described in the Laboratory Manual (New York: Cold Spring Harbor Laboratory Press,1989), or according to the manufacturer's recommendations.

Unless defined otherwise or clearly indicated by the background, all technical and scientific terms used in this disclosure have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs.

The basic culture medium used for culturing the strain in the following examples has the same composition, and correspondingly required sucrose, kanamycin or chloramphenicol and the like are added to the basic culture medium, and the basic culture medium has the following composition:

TABLE 1 composition of solid media

Composition (I)	Formulation of
		Glucose	5g/L
Polypeptone	10g/L
		Beef extract	10g/L
Yeast powder	5g/L
		Sodium chloride	55g/L
Agar powder	20g/L
		pH (NaOH adjusted)	7.0
Culture conditions	31℃

Example 1 construction of transformation vector pK18-YH66_08550 containing the coding region of the Point-mutated YH66_08550 Gene^G607A

According to the NCBI published Corynebacterium glutamicum ATCC15168 genome (GenBank: CP011309.1) sequence, two pairs of primers for amplifying YH66_08550 gene (GenBank: AKF27595.1) coding region sequence were designed and synthesized, point mutations were introduced in the strain ATCC15168 and Corynebacterium glutamicum YPILE001 (organism accession No. CGMCC No.20437) with high yield of L-isoleucine by allelic replacement, and guanine (G) at position 607 of nucleotide sequence of gene YH66_08550 corresponding to amino acid sequence of encoded protein SEQ ID NO:3 was changed to adenine (A) (SEQ ID NO: 2: YH66_08550)^G607A) The amino acid sequence corresponding to the encoded protein had the amino acid sequence changed from glutamic acid (E) to lysine (K) at position 203 (SEQ ID NO: 4: YH66_08550^E203K). The primers were designed as follows (Shanghai invitrog)en synthesis):

P1:5'CAGTGCCAAGCTTGCATGCCTGCAGGTCGACTCTAGGTTACTCGTTAA GGAAGC 3'(SEQ ID NO:5)

P2:5'TCTACAGTGCCCTCCGCAGCAATCGCAGGCCTCAAAG 3'(SEQ ID N O:6)

P3:5'CTTTGAGGCCTGCGATTGCTGCGGAGGGCACTGTAGA 3'(SEQ ID N O:7)

P4:5'CAGCTATGACCATGATTACGAATTCGAGCTCGGTACCCCATTGAGCAA GCTTTGAAC3'(SEQ ID NO:8)

the construction method comprises the following steps: PCR amplification was carried out using Corynebacterium glutamicum ATCC15168 as a template and primers P1 and P2, and P3 and P4, respectively.

And (3) PCR system: 10 XEx Taq Buffer 5. mu.L, dNTP mix (2.5 mM each) 4. mu.L, Mg²⁺mu.L (25mM), 2. mu.L each of primers (10pM), 0.25. mu.L of Ex Taq (5U/. mu.L), and a total volume of 50. mu.L.

The PCR amplification was performed as follows: pre-denaturation at 94 ℃ for 5min, denaturation at 94 ℃ for 30s, annealing at 52 ℃ for 30s, extension at 72 ℃ for 40s (30 cycles), and over-extension at 72 ℃ for 10min to obtain two DNA fragments (YH 66-08550) with the sizes of 733bp and 708bp respectively and containing coding regions of YH 66-08550 gene^G607AUp and YH66_08550^G607A-Down)。

YH66_08550^G607AUp and YH66_08550^G607A-Down after separation and purification by agarose gel electrophoresis; then using the two DNA fragments as templates and P1 and P4 as primers, amplifying YH66_08550 with a length of about 1441bp by overlap PCR^G607A-Up-Down fragment.

The PCR amplification was performed as follows: pre-denaturation at 94 ℃ for 5min, denaturation at 94 ℃ for 30s, annealing at 52 ℃ for 30s, extension at 72 ℃ for 90s (30 cycles), and over-extension at 72 ℃ for 10 min.

This DNA fragment resulted in the conversion of guanine (G) at position 607 of the coding region of YH66_08550 gene of the mutagenized strain Corynebacterium glutamicum YPILE001 (accession number CGMCC No.20437) of ATCC15168 to adenine (A), and finally in the conversion of amino acid 203 of the encoded protein from glutamic acid (E) to lysine (K).

The pK18mobsacB plasmid (from Addgene) was digested with XbaI and purified by agarose gel electrophoresis to isolate YH 66-08550^G607AThe plasmid of-Up-Down and linearized pK18mobsacB is assembled by a NEBuider recombination system to obtain a vector pK18-YH66_08550^G607AThe plasmid contains a kanamycin resistance marker. And the vector p K18-YH66_08550^G607ASequencing and identifying by a sequencing company, and carrying out sequencing identification on the vector pK18-YH66_08550 containing the correct point mutation (C-T)^G607AAnd (5) storing for later use.

Example 2 construction of YH66_08550 comprising a Point mutation^G607AOf (4) an engineered strain

The construction method comprises the following steps: the allele substitution plasmid pK18-YH66_08550^G607ATransforming into Corynebacterium glutamicum YPILE001 (organism preservation number is CGMCC No.20437) with high L-isoleucine yield by electric shock; the single colony produced by the culture is respectively identified by the primer P1 and the universal primer M13R, and the strain which can amplify the band with the size of about 1441bp is a positive strain. Culturing the positive strain on a culture medium containing 15% of sucrose; the strains that were cultured and produced single colonies were cultured on kanamycin-containing and kanamycin-free media, respectively, and grown on kanamycin-free media, but not grown on kanamycin-containing media were further subjected to PCR identification using the following primers (synthesized by Shanghai invitrogen Co.):

P5:5'CAAACTGTCCGTAGGACTGG 3'(SEQ ID NO:9)

P6:5'ATCTGGGCACTCATCGAAG3'(SEQ ID NO:10)

the PCR amplification product was subjected to sscp electrophoresis (plasmid pK18-YH 66-08550) after high temperature denaturation and ice-bath^G607AThe amplified fragment is a positive control, the amplified fragment of ATCC15168 is a negative control, and water is used as a blank control). due to the different fragment structures and different electrophoresis positions, the strain with the fragment electrophoresis position inconsistent with the position of the negative control fragment and consistent with the position of the positive control fragment is a strain with successful allelic replacement. The target fragment of the successful strain is replaced by the allele through PCR amplification again by using the primers P5 and P6, and is connected to PMD19-T vector for sequencing, and the sequence is determined by aligning the base sequencesWhether the replacement was successful; and the mutant strain which is successfully replaced by Corynebacterium glutamicum YPILE001 (biological preservation number is CGMCC No.20437) which has high isoleucine yield is named YPI 007.

TABLE 2 preparation of PAGE by sscp electrophoresis

Example 3 construction of genome overexpression of YH66_08550 or YH66_08550^G607AEngineered strains of genes

Three pairs of primers for amplifying upstream and downstream homologous arm fragments and sequences of coding regions and promoter regions of YH66_08550 gene are designed and synthesized according to the genome (GenBank: CP011309.1) sequence of Corynebacterium glutamicum ATCC15168 published by NCBI, and YH66_08550 or YH66_08550 is introduced into strain Corynebacterium glutamicum YPILE001 (biological collection number CGMCC number 20437) by homologous recombination^G607AA gene.

The primers were designed as follows (synthesized by Shanghai Invitrogen corporation):

P7:5'CAGTGCCAAGCTTGCATGCCTGCAGGTCGACTCTAGGAAGGAAAAA AGCTTCTC3'

P8:5'CATCTCAGAAGAACACTAAACTAAGATGGTGAAACGG3'

P9:5'CCGTTTCACCATCTTAGTTTAGTGTTCTTCTGAGATG3'

P10:5'GCCTTAGTTGGTCATGTGTTGGGTTCTCACATCACTC 3'

P11:5'GAGTGATGTGAGAACCCAACACATGACCAACTAAGGC3'

P12:5'CAGCTATGACCATGATTACGAATTCGAGCTCGGTACCCCGTCAACACC AATTTCAG 3'

the construction method comprises the following steps: PCR amplification was performed using Corynebacterium glutamicum ATCC15168 or YPI007 as template and primers P7/P8, P9/P10, and P11/P12, respectively, to obtain upstream homology arm fragments of about 804bp, YH66_08550, or YH66_08550^G607AAbout 866bp of gene fragment and about 759bp of downstream homology arm fragment, and P7/P12 as primerAnd (3) mixing the three amplified fragments as a template for amplification to obtain integrated homologous arm fragments. After the PCR reaction is finished, carrying out electrophoretic recovery on the amplified product, recovering a required DNA fragment of about 2429bp by using a column type DNA gel recovery kit, and connecting a NEBuider recombination system with a shuttle plasmid pk18mobsacB recovered by XbaI enzyme digestion to obtain an integrated plasmid pk18mobsacB-YH66_08550 or pk18mobsacB-YH66_08550^G607AThe plasmid contains a kanamycin resistance marker, and recombinants with the plasmid integrated on the genome can be obtained by kanamycin screening.

The PCR amplification was performed as follows: pre-denaturation at 94 ℃ for 5min, denaturation at 94 ℃ for 30s, annealing at 52 ℃ for 30s, extension at 72 ℃ for 180s (30 cycles), and over-extension at 72 ℃ for 10 min.

Respectively and electrically transforming the 2 integration plasmids into Corynebacterium glutamicum YPILE001 (biological preservation number is CGMCC number 20437), carrying out PCR identification on a single colony generated by culture by using a P13/P14 primer, and carrying out PCR amplification to obtain a positive strain containing a fragment with the size of about 960bp, wherein the strain without the amplified fragment is a protobacteria. The positive strains were screened with 15% sucrose, cultured on kanamycin-containing and kanamycin-free media, respectively, grown on kanamycin-free media, and the strains that did not grow on kanamycin-containing media were further identified by PCR using primers P15/P16, whereby the strain with a size of about 944bp, YH 66-08550 or YH 66-08550, was amplified^G607AThe strain with the gene integrated into the genome of the strain Corynebacterium glutamicum YPILE001 (biological preservation number CGMCC No.20437) was named YPI-008 (without mutation point) and YPI-009 (with mutation point).

P13:5'ATCGGCATTTTCACAGCGC 3'

P14:5'ATGCCATGCGTGAAGCTTTG 3'

P15:5'ATAGCCGGTGTTGTGGAGG 3'

P16:5'CTGGGTCCACAGGCTTTTC 3'

Example 4 overexpression of YH66_0855 on the plasmid constructed0 or YH66_08550^G607AEngineered strains of genes

A pair of primers for amplifying the sequences of the coding region and the promoter region of YH66_08550 gene were designed and synthesized based on the sequence of Corynebacterium glutamicum ATCC15168 genome (GenBank: CP011309.1) published by NCBI, and the primers were designed as follows (synthesized by Shanghai invitrogen corporation):

P17:5'GCTTGCATGCCTGCAGGTCGACTCTAGAGGATCCCCTTAGTGTTCTTC TGAGATG3'

P18:5'ATCAGGCTGAAAATCTTCTCTCATCCGCCAAAACTTGGGTTCTCACAT CACTC 3'

the construction method comprises the following steps: PCR amplification with ATCC15168 or YPI007 as template and primer P17/P18 to obtain YH66_08550 or YH66_08550^G607AThe gene fragment is about 901bp, the amplified product is subjected to electrophoretic recovery, a column type DNA gel recovery kit is adopted to recover the required 901bp DNA fragment, a NEBuider recombination system is adopted to be connected with a shuttle plasmid pXMJ19 which is subjected to EcoRI enzyme digestion and recovery, and an over-expression plasmid pXMJ19-YH 66-08550 or pXMJ19-YH 66-08550 is obtained^G607A. The plasmid contains a chloramphenicol resistance marker, and the plasmid obtained by chloramphenicol screening can be transformed into a strain.

The PCR amplification was performed as follows: pre-denaturation at 94 ℃ for 5min, denaturation at 94 ℃ for 30s, annealing at 52 ℃ for 30s, extension at 72 ℃ for 120s (30 cycles), and over-extension at 72 ℃ for 10 min.

The plasmids are respectively transformed into Corynebacterium glutamicum YPILE001 (biological preservation number is CGMCC No.20437), single colonies generated by culture are identified by PCR through M13R (-48) and P18 primers, and the single colonies amplified by PCR contain a fragment with the size of about 920bp and are taken as a transfused strain which is named YPI-010 (without point mutation) and YPI-011 (with point mutation).

Example 5 construction of engineered Strain with deletion of YH66_08550 Gene on genome

Two pairs of primers for amplifying fragments at both ends of the coding region of YH66_08550 gene were synthesized as upstream and downstream homology arm fragments based on the genomic sequence of Corynebacterium glutamicum ATCC15168 (GenBank: CP011309.1) published by NCBI. The primers were designed as follows (synthesized by shanghai handsome corporation):

P19:5'CAGTGCCAAGCTTGCATGCCTGCAGGTCGACTCTAGAGTGCTGCCC ATACTCATG 3'

P20:5'GATAAGGATCAACGAATAAAAGTCCCCGCCACCTCCTCAA 3'

P21:5'GTTGAGGAGGTGGCGGGGACTTTTATTCGTTGATCCTTATC 3'

P22:5'CAGCTATGACCATGATTACGAATTCGAGCTCGGTACCCGCTCCGCCAA CTGCATCAC3'

PCR amplification was performed using Corynebacterium glutamicum ATCC15168 as a template and primers P19/P20 and P21/P22, respectively, to obtain the upstream homology arm fragment 911bp and the downstream homology arm fragment 728 bp. Then OVER PCR was performed with primers P19/P22 to obtain 1639bp of the entire homologous arm fragment. And after the PCR reaction is finished, carrying out electrophoretic recovery on the amplified product, recovering a required 1639bp DNA fragment by using a column type DNA gel recovery kit, and connecting the recovered shuttle plasmid pk18mobsacB plasmid subjected to XbaI enzyme digestion through a NEBuider recombination system to obtain a knocked-out plasmid. The plasmid contains a kanamycin resistance marker.

The knockout plasmid is electrically transformed into Corynebacterium glutamicum YPILE001 (biological preservation number is CGMCC No.20437), and the single colony generated by culture is respectively identified by PCR through the following primers (synthesized by Shanghai Yingjun company):

P23:5'GCGCTGACTATGCAGATTC 3'

P24:5'AAACTCGACC TTCACGTC 3'

the strains with bands of about 1639bp and about 2469bp amplified by the PCR are positive strains, and the strains with the bands of 2469bp only amplified are spawns. The positive strain is screened on a 15% sucrose culture medium, then is respectively cultured on a culture medium containing kanamycin and a culture medium not containing kanamycin, and grows on the culture medium not containing kanamycin, and the strain which does not grow on the culture medium containing kanamycin is further subjected to PCR identification by adopting a P23/P24 primer, so that the strain with 1639bp band is a genetically engineered strain with YH66_08550 gene coding region being knocked out, and the strain is named YPI-012.

Example 6L-isoleucine fermentation experiment

The strains constructed in examples 2 to 5 and Corynebacterium glutamicum YPILE001 (organism accession number CGMCC No.20437) were subjected to fermentation experiments in a BLBIO-5GC-4-H type fermenter (available from Bailan Biotech Co., Ltd., Shanghai) using the media shown in Table 3 and the fermentation control process shown in Table 4. Each strain was replicated three times, and the results are shown in Table 5.

TABLE 3 fermentation Medium formulation

Composition (I)	Formulation (g/L)
		Glucose	90
Ammonium sulfate	12
		Magnesium sulfate	0.87
Potassium dihydrogen sulfate	2
		Acidified corn steep liquor	3mL/L
Yeast powder	4
		Defoaming agent (2% foam)	4mL/L
VB₁	0.006
		VH	0.003
Biotin	0.088

TABLE 4 fermentation control Process

TABLE 5 results of L-isoleucine fermentation experiments

As shown in Table 5, the coding region of YH66_08550 gene was point-mutated to YH66_08550 in Corynebacterium glutamicum YPILE001 (accession number: CGMCC No.20437), an engineered bacterium capable of producing isoleucine^G607AAll contribute to the improvement of L-isoleucine production; overexpression of YH66_08550, YH66_08550^G607AIs helpful for improving the yield of L-isoleucine, and is not beneficial to the accumulation of L-isoleucine when the gene is weakened or knocked out.

The embodiments of the present invention have been described above. However, the present invention is not limited to the above embodiment. Any modification, equivalent replacement, or improvement made within the spirit and principle of the present invention should be included in the protection scope of the present invention.

Sequence listing

<110> Ningxia Yipin Biotechnology Ltd

<120> recombinant strain capable of producing L-isoleucine based on YH 66-08550 gene as well as construction method and application thereof

<160> 28

<170> SIPOSequenceListing 1.0

<210> 1

<211> 831

<212> DNA

<213> Corynebacterium glutamicum (Corynebacterium glutamicum)

<400> 1

ttgggttctc acatcactca ccgggcggcc gtactcggct cacccatcga gcattccaaa 60

tccccagtcc tccacaacac cggctataaa gccctcggac tggaccaatg ggaatacgac 120

cgctttgagt gcaccggcga catgctcccc ggaatcgtct ccggcgctga tgaaacctac 180

cgcggattct ccgtcaccat gccgtccaaa ttcgcagccc tcgaattcgc cgacgaagta 240

accgaacgcg cccgcgccat cggctccgca aacacacttc tgcgcaccga aaccggatgg 300

cgcgcagaca acaccgacgt cgacggcatc aggggagccc tcggtgaact cctcggcggc 360

gcatcactgt ccggcaaaca cgccatcgtc atcggctccg gcggcaccgc acgtcccgcc 420

atctgggcac tcatcgaagc cggggtcgcc cgcatcacgg tgctcaaccg ctccgatcgc 480

accgccgaac tgcaaacgct tttcgacgaa acccccacca ccttggccta cgccccgctc 540

gagcatctcc acatcgaagc cgacgtcgta gtctctacag tgccctccgc agcaatcgca 600

ggcctcgaag acacccttgc gatcgcccca gtcctcgacg tcatctacga cccctggcca 660

acaccactcg tagaagtcac acgagccaaa ggcctcaaag ctgtcggagg ccacgtcatg 720

ctggcacacc agtcctacgg acagtttgaa caattcaccg gaatggatgc accccgcgat 780

gccatgcgtg aagctttgga agagtcttta ggcatctcag aagaacacta a 831

<210> 2

<211> 831

<212> DNA

<213> Corynebacterium glutamicum (Corynebacterium glutamicum)

<400> 2

ttgggttctc acatcactca ccgggcggcc gtactcggct cacccatcga gcattccaaa 60

tccccagtcc tccacaacac cggctataaa gccctcggac tggaccaatg ggaatacgac 120

cgctttgagt gcaccggcga catgctcccc ggaatcgtct ccggcgctga tgaaacctac 180

cgcggattct ccgtcaccat gccgtccaaa ttcgcagccc tcgaattcgc cgacgaagta 240

accgaacgcg cccgcgccat cggctccgca aacacacttc tgcgcaccga aaccggatgg 300

cgcgcagaca acaccgacgt cgacggcatc aggggagccc tcggtgaact cctcggcggc 360

gcatcactgt ccggcaaaca cgccatcgtc atcggctccg gcggcaccgc acgtcccgcc 420

atctgggcac tcatcgaagc cggggtcgcc cgcatcacgg tgctcaaccg ctccgatcgc 480

accgccgaac tgcaaacgct tttcgacgaa acccccacca ccttggccta cgccccgctc 540

gagcatctcc acatcgaagc cgacgtcgta gtctctacag tgccctccgc agcaatcgca 600

ggcctcaaag acacccttgc gatcgcccca gtcctcgacg tcatctacga cccctggcca 680

acaccactcg tagaagtcac acgagccaaa ggcctcaaag ctgtcggagg ccacgtcatg 720

ctggcacacc agtcctacgg acagtttgaa caattcaccg gaatggatgc accccgcgat 780

gccatgcgtg aagctttgga agagtcttta ggcatctcag aagaacacta a 831

<210> 3

<211> 276

<212> PRT

<213> Corynebacterium glutamicum (Corynebacterium glutamicum)

<400> 3

Met Gly Ser His Ile Thr His Arg Ala Ala Val Leu Gly Ser Pro Ile

1 5 10 15

Glu His Ser Lys Ser Pro Val Leu His Asn Thr Gly Tyr Lys Ala Leu

20 25 30

Gly Leu Asp Gln Trp Glu Tyr Asp Arg Phe Glu Cys Thr Gly Asp Met

35 40 45

Leu Pro Gly Ile Val Ser Gly Ala Asp Glu Thr Tyr Arg Gly Phe Ser

50 55 60

Val Thr Met Pro Ser Lys Phe Ala Ala Leu Glu Phe Ala Asp Glu Val

65 70 75 80

Thr Glu Arg Ala Arg Ala Ile Gly Ser Ala Asn Thr Leu Leu Arg Thr

85 90 95

Glu Thr Gly Trp Arg Ala Asp Asn Thr Asp Val Asp Gly Ile Arg Gly

100 105 110

Ala Leu Gly Glu Leu Leu Gly Gly Ala Ser Leu Ser Gly Lys His Ala

115 120 125

Ile Val Ile Gly Ser Gly Gly Thr Ala Arg Pro Ala Ile Trp Ala Leu

130 135 140

Ile Glu Ala Gly Val Ala Arg Ile Thr Val Leu Asn Arg Ser Asp Arg

145 150 155 160

Thr Ala Glu Leu Gln Thr Leu Phe Asp Glu Thr Pro Thr Thr Leu Ala

165 170 175

Tyr Ala Pro Leu Glu His Leu His Ile Glu Ala Asp Val Val Val Ser

180 185 190

Thr Val Pro Ser Ala Ala Ile Ala Gly Leu Glu Asp Thr Leu Ala Ile

195 200 205

Ala Pro Val Leu Asp Val Ile Tyr Asp Pro Trp Pro Thr Pro Leu Val

210 215 220

Glu Val Thr Arg Ala Lys Gly Leu Lys Ala Val Gly Gly His Val Met

225 230 235 240

Leu Ala His Gln Ser Tyr Gly Gln Phe Glu Gln Phe Thr Gly Met Asp

245 250 255

Ala Pro Arg Asp Ala Met Arg Glu Ala Leu Glu Glu Ser Leu Gly Ile

260 265 270

Ser Glu Glu His

275

<210> 4

<211> 276

<212> PRT

<213> Corynebacterium glutamicum (Corynebacterium glutamicum)

<400> 4

Met Gly Ser His Ile Thr His Arg Ala Ala Val Leu Gly Ser Pro Ile

1 5 10 15

Glu His Ser Lys Ser Pro Val Leu His Asn Thr Gly Tyr Lys Ala Leu

20 25 30

Gly Leu Asp Gln Trp Glu Tyr Asp Arg Phe Glu Cys Thr Gly Asp Met

35 40 45

Leu Pro Gly Ile Val Ser Gly Ala Asp Glu Thr Tyr Arg Gly Phe Ser

50 55 60

Val Thr Met Pro Ser Lys Phe Ala Ala Leu Glu Phe Ala Asp Glu Val

65 70 75 80

Thr Glu Arg Ala Arg Ala Ile Gly Ser Ala Asn Thr Leu Leu Arg Thr

85 90 95

Glu Thr Gly Trp Arg Ala Asp Asn Thr Asp Val Asp Gly Ile Arg Gly

100 105 110

Ala Leu Gly Glu Leu Leu Gly Gly Ala Ser Leu Ser Gly Lys His Ala

115 120 125

Ile Val Ile Gly Ser Gly Gly Thr Ala Arg Pro Ala Ile Trp Ala Leu

130 135 140

Ile Glu Ala Gly Val Ala Arg Ile Thr Val Leu Asn Arg Ser Asp Arg

145 150 155 160

Thr Ala Glu Leu Gln Thr Leu Phe Asp Glu Thr Pro Thr Thr Leu Ala

165 170 175

Tyr Ala Pro Leu Glu His Leu His Ile Glu Ala Asp Val Val Val Ser

180 185 190

Thr Val Pro Ser Ala Ala Ile Ala Gly Leu Lys Asp Thr Leu Ala Ile

195 200 205

Ala Pro Val Leu Asp Val Ile Tyr Asp Pro Trp Pro Thr Pro Leu Val

210 215 220

Glu Val Thr Arg Ala Lys Gly Leu Lys Ala Val Gly Gly His Val Met

225 230 235 240

Leu Ala His Gln Ser Tyr Gly Gln Phe Glu Gln Phe Thr Gly Met Asp

245 250 255

Ala Pro Arg Asp Ala Met Arg Glu Ala Leu Glu Glu Ser Leu Gly Ile

260 265 270

Ser Glu Glu His

275

<210> 5

<211> 54

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

cagtgccaag cttgcatgcc tgcaggtcga ctctaggtta ctcgttaagg aagc 54

<210> 6

<211> 37

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

tctacagtgc cctccgcagc aatcgcaggc ctcaaag 37

<210> 7

<211> 37

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

ctttgaggcc tgcgattgct gcggagggca ctgtaga 37

<210> 8

<211> 57

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

cagctatgac catgattacg aattcgagct cggtacccca ttgagcaagc tttgaac 57

<210> 9

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

caaactgtcc gtaggactgg 20

<210> 10

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

atctgggcac tcatcgaag 19

<210> 11

<211> 54

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 11

cagtgccaag cttgcatgcc tgcaggtcga ctctaggaag gaaaaaagct tctc 54

<210> 12

<211> 37

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 12

catctcagaa gaacactaaa ctaagatggt gaaacgg 37

<210> 13

<211> 37

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 13

ccgtttcacc atcttagttt agtgttcttc tgagatg 37

<210> 14

<211> 37

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 14

gccttagttg gtcatgtgtt gggttctcac atcactc 37

<210> 15

<211> 37

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 15

gagtgatgtg agaacccaac acatgaccaa ctaaggc 37

<210> 16

<211> 56

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 16

cagctatgac catgattacg aattcgagct cggtaccccg tcaacaccaa tttcag 56

<210> 17

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 17

atcggcattt tcacagcgc 19

<210> 18

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 18

atgccatgcg tgaagctttg 20

<210> 19

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 19

atagccggtg ttgtggagg 19

<210> 20

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 20

ctgggtccac aggcttttc 19

<210> 21

<211> 55

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 21

gcttgcatgc ctgcaggtcg actctagagg atccccttag tgttcttctg agatg 55

<210> 22

<211> 53

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 22

atcaggctga aaatcttctc tcatccgcca aaacttgggt tctcacatca ctc 53

<210> 23

<211> 55

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 23

cagtgccaag cttgcatgcc tgcaggtcga ctctagagtg ctgcccatac tcatg 55

<210> 24

<211> 40

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 24

gataaggatc aacgaataaa agtccccgcc acctcctcaa 40

<210> 25

<211> 41

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 25

gttgaggagg tggcggggac ttttattcgt tgatccttat c 41

<210> 26

<211> 57

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 26

cagctatgac catgattacg aattcgagct cggtacccgc tccgccaact gcatcac 57

<210> 27

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 27

gcgctgacta tgcagattc 19

<210> 28

<211> 18

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 28

aaactcgacc ttcacgtc 18

Claims

1. A polynucleotide comprising a polynucleotide encoding an amino acid sequence shown in SEQ ID No. 3 wherein glutamic acid at position 203 is substituted with a different amino acid; preferably the glutamic acid at position 203 is substituted with lysine;

preferably, the polynucleotide comprises a polynucleotide encoding an amino acid sequence shown in SEQ ID NO. 4;

preferably, the polynucleotide is formed by mutation of 607 th base of the polynucleotide sequence shown in SEQ ID NO. 1; preferably, the mutation is that the 607 th base of the polynucleotide sequence shown in SEQ ID NO. 1 is mutated from guanine (G) to adenine (A);

preferably, the polynucleotide comprises the polynucleotide sequence shown in SEQ ID NO. 2.

2. A protein is characterized in that the amino acid sequence of the protein is shown as SEQ ID NO. 4.

3. A recombinant vector comprising the polynucleotide of claim 1.

4. A recombinant strain comprising the polynucleotide of claim 1.

5. Use of the polynucleotide of claim 1, the protein of claim 2, the recombinant vector of claim 3, the recombinant strain of claim 4 for the production of L-isoleucine.

6. An L-isoleucine producing bacterium having improved expression of a polynucleotide having an amino acid sequence encoding SEQ ID NO. 3;

preferably, the improved expression is an increased expression of the polynucleotide encoding the amino acid sequence of SEQ ID NO. 3, or the polynucleotide encoding the amino acid sequence of SEQ ID NO. 3 has a point mutation and the expression is increased.

7. The bacterium of claim 6, wherein the polynucleotide encoding the amino acid sequence of SEQ ID NO. 3 is point mutated such that the glutamic acid at position 203 of the amino acid sequence of SEQ ID NO. 3 is substituted with a different amino acid; preferably, the glutamic acid at position 203 is substituted with lysine.

8. The bacterium of claim 6 or 7, wherein the polynucleotide encoding the amino acid sequence of SEQ ID NO. 3 comprises the nucleotide sequence of SEQ ID NO. 1.

9. The bacterium of any one of claims 6 to 8, wherein the polynucleotide sequence having point mutations is formed by mutation of base 607 of the polynucleotide sequence shown in SEQ ID NO. 1;

preferably, the mutation comprises that the 607 th base of the polynucleotide sequence shown in SEQ ID NO. 1 is mutated from guanine (G) to adenine (A);

preferably, the polynucleotide sequence having point mutations comprises the polynucleotide sequence shown in SEQ ID NO. 2.

10. The bacterium according to any one of claims 6 to 9, wherein said bacterium is a bacterium of the genus Corynebacterium, preferably Corynebacterium acetoacidophilum (Corynebacterium acetoacidophilum), Corynebacterium acetoglutamicum (Corynebacterium acetoglutacter), Corynebacterium glutamicum (Corynebacterium glutamicum), Brevibacterium flavum (Brevibacterium flavum), Brevibacterium lactofermentum (Brevibacterium lactofermentum), Corynebacterium ammoniagenes (Corynebacterium ammoniagenes), Corynebacterium pekinense (Corynebacterium pekinense), Brevibacterium saccharolyticum (Brevibacterium saccharolyticum), Brevibacterium roseum (Brevibacterium roseum), Brevibacterium thionasum (Brevibacterium thiogenitalis); preferably Corynebacterium glutamicum YPILE001, with the biological collection number CGMCC No.20437, or Corynebacterium glutamicum ATCC 13869.