CN112626098A

CN112626098A - Recombinant strain for modifying kgd gene, construction method thereof and application of recombinant strain for producing L-isoleucine

Info

Publication number: CN112626098A
Application number: CN202011447112.3A
Authority: CN
Inventors: 孟刚; 魏爱英; 杨立鹏; 赵春光; 马风勇; 周晓群; 贾慧萍; 苏厚波
Original assignee: Ningxia Eppen Biotech Co ltd
Current assignee: Ningxia Eppen Biotech Co ltd
Priority date: 2020-12-11
Filing date: 2020-12-11
Publication date: 2021-04-09

Abstract

The present invention provides a method for introducing point mutations into or improving the expression of the coding sequence of the kgd gene in coryneform bacteria, which allows strains carrying such mutations to increase the fermentation yield of L-isoleucine. The point mutation is to mutate cytosine (C) at position 2425 of the kgd gene sequence into thymine (T), so that the glutamic acid at position 809 of the corresponding encoded amino acid sequence is replaced by lysine.

Description

Recombinant strain for modifying kgd gene, construction method thereof and application of recombinant strain for producing L-isoleucine

Technical Field

The invention belongs to the technical field of genetic engineering and microorganisms, and particularly relates to a recombinant strain for producing L-isoleucine, a construction method and application thereof.

Background

L-isoleucine is one of eight essential amino acids in human body, and is one of three branched chain amino acids, and has a particularly important position in human life metabolism due to its special structure and function. L-isoleucine is also the most expensive one of the twenty amino acids, and is mainly used for preparing compound amino acid preparations, in particular for high-branched chain amino acid infusion and oral liquid.

Generally, microbial fermentation processes are used to produce various amino acids, and methods for improving the performance properties of these microorganisms include mutagenesis, selection of mutants, and screening. The strains obtained in this way are resistant to antimetabolites or auxotrophic for metabolites of regulatory importance and produce L-amino acids and the like.

In domestic research, the institute of microbiology of the Chinese academy of sciences reports the breeding of L-isoleucine-producing bacteria for the first time in 1976, the L-isoleucine acid yield is 1.0%, and later scholars reform the strain and the acid yield is improved to 1.4%.

Although there are many methods for improving L-isoleucine-producing ability, there is a need for developing a method for producing L-isoleucine in order to meet the increasing demand.

Disclosure of Invention

The object of the present invention is to provide a recombinant strain having L-isoleucine-producing ability, thereby providing a method for efficiently producing L-isoleucine.

In order to achieve the above object, the inventors of the present invention have found through studies that a kgd gene (also referred to as odh gene in the literature, but annotated as kgd gene in NCBI Genbank) in a bacterium having no L-isoleucine-producing ability shows an effective L-isoleucine-producing ability by modifying the gene or improving its expression. Based on these findings, the present invention has been completed.

The invention provides a polynucleotide sequence which comprises a polynucleotide for encoding a polypeptide of an amino acid sequence shown in SEQ ID NO. 3 or a homologous sequence thereof, wherein the 809 th glutamic acid in the amino acid sequence is replaced by different amino acids.

According to the invention, the glutamic acid at position 809 is preferably replaced by lysine.

According to the invention, the amino acid sequence shown in SEQ ID NO. 3, wherein the amino acid sequence of which 809 th glutamic acid is replaced by lysine is shown in SEQ ID NO. 4.

According to the present invention, it is preferred that the polynucleotide sequence encoding a polypeptide comprising the amino acid sequence shown in SEQ ID NO. 3 comprises the polynucleotide sequence shown in SEQ ID NO. 1.

In one embodiment of the present invention, the polynucleotide sequence of the present invention is formed by mutation at base 2425 of the polynucleotide sequence shown in SEQ ID NO. 1.

According to the present invention, the mutation refers to a change in the base/nucleotide at the site, and the mutation method may be at least one selected from the group consisting of mutagenesis, PCR site-directed mutagenesis, and/or homologous recombination. In the present invention, PCR site-directed mutagenesis and/or homologous recombination are preferably used.

According to the invention, the mutation comprises the mutation of the 2425 th cytosine (C) of the polynucleotide sequence shown in SEQ ID NO. 1 into thymine (T).

In one embodiment of the present invention, the polynucleotide sequence of the present invention comprises the polynucleotide sequence shown in SEQ ID NO. 2.

The invention also provides an amino acid sequence which comprises the amino acid sequence of SEQ ID NO. 3 or a homologous sequence thereof, and the 809 th glutamic acid of the amino acid sequence is replaced by different amino acids.

The invention also provides a recombinant vector, which is constructed by introducing the polynucleotide sequence into a plasmid.

In one embodiment of the invention, the plasmid is a pK18mobsacB plasmid.

In another embodiment of the invention, the plasmid is the pXMJ19 plasmid.

In particular, the polynucleotide sequence and the plasmid may be constructed into a recombinant vector by a NEBuider recombination system.

The present invention also provides a recombinant strain having improved expression of a polynucleotide encoding the amino acid sequence of SEQ ID NO. 3 or a homologous sequence thereof.

According to the invention, the improved expression is an increased expression of the polynucleotide, or the polynucleotide encoding the amino acid sequence of SEQ ID NO. 3 or a homologous sequence thereof has a point mutation and the expression is increased.

In one embodiment of the invention, the improved expression of the polynucleotide is the introduction of a point mutation into the polynucleotide encoding the amino acid sequence of SEQ ID NO. 3 or a homologous sequence thereof. In particular, the polynucleotides of the invention have the point mutations described hereinbefore.

In one embodiment of the present invention, the polynucleotide sequence expression enhancement is an increase in the copy number of a polynucleotide into which a polynucleotide encoding the amino acid sequence of SEQ ID NO. 3 or a homologous sequence thereof or a polynucleotide having a point mutation as described hereinbefore in the present invention is introduced via chromosomal insertion or a vector.

In one embodiment of the present invention, the polynucleotide encoding the amino acid sequence of SEQ ID NO. 3 or a homologous sequence thereof having a promoter sequence or the polynucleotide having a point mutation is incorporated into a specific site of a chromosome of a microorganism to overexpress the nucleic acid sequence.

In one embodiment of the invention, the polynucleotide encoding the amino acid sequence of SEQ ID NO. 3 with a promoter sequence or a homologous sequence thereof or the polynucleotide having point mutations is incorporated into an expression vector, and the expression vector is introduced into a host cell, thereby overexpressing the amino acid sequence.

In one embodiment of the invention, the polynucleotide sequence expression enhancement is the incorporation of a polynucleotide having a point mutation into an expression vector, which is introduced into a host cell, thereby increasing the copy number.

The recombinant strain according to the present invention is an embodiment of the present invention, wherein the recombinant vector is introduced into a host strain, and the host strain is ATCC 15168.

As one embodiment of the invention, the host bacterium of the recombinant strain is CGMCC NO.20437 with high isoleucine yield.

In the present invention, the CGMCC NO.20437 information is as follows:

corynebacterium glutamicum (Corynebacterium glutamicum) YPILE001

The strain name is as follows: corynebacterium glutamicum

Latin name: (Corynebacterium glutamicum)

The strain number is as follows: YPILE001

The preservation organization: china general microbiological culture Collection center

The preservation organization is abbreviated as: CGMCC (China general microbiological culture Collection center)

Address: xilu No. 1 Hospital No. 3 of Beijing market facing Yang district

The preservation date is as follows: year 2020, 8 and 17

Registration number of the preservation center: CGMCC No.20437

In the present invention, the term "bacterium having an L-isoleucine-producing ability" refers to a bacterium having an ability to produce and accumulate L-isoleucine of interest in a medium and/or cells of the bacterium to such an extent that the L-isoleucine can be collected when the bacterium is cultured in the medium. The bacterium having an L-isoleucine-producing ability may be a bacterium capable of accumulating L-isoleucine of interest in a culture medium and/or cells of the bacterium in a larger amount than that obtainable from an unmodified strain.

The term "unmodified strain" refers to a control strain that has not been modified in a manner such that it has particular characteristics. That is, examples of the unmodified strain include a wild-type strain and a parent strain.

The bacterium having L-isoleucine-producing ability may be a bacterium capable of accumulating target L-isoleucine in the medium in an amount of preferably 0.5g/L or more, more preferably 1.0g/L or more.

In the present invention, the term "L-isoleucine" means L-isoleucine in a free form, a salt thereof or a mixture thereof, unless otherwise specified.

The polynucleotide may encode an amino acid sequence having about 90% or greater, about 92% or greater, about 95% or greater, about 97% or greater, about 98% or greater, or about 99% or greater sequence homology to the amino acid sequence of SEQ ID NO. 3. As used herein, the term "homology" refers to the percent identity between two polynucleotides or two polypeptide modules. Sequence homology between one module and another can be determined by using methods known in the art. Such sequence homology can be determined, for example, by the BLAST algorithm.

Expression of the polynucleotide may be enhanced as follows: expression of regulatory sequences by substitution or mutation, introduction of mutation into polynucleotide sequences, increase in the copy number of polynucleotides by introduction via chromosomal insertion or vectors, or combinations thereof, and the like.

The expression regulatory sequence of the polynucleotide may be modified. Expression regulatory sequences control the expression of the polynucleotide to which they are operably linked and may include, for example, promoters, terminators, enhancers, silencers, and the like. The polynucleotide may have a change in the initiation codon. The polynucleotides may be incorporated into specific sites of the chromosome, thereby increasing copy number. Herein, the specific site may include, for example, a transposon site or an intergenic site. Alternatively, the polynucleotide may be incorporated into an expression vector, which is introduced into a host cell, thereby increasing copy number.

As used herein, the term "operably linked" refers to a functional linkage between a regulatory sequence and a polynucleotide sequence, whereby the regulatory sequence controls transcription and/or translation of the polynucleotide sequence. The regulatory sequence may be a strong promoter capable of increasing the expression level of the polynucleotide. The regulatory sequence may be a promoter derived from a microorganism belonging to the genus Corynebacterium or may be a promoter derived from other microorganisms. For example, the promoter may be trc promoter, gap promoter, tac promoter, T7 promoter, lac promoter, trp promoter, araBAD promoter, or cj7 promoter.

In a specific embodiment of the present invention, the promoter is the promoter of the polynucleotide (kgd gene) encoding the amino acid sequence of SEQ ID NO. 3.

As used herein, the term "vector" refers to a polynucleotide construct containing the regulatory sequences of a gene and the gene sequences and configured to express a target gene in a suitable host cell. Alternatively, a vector may in turn be a polynucleotide construct containing sequences useful for homologous recombination, so that the regulatory sequences of an endogenous gene in the genome of a host cell may be altered or a target gene which may be expressed may be inserted into a specific site in the genome of a host cell as a result of the vector introduced into the host cell. In this regard, the vector used in the present invention may further comprise a selection marker to determine the introduction of the vector into the host cell or the insertion of the vector into the chromosome of the host cell. The selection marker may comprise a marker that confers a selectable phenotype, such as drug resistance, auxotrophy, resistance to a cytotoxic agent, or expression of a surface protein. In the context of treatment with such a selection agent, transformed cells may be selected as cells that only express the selection marker may survive or display a different phenotypic trait.

In some embodiments of the invention, the vector used is the pK18mobsacB plasmid, the pXMJ19 plasmid.

As used herein, the term "transformation" refers to the introduction of a polynucleotide into a host cell such that the polynucleotide can replicate as an extra-genomic element or as an insert into the genome of the host cell. The method of transforming the vector used in the present invention may include a method of introducing a nucleic acid into a cell. In addition, as disclosed in the related art, the electric pulse method may be performed depending on the host cell.

According to the present invention, the host bacterium may be a microorganism belonging to the genus Corynebacterium, such as Corynebacterium acetoacidophilum (Corynebacterium acetoacidophilum), Corynebacterium acetoglutamicum (Corynebacterium acetobacter), Corynebacterium melaleucum (Corynebacterium callunae), Corynebacterium glutamicum (Corynebacterium glutamicum), Brevibacterium flavum, Brevibacterium lactofermentum (Brevibacterium lactofermentum), Corynebacterium ammoniagenes (Corynebacterium ammoniagenes), Corynebacterium pekinense (Corynebacterium pekinense), Brevibacterium saccharolyticum (Brevibacterium saccharolyticum), Brevibacterium roseum (Brevibacterium roseum), Brevibacterium thiogenes (Brevibacterium thiogenes), and the like.

In one embodiment of the present invention, the microorganism belonging to the genus Corynebacterium is ATCC 15168.

In one embodiment of the present invention, the microorganism belonging to the genus Corynebacterium is CGMCC NO.20437 highly producing isoleucine

According to the invention, the bacteria may also have further improvements associated with increased production of L-isoleucine, for example, enhanced or reduced expression of the activity of enzymes such as threonine deaminase, acetohydroxyacid synthase, etc., or of genes, or may have genes replaced by foreign genes.

The invention also provides a construction method of the recombinant strain for generating the L-isoleucine.

According to the invention, the construction method comprises the following steps:

the polynucleotide sequence of the wild type kgd gene shown as SEQ ID NO. 1 in the host strain is modified to cause the 2425 th base of the host strain to generate mutation, thus obtaining the recombinant strain containing the mutant kgd coding gene.

According to the construction method of the invention, the modification comprises at least one of mutagenesis, PCR site-directed mutagenesis, homologous recombination and the like.

According to the construction method of the invention, the mutation is that the 2425 th base in SEQ ID NO. 1 is mutated from cytosine (C) to thymine (T); specifically, the polynucleotide sequence containing the mutant kgd encoding gene is shown as SEQ ID NO. 2.

Further, the construction method comprises the following steps:

(1) modifying the nucleotide sequence of the wild type kgd gene shown as SEQ ID NO. 1 to cause the 2425 th base of the wild type kgd gene to generate mutation so as to obtain a mutated kgd gene polynucleotide sequence;

(2) connecting the mutated polynucleotide sequence with a plasmid to construct a recombinant vector;

(3) and (3) introducing the recombinant vector into a host strain to obtain the recombinant strain containing the mutant kgd coding gene.

According to the construction method of the present invention, the step (1) includes: construction of a point-mutated kgd Gene: synthesizing two pairs of primers P1 and P2, P3 and P4 for amplifying the kgd gene fragment according to the genome sequence of an unmodified strain, introducing point mutation in the wild-type kgd gene SEQ ID NO 1 by a PCR (polymerase chain reaction) site-directed mutagenesis method to obtain a gene nucleotide sequence SEQ ID NO 2 marked as kgd^C2425T。

In one embodiment of the invention, the unmodified strain genome may be derived from the ATCC15168 strain, the genomic sequence of which may be obtained from the NCBI website.

In one embodiment of the present invention, in the step (1), the primers are:

P1:5'CAGTGCCAAGCTTGCATGCCTGCAGGTCGACTCTAGTTGTTACGCAGCATGGAC 3'(SEQ ID NO:5)

P2:5'CCAGATGGAA TCTGTGTTCA ACGAAGTCAA GAAAGGC 3'(SEQ ID NO:6)

P3:5'GCCT TTCTTGACTT CGTTGAACACAGATTCCATC TGG 3'(SEQ ID NO:7)

P4:5'CAGCTATGACCATGATTACGAATTCGAGCTCGGTACCCTTTGAAGGCC AAATGGAG3'(SEQ ID NO:8)

in one embodiment of the invention, the PCR amplification is performed as follows: pre-denaturation at 94 ℃ for 5min, denaturation at 94 ℃ for 30s, annealing at 52 ℃ for 30s, and extension at 72 ℃ for 40s, 30 cycles, and over-extension at 72 ℃ for 10 min.

In one embodiment of the invention, the overlapping PCR amplification is performed as follows: pre-denaturation at 94 ℃ for 5min, denaturation at 94 ℃ for 30s, annealing at 52 ℃ for 30s, and extension at 72 ℃ for 90s, 30 cycles, and over-extension at 72 ℃ for 10 min.

According to the construction method of the present invention, the step (2) comprises construction of a recombinant plasmid comprising: the kgd after separation and purification^C2425TAnd pK18mobsacB plasmid, and assembling through a NEBuider recombination system to obtain a recombinant plasmid.

According to the construction method of the present invention, the step (3) includes constructing a recombinant strain, and transforming the recombinant plasmid into a host strain to obtain the recombinant strain.

In one embodiment of the present invention, the conversion of step (3) is an electrical conversion process.

In one embodiment of the present invention, the host strain is ATCC 15168.

In one embodiment of the present invention, the host strain is CGMCC NO.20437 which produces isoleucine at a high yield.

In one embodiment of the invention, the recombination is effected by homologous recombination.

The invention also provides a construction method of another recombinant strain for generating L-isoleucine.

amplifying upstream and downstream homologous arm fragments of kgd, coding region of kgd gene and promoter region sequence thereof, and introducing kgd into genome of host strain by homologous recombination^C2425TGenes to achieve overexpression of kgd by said strain^C2425TA gene.

In one embodiment of the invention, the primers for amplifying the upstream homology arm fragments are:

P7:5'CAGTGCCAAGCTTGCATGCCTGCAGGTCGACTCTAGGTTGGTATTGATGTCGCAG3'(SEQ ID NO:11)

P8:5'GAGGCTTTCGAGGCTTAATGGACTTCCTAAAGAGGG3'(SEQ ID NO:12)

in one embodiment of the invention, the primers for amplifying the downstream homology arm fragments are:

P11:5'GTTCTCCTAAAAATAACGTGAGTATTTGGGGTAGCTATC 3'(SEQ ID NO:15)

P12:5'CAGCTATGACCATGATTACGAATTCGAGCTCGGTACCCCGACCTGATTCAAAGCCTC 3'(SEQ ID NO:16)

in one embodiment of the present invention, the primers for amplifying the coding region of the gene and the sequence of its promoter region are:

P9:5'CCCTCTTTAGGAAGTCCATTAAGCCTCGAAAGCCTC3'(SEQ ID NO:13)

P10:5'GATAGCTACCCCAAATACTCACGTTATTTTTAGGAGAAC 3'(SEQ IDNO:14)

in one embodiment of the present invention, the integrated homologous arm fragment is obtained by amplifying the three amplified fragments of the upstream homologous arm fragment, the downstream homologous arm fragment, the gene coding region and the promoter region sequence fragment thereof by using the P7/P12 as primers.

In one embodiment of the present invention, a PCR system is used: 10 XEx Taq Buffer 5. mu.L, dNTP mix (2.5 mM each) 4. mu.L, Mg²⁺4. mu.L (25mM), 2. mu.L each of primers (10pM), 0.25. mu.L of Ex Taq (5U/. mu.L), and a total volume of 50. mu.L; PCR amplification was performed as follows: pre-denaturation at 94 ℃ for 5min, denaturation at 94 ℃ for 30s, annealing at 52 ℃ for 30s, and extension at 72 ℃ for 180s, for 30 cycles, and over-extension at 72 ℃ for 10 min.

In one embodiment of the present invention, shuttle plasmid PK18mobsacB and the integration homology arm fragment were assembled using the NEBuider recombination system to obtain an integrated plasmid.

In one embodiment of the invention, the integration plasmid is transfected into a host strain and kgd is introduced into the genome of the host strain by homologous recombination^C2425TA gene.

In one embodiment of the present invention, the host strain is ATCC 15168.

In one embodiment of the present invention, the host strain is a strain carrying the polynucleotide sequence shown in SEQ ID NO. 2.

The invention also provides a construction method of an additional recombinant strain for producing L-isoleucine.

amplification of kgd^C2425TGene coding region and promoter region sequence, constructing over-expression plasmid vector, transferring the vector into host strain to realize the over-expression kgd of the strain^C2425TA gene.

P17:5'GCTTGCATGCCTGCAGGTCGACTCTAGAGGATCCCCTTAAGCCTCGAAAGCCTC3'(SEQ ID NO:21)

P18:5'ATCAGGCTGAAAATCTTCTCTCATCCGCCAAAACCACGTTATTTTTAGGAGAAC 3'(SEQ ID NO:22)。

in one embodiment of the present invention, the PCR system: 10 XEx Taq Buffer 5. mu.L, dNTP mix (2.5 mM each) 4. mu.L, Mg²⁺4. mu.L (25mM), 2. mu.L each of primers (10pM), 0.25. mu.L of ExTaq (5U/. mu.L), and a total volume of 50. mu.L; the PCR amplification was performed as follows: pre-denaturation at 94 ℃ for 5min, denaturation at 94 ℃ for 30s, annealing at 52 ℃ for 30s, extension at 72 ℃ for 120s, 30 cycles, and over-extension at 72 ℃ for 10 min.

In one embodiment of the invention, the shuttle plasmid pXMJ19 and kgd with its own promoter were ligated using the NEBuider recombination system^C2425TAssembling the fragments to obtain an overexpression plasmid.

In one embodiment of the present invention, the host strain is ATCC 15168.

The recombinant strain obtained by the invention can be independently applied to the fermentation production of L-isoleucine, and can also be mixed with other L-isoleucine-producing bacteria for fermentation production of L-isoleucine.

Another aspect of the present invention provides a method for producing L-isoleucine, which comprises culturing the recombinant strain; and obtaining L-isoleucine from the culture.

The invention also provides application of the polynucleotide sequence, the amino acid sequence, the recombinant vector and the recombinant strain in the production of L-isoleucine.

The cultivation of the bacteria may be carried out in a suitable medium under culture conditions known in the art. The culture medium may comprise: carbon sources, nitrogen sources, trace elements, and combinations thereof. In the culture, the pH of the culture may be adjusted. Further, prevention of bubble generation, for example, by using an antifoaming agent, may be included in the culture. In addition, the culturing may include injecting a gas into the culture. The gas may include any gas capable of maintaining aerobic conditions of the culture. In the culture, the temperature of the culture may be 20 to 45 ℃. The produced L-isoleucine can be recovered from the culture by treating the culture with sulfuric acid or hydrochloric acid or the like, followed by a combination of methods such as anion exchange chromatography, concentration, crystallization and isoelectric precipitation.

Advantageous effects

The present inventors have found that a recombinant strain having L-isoleucine-producing ability, which is advantageous for producing high-concentration-isoleucine, can be obtained by introducing point mutation into the kgd coding sequence, or increasing the copy number or overexpression of the gene.

Detailed Description

The technical solution of the present invention will be further described in detail with reference to specific embodiments. It is to be understood that the following examples are only illustrative and explanatory of the present invention and should not be construed as limiting the scope of the present invention. All the technologies realized based on the above-mentioned contents of the present invention are covered in the protection scope of the present invention. Unless otherwise indicated, the starting materials and reagents used in the following examples are all commercially available products or can be prepared by known methods; the manipulations performed are all known in the art or performed according to the user's manual of commercially available products.

The basic culture medium used for culturing the strain in the following examples has the same composition, and correspondingly required sucrose, kanamycin or chloramphenicol and the like are added to the basic culture medium, and the basic culture medium has the following composition:

composition (I)	Formulation of
		Glucose	5g/L
Polypeptone	10g/L
		Beef extract	10g/L
Yeast powder	5g/L
		Sodium chloride	55g/L
Agar powder	20g/L
		pH (NaOH adjusted)	7.0
Culture conditions	31℃

Example 1 construction comprising Point mutationsThe vector pK18-kgd for transformation of the coding region of the kgd gene of (1)^C2425T

According to the genome sequence of Corynebacterium glutamicum ATCC15168 published by NCBI, two pairs of primers for amplifying coding region sequence of kgd gene are designed and synthesized, point mutation is introduced in high isoleucine-producing strain CGMCC NO.20437 by allelic gene replacement, the amino acid sequence of the corresponding coding protein is SEQ ID NO. 3, C cytosine at position 2425 of nucleotide sequence of kgd gene is changed into T thymine (SEQ ID NO: 2: kgd gene)^C2425T) The amino acid sequence corresponding to the encoded protein had the glutamic acid at position 809 changed to lysine (SEQ ID NO: 4: kgd^E809K)。

The primers were designed as follows (synthesized by Shanghai Invitrogen corporation):

P1:5'CAGTGCCAAGCTTGCATGCCTGCAGGTCGACTCTAGTT

GTTACGCAGC ATGGAC 3'(SEQ ID NO:5)

P2:5'CCAGATGGAA TCTGTGTTCA ACGAAGTCAA GAAAGGC3'(SEQ ID NO:6)

P3:5'GCCT TTCTTGACTT CGTTGAACACAGATTCCATC TGG 3'(SEQ ID NO:7)

P4:5'CAGCTATGACCATGATTACGAATTCGAGCTCGGTACCCTTTGAAGGCC AAATGGAG3'(SEQ ID NO:8)

the construction method comprises the following steps: PCR was performed using ATCC15168 as a template and primers P1 and P2, and P3 and P4, respectively.

And (3) PCR system: 10 XEx Taq Buffer 5. mu.L, dNTP mix (2.5 mM each) 4. mu.L, Mg²⁺mu.L (25mM), 2. mu.L each of primers (10pM), 0.25. mu.L of Ex Taq (5U/. mu.L), and a total volume of 50. mu.L.

The PCR amplification was performed as follows: pre-denaturation at 94 ℃ for 5min, denaturation at 94 ℃ for 30s, annealing at 52 ℃ for 30s, extension at 72 ℃ for 40s (30 cycles), and over-extension at 72 ℃ for 10min to obtain two DNA fragments (KGD) with sizes of about 869bp and 773bp respectively and containing KGD gene coding regions^C2425T-Up and kgd^C2425T-Down)。

Will kgd^C2425T-Up and kgd^C2425T-Down after separation and purification by agarose gel electrophoresis; and amplifying kgd with length of about 1642bp by overlap PCR by using the two DNA fragments as templates and using P1 and P4 as primers^C2425T-Up-Down fragment.

The PCR amplification was performed as follows: pre-denaturation at 94 ℃ for 5min, denaturation at 94 ℃ for 30s, annealing at 52 ℃ for 30s, extension at 72 ℃ for 90s (30 cycles), and over-extension at 72 ℃ for 10 min.

This DNA fragment resulted in the conversion of cytosine (C) at position 2425 of the coding region of the kgd gene of CGMCC NO.20437 to thymine (T), and finally in the conversion of amino acid at position 809 of the encoded protein from glutamic acid (E) to lysine (K).

The pK18mobsacB plasmid (from Addgene) was digested with Xba I and purified by agarose gel electrophoresis to isolate kgd^C2425T-Up-Down and linearized pK18mobsacB plasmid, and then assembled by a NEBuider recombination system to obtain a vector pK18-kgd^C2425TThe plasmid contains a kanamycin resistance marker. And the vector pK18-kgd^C2425TSending to a sequencing company for sequencing identification, and carrying out sequencing identification on the vector pK18-kgd containing the correct point mutation (C-T)^C2425TAnd (5) storing for later use.

Example 2 construction of kgd comprising Point mutations^C2425TOf (4) an engineered strain

The construction method comprises the following steps: substitution of the allele for the plasmid pK18-kgd^C2425TTransforming into high-yield isoleucine-producing strain CGMCC NO.20437 by electric shock; the single colony generated by the culture is respectively identified by a primer P1 and a universal primer M13R, and the strain capable of amplifying a band with the size of about 1642bp is a positive strain. Culturing the positive strain on a culture medium containing 15% of sucrose; the strains that were cultured and produced single colonies were cultured on kanamycin-containing and kanamycin-free media, respectively, and grown on kanamycin-free media, but not grown on kanamycin-containing media were further subjected to PCR identification using the following primers (synthesized by Shanghai invitrogen Co.):

P5:5'TTC GGTGACAGAG GAGAC 3'(SEQ ID NO:9)

P6:5'ATGACCCAGC CAAAGATG 3'(SEQ ID NO:10)

the PCR amplification product is subjected to high-temperature denaturation and ice bathsscp electrophoresis (with plasmid pK 18-kgd)^C2425TThe amplified fragment is a positive control, the amplified fragment of ATCC15168 is a negative control, and water is used as a blank control). due to the different fragment structures and different electrophoresis positions, the strain with the fragment electrophoresis position inconsistent with the position of the negative control fragment and consistent with the position of the positive control fragment is a strain with successful allelic replacement. The target fragment of the strain which was successfully allelic-substituted was amplified again by PCR using primers P5 and P6, ligated to PMD19-T vector sequencing, sequence-verified that the allelic substitution of the strain was successful by mutation of the base sequence by sequence alignment, and designated YPI001

TABLE 1 preparation of PAGE by sscp electrophoresis

Example 3 construction of on-genome overexpression of kgd or kgd^C2425TEngineered strains of genes

According to the genome sequence of Corynebacterium glutamicum ATCC15168 published by NCBI, three pairs of primers for amplifying upstream and downstream homologous arm fragments and coding regions and promoter regions of kgd gene are designed and synthesized, and kgd or kgd is introduced into strain CGMCC NO.20437 by homologous recombination^C2425TA gene.

P7:5'CAGTGCCAAGCTTGCATGCCTGCAGGTCGACTCTAGGTTGGTATTG ATGTCGCAG3'(SEQ ID NO:11)

P8:5'GAGGCTTTCGAGGCTTAATGGACTTCCTAAAGAGGG3'(SEQ ID NO:12)

P9:5'CCCTCTTTAGGAAGTCCATTAAGCCTCGAAAGCCTC3'(SEQ ID NO:13)

P10:5'GATAGCTACCCCAAATACTCACGTTATTTTTAGGAGAAC 3'(SEQ ID NO:14)

P11:5'GTTCTCCTAAAAATAACGTGAGTATTTGGGGTAGCTATC 3'(SEQ ID NO:15)

the construction method comprises the following steps: using ATCC15168 and YPI001 as templates, and primers P7/P8, P9/P10 and P11/P12, performing PCR amplification to obtain the upstream homologous arm fragment of about 738bp, kgd or kgd^C2425TThe gene fragment is about 3843bp and the downstream homologous arm fragment is about 814bp, and then P7/P12 is used as a primer, and the three amplified fragments are mixed to be used as a template for amplification to obtain the integrated homologous arm fragment. After the PCR reaction is finished, carrying out electrophoretic recovery on the amplified product, adopting a column type DNA gel recovery kit to recover the required DNA fragment of about 5395bp, adopting a NEBuider recombination system to be connected with the shuttle plasmid pk18mobsacB recovered by Xba I enzyme digestion to obtain an integrated plasmid pk18mobsacB-kgd or pk18mobsacB-kgd^C2425TThe plasmid contains a kanamycin resistance marker, and recombinants with the plasmid integrated on the genome can be obtained by kanamycin screening.

The PCR amplification was performed as follows: pre-denaturation at 94 ℃ for 5min, denaturation at 94 ℃ for 30s, annealing at 52 ℃ for 30s, extension at 72 ℃ for 180s (30 cycles), and over-extension at 72 ℃ for 10 min.

Respectively and electrically transforming the 2 integration plasmids into a strain CGMCC NO.20437, carrying out PCR identification on a single colony generated by culture by using a P13/P14 primer, wherein the strain which contains a fragment with the size of about 1287bp and is amplified by PCR is a positive strain, and the strain which can not be amplified is a protobacteria. The positive strains are screened by 15% sucrose, then are respectively cultured on a culture medium containing kanamycin and a culture medium not containing kanamycin, the strains grow on the culture medium not containing kanamycin, the strains which do not grow on the culture medium containing kanamycin are further subjected to PCR identification by adopting a P15/P16 primer, and the amplified bacterium with the size of about 1177bp is kgd or kgd^C2425TThe strain with gene integrated into the genome of strain CGMCC NO.20437 is named YPI-002 (without mutation point) and YPI-003 (with mutation point).

P13:5'TAGGGTCAGC TTGTAAAAC 3'(SEQ ID NO:17)

P14:5'TTCCAATCCG TGATCGACG 3'(SEQ ID NO:18)

P15:5'GAAGGCTGTG CTTCTGTTG 3'(SEQ ID NO:19)

P16:5'CTCAACTACC AGCCAAATC 3'(SEQ ID NO:20)

EXAMPLE 4 overexpression of kgd or kgd on the construction plasmid^C2425TEngineered strains of genes

Based on the ATCC15168 genome sequence published by NCBI, a pair of primers for amplifying coding region and promoter region sequences of kgd gene were designed and synthesized, and the primers were designed as follows (synthesized by Shanghai Invitrogen):

P17:5'GCTTGCATGCCTGCAGGTCGACTCTAGAGGATCCCCTTAAGCCTCGAAAGCCTC3'(SEQ ID NO:21)

P18:5'ATCAGGCTGAAAATCTTCTCTCATCCGCCAAAACCACGTTATTTTTAGGAGAAC 3'(SEQ ID NO:22)

the construction method comprises the following steps: PCR amplification with ATCC15168 or YPI001 as template and primer P17/P18 to obtain kgd or kgd^C2425TThe gene fragment is about 3843bp, the amplified product is subjected to electrophoretic recovery, a column type DNA gel recovery kit is adopted to recover the required 3843bp DNA fragment, a NEBuider recombination system is adopted to be connected with a shuttle plasmid pXMJ19 which is subjected to enzyme digestion and recovery by EcoR I, and an over-expression plasmid pXMJ19-kgd or pXMJ19-kgd is obtained^C2425T. The plasmid contains a chloramphenicol resistance marker, and the plasmid obtained by chloramphenicol screening can be transformed into a strain.

The PCR amplification was performed as follows: pre-denaturation at 94 ℃ for 5min, denaturation at 94 ℃ for 30s, annealing at 52 ℃ for 30s, extension at 72 ℃ for 120s (30 cycles), and over-extension at 72 ℃ for 10 min.

The plasmids are respectively electrically transformed into a strain CGMCC NO.20437, PCR identification is carried out on a single colony generated by culture through M13R (-48) and P18 primers, and the single colony which is amplified by PCR and contains a fragment with the size of about 3863bp is a transferred strain and is named as YPI-004 (without point mutation) and YPI-005 (with point mutation).

Example 5 construction of an engineered Strain with deletion of the kgd Gene on the genome

Two pairs of primers for amplifying fragments at both ends of the coding region of the kgd gene were synthesized as upstream and downstream homology arm fragments based on the genomic sequence of ATCC15168 published by NCBI. The primers were designed as follows (synthesized by shanghai handsome corporation):

P19:5'CAGTGCCAAGCTTGCATGCCTGCAGGTCGACTCTAGTTTTCACGC TAGTTCAGCC 3'(SEQ ID NO:23)

P20:5'CAACAAATTA ATGCTACAAC AGCTGGAGGA GAAGCAGC 3'(SEQ ID NO:24)

P21:5'GCTGCTTCTCCTCCAGCTGTTGTAGCATTAATTTGTTG 3'(SEQ ID NO:25)

P22:5'CAGCTATGACCATGATTACGAATTCGAGCTCGGTACCCGATCCGA TCC TAGAAAAC3'(SEQ ID NO:26)

PCR amplification was performed using ATCC15168 as a template and primers P19/P20 and P21/P22, respectively, to obtain an upstream homology arm fragment 715bp and a downstream homology arm fragment 756 bp. Then OVER PCR was performed with primers P19/P22 to obtain 1471bp of the entire homology arm fragment. And after the PCR reaction is finished, carrying out electrophoretic recovery on the amplified product, recovering the required 1471bp DNA fragment by using a column type DNA gel recovery kit, and connecting the DNA fragment with a shuttle plasmid pk18mobsacB plasmid recovered by Xba I enzyme digestion through a NEBuider recombination system to obtain a knockout plasmid. The plasmid contains a kanamycin resistance marker.

The knockout plasmid is electrically transformed into a strain CGMCC NO.20437, and the single colony generated by culture is respectively subjected to PCR identification through the following primers (synthesized by Shanghai Invitrogen company):

P23:5'TTTTCACGC TAGTTCAGCC 3'(SEQ ID NO:27)

P24:5'GATCCGA TCC TAGAAAAC3'(SEQ ID NO:28)

the strains with bands of 1325bp and 5116bp amplified by the PCR are positive strains, and the strains with the bands of 5116bp only amplified are initiating strains. The positive strains were screened on a 15% sucrose medium, cultured on kanamycin-containing and kanamycin-free media, respectively, and grown on kanamycin-free media, while the strains that did not grow on kanamycin-containing media were further identified by PCR using primers P23/P24, and the strain whose size was 1325bp band was amplified as a genetically engineered strain in which the kgd gene coding region was knocked out, which was designated YPI-006.

Example 6L-isoleucine fermentation experiment

The strains constructed in the examples and the original strain CGMCC NO.20437 were subjected to fermentation experiments in a BLBIO-5GC-4-H model fermenter (purchased from Bailan Biotech Co., Ltd., Shanghai) using the medium shown in Table 1. Each strain was replicated three times, and the results are shown in Table 3.

TABLE 2 fermentation Medium formulation

Composition (I)	Formulation of
		Glucose	90g/l
Ammonium sulfate	12g/l
		Magnesium sulfate	0.87g/l
Potassium dihydrogen sulfate	2g/l
		Acidified corn steep liquor	3mL/L
Yeast powder	4g/l
		Defoaming agent (2% foam)	4mL/L
VB₁	0.006g/l
		VH	0.003g/l
Biotin	0.088g/l

TABLE 3 fermentation control Process

TABLE 4 results of L-isoleucine fermentation experiments

Strain number	L-isoleucine yield (g/L)	OD(600nm)
			CGMCC20437	25.3	39.5
YPI001	25.6	40.2
			YPI002	25.9	41.2
YPI003	28.2	41.5
			YPI004	27.6	38.9
YPI005	28.5	39.5
			YPI006	24.3	42.3

The results are shown in Table 4, in the high isoleucine-producing engineering bacterium CGMCC20437, the coding region of the kgd gene is subjected to point mutation kgd^C2425TAnd/or overexpression contribute to the increase in L-isoleucine production; however, overexpression or knock-out of the kgd gene had little effect on isoleucine.

The embodiments of the present invention have been described above. However, the present invention is not limited to the above embodiment. Any modification, equivalent replacement, or improvement made within the spirit and principle of the present invention should be included in the protection scope of the present invention.

Sequence listing

<110> Ningxia Yipin Biotechnology Ltd

<120> recombinant strain for modifying kgd gene, construction method thereof and application of recombinant strain for producing L-isoleucine

<130> CPCN20411404

<160> 28

<170> SIPOSequenceListing 1.0

<210> 1

<211> 3666

<212> DNA

<213> Corynebacterium glutamicum (Corynebacterium glutamicum)

<400> 1

ttaagcctcg aaagcctcgt cgataagctg cttctcctcc agctggtgca ccttagcaac 60

accagttgcg gtggaggact gagcgcggcg ggaaacgcgg cgcatctttg gcatgttcgg 120

gatcagctct gggaggtgct cctggtagaa cggccatggg ccctggtttg ctggctcatc 180

ctgaacgaag aggacttcct cagcgttagg gtagccggca agagcctcgg agatgcggtt 240

gaacggaatt gggtggagca tttcgatacg aacgatcgcg atgtcgtcgc gtccgtcctt 300

ctccttgcgc tttgccaatt cgtagtacag cttgccggag accagcatga ccttcttcac 360

cttggctgca tctgcaacgt ttggatcgtc gatcacggat tggaacttgg tgacctcagt 420

gaagtcttct ggtgcggagg cagcagcctt gttacgcagc atggacttcg gggtgaagat 480

aaccagtgga cgcttcaggt cggacagagc gtgacgacgc agcaggtgga agtggtttgc 540

tggggtggat ggctgagcaa cagtcatgga accctcagcg cacagctgca ggaagcgctc 600

gatacgtgcg gaagagtggt ctgggccctg gccttcgtag ccgtgaggca gcagaaggat 660

cagcttggag gtctggcccc acttagcttc gcctgaggag acgtactcat cgatgatggt 720

ctgagcgccg ttggcgaagt cgccgaactg tgcttcccat gcaacgacgg agtcttcgtt 780

tcctacggag tagccgtact cgaagcccat gcctgcgtac tcggtcagtg cggagttgta 840

gaccaggaac ttaccgttgt tgcccttgga ctgtgcaagc tcgtggagtg ggttgaactc 900

ttcagcggtc gctgggtcga tggcaactgc gtggcgctgg gtgaaggtac cgcggcggga 960

atcctcacct gcaaggcgaa ccaagcggcc ggagttagct agggaaccga aggcgaggag 1020

ctcgccccat gcccagtcga tgccaccttc ggtgacagag gagacgcgct tcttagcaac 1080

gggagccaca cgtgggtggt agttgaagcc ttctggggtg ttggcgaaag cctgtcccag 1140

ttccaggagc tcttcacggg agatgttggt ctcaaggccg tgtggaagct tctgggagcc 1200

ggtgatgccg gtctgtgcct cagcctgctt cttgccgcct tccttgactt cgttgaacac 1260

agattccatc tggtcgtgga agtcgcggac gactgcttct gcatcttcgt tggagaggtc 1320

tccacgtccg agcaggtctt cggtgtactg agcacgaacg gtctcgcggc cggtgatgag 1380

ctcatacatc tttggctggg tcatggaagg atcatcagct tcgttgtggc cgcggaggcg 1440

gtagcaaacg aggtcgatga agacgtcctt gccgaagcga cgacggtact cggtggccag 1500

ctggccaacc cagacaactg cctctgggtc atcaccattg acgtggaaga ctgggcagcc 1560

gaatgccttg gcgtagtcgg ttgcgtagtg catggagcgg ctggagtctg gggtggtggt 1620

gaagccgatc tggttgttca ccacgatgtg gatggtgccg ccgacgtcgt agccacgcag 1680

cttagccagg ttgatggttt ctggcacgat gcccaggcct gcgaatgcag cgtcaccgtg 1740

gagcagcagt ggcacaacag tcttgccgtc tacgcccttg tccaggtagt cctgctttgc 1800

gcggacgata ccttccatca ctgggttaac agcttccagg tgggacgggt tagcagtcag 1860

ggagaccttg atctcgccgt cgccgaacat ctgcaggtgc tggccttcgg aaccgaggtg 1920

gtacttcacg tcaccggagc caccgatctg gccctgctcc atttggcctt caaactcgtt 1980

gaagatggat gccagtggct tgcccacgat gttgaacagc acgttgaggc gtccacggtg 2040

tggcataccg atgacaactt cgtcgaggcc ctggcctgcg gcggtgtcga tggcggagtc 2100

catcagtggg ataagtgctt ctgcaccttc gagggagaag cgcttctggc cgacgtactt 2160

ggtctgcagg aagttctcga aagcctccgc ggcgttcagc ttctgcagga tgtacttctg 2220

ctctgcctgg gttggctttg gcatacctgc ttcgaggcgg tcctgcagcc aggtgcgctc 2280

gtcgcggtcc aggatgtggg tgtattcgga gccgaccttg agggtgtacg cagcgcggag 2340

gcgggacagt acctcgcgca gggtcatggt ctccttgccg ccgaagccac cgacgctgaa 2400

ggtacggtcc agatcccaga tggtcaggcc gtgggtctcg atgtcgaggt cgcggtggtc 2460

tggaactggc atgccaggct gaacccatga aagtgggttg gtgtcagcga tgaggtgtcc 2520

acgggagcgg tatgcctcaa tgagctgcat gacgcgggtg ttcttatcaa caccggtgtt 2580

tggaacgtcc tgtgcccaac gcattggggt gtaaggaacg ttcattgcgt cgaagatctc 2640

atcccagaag gaatcatcgg tgagcaggcg agacatggtg cgcaggaatt caccggacac 2700

agcaccctgg atcacgcggt gatcgtaggt ggaggtgatg gttactagct tgccaacgcc 2760

gagctctgca aggcggtctt cggaagcgcc ctggaactct gctgggtaat ccatggaacc 2820

gacaccgatg atggtgccct ggcccttggt cagacgtggg acagagtggc gggtaccgat 2880

gccacctggg ttggtcaagg aaacggtaac gccctggtag tcatccatgg tgagcttgcc 2940

cttgcgggag cgtgtcacga tgtcttcgta tgctgcgagg aactcggaga agttcatctt 3000

ctcggtttcc ttgatggctg ctacgacaag tgcgcgggag ccgtccttct gaggaaggtc 3060

gatagcaagg cccaggttga tgtgctcagg cacgatcagg gttggcttgc cgtcgatgac 3120

gtcgtaggag ttgttcatgt ccgggtgagc catgactgcc ttcaccatgg cgtagccaat 3180

gatgtgggtg aaggagatct tgccaccgcg ggtgcgcttg agctgatcgt tgaccatcgc 3240

gcggttttcg aacatgaggc gagctggcat atcgcgaacc gaggttgcgg ttgggatttc 3300

cagggagata tccatgttct tcgcgatgga cttgaaaata cccctgattg gggtttgtcc 3360

tggctccgga agcttaggtt gctgtggcac tgaggactcc ttggcctttg gggcggcctt 3420

ggcggccggc ttggtttcta cgcgcggtgc tgccttggct gcaggggcag cctttggtgc 3480

tggtttcgca gactccttgg gcgctgaagg ctgtgcttct gttgtagcgg gggtagtatt 3540

tggtcccccc tgcgcctcaa agagttctct ccattccttg tccacggact tggggtcctt 3600

ctggaactgc tggaacatct cgtctaccag ccacgcattc tggccgaaag tactagcgct 3660

gctcac 3666

<210> 2

<211> 3666

<212> DNA

<213> Corynebacterium glutamicum (Corynebacterium glutamicum)

<400> 2

ttaagcctcg aaagcctcgt cgataagctg cttctcctcc agctggtgca ccttagcaac 60

accagttgcg gtggaggact gagcgcggcg ggaaacgcgg cgcatctttg gcatgttcgg 120

gatcagctct gggaggtgct cctggtagaa cggccatggg ccctggtttg ctggctcatc 180

ctgaacgaag aggacttcct cagcgttagg gtagccggca agagcctcgg agatgcggtt 240

gaacggaatt gggtggagca tttcgatacg aacgatcgcg atgtcgtcgc gtccgtcctt 300

ctccttgcgc tttgccaatt cgtagtacag cttgccggag accagcatga ccttcttcac 360

cttggctgca tctgcaacgt ttggatcgtc gatcacggat tggaacttgg tgacctcagt 420

gaagtcttct ggtgcggagg cagcagcctt gttacgcagc atggacttcg gggtgaagat 480

aaccagtgga cgcttcaggt cggacagagc gtgacgacgc agcaggtgga agtggtttgc 540

tggggtggat ggctgagcaa cagtcatgga accctcagcg cacagctgca ggaagcgctc 600

gatacgtgcg gaagagtggt ctgggccctg gccttcgtag ccgtgaggca gcagaaggat 660

cagcttggag gtctggcccc acttagcttc gcctgaggag acgtactcat cgatgatggt 720

ctgagcgccg ttggcgaagt cgccgaactg tgcttcccat gcaacgacgg agtcttcgtt 780

tcctacggag tagccgtact cgaagcccat gcctgcgtac tcggtcagtg cggagttgta 840

gaccaggaac ttaccgttgt tgcccttgga ctgtgcaagc tcgtggagtg ggttgaactc 900

ttcagcggtc gctgggtcga tggcaactgc gtggcgctgg gtgaaggtac cgcggcggga 960

atcctcacct gcaaggcgaa ccaagcggcc ggagttagct agggaaccga aggcgaggag 1020

ctcgccccat gcccagtcga tgccaccttc ggtgacagag gagacgcgct tcttagcaac 1080

gggagccaca cgtgggtggt agttgaagcc ttctggggtg ttggcgaaag cctgtcccag 1140

ttccaggagc tcttcacggg agatgttggt ctcaaggccg tgtggaagct tctgggagcc 1200

ggtgatgccg gtctgtgcct cagcctgctt cttgccgcct ttcttgactt cgttgaacac 1260

agattccatc tggtcgtgga agtcgcggac gactgcttct gcatcttcgt tggagaggtc 1320

tccacgtccg agcaggtctt cggtgtactg agcacgaacg gtctcgcggc cggtgatgag 1380

ctcatacatc tttggctggg tcatggaagg atcatcagct tcgttgtggc cgcggaggcg 1440

gtagcaaacg aggtcgatga agacgtcctt gccgaagcga cgacggtact cggtggccag 1500

ctggccaacc cagacaactg cctctgggtc atcaccattg acgtggaaga ctgggcagcc 1560

gaatgccttg gcgtagtcgg ttgcgtagtg catggagcgg ctggagtctg gggtggtggt 1620

gaagccgatc tggttgttca ccacgatgtg gatggtgccg ccgacgtcgt agccacgcag 1680

cttagccagg ttgatggttt ctggcacgat gcccaggcct gcgaatgcag cgtcaccgtg 1740

gagcagcagt ggcacaacag tcttgccgtc tacgcccttg tccaggtagt cctgctttgc 1800

gcggacgata ccttccatca ctgggttaac agcttccagg tgggacgggt tagcagtcag 1860

ggagaccttg atctcgccgt cgccgaacat ctgcaggtgc tggccttcgg aaccgaggtg 1920

gtacttcacg tcaccggagc caccgatctg gccctgctcc atttggcctt caaactcgtt 1980

gaagatggat gccagtggct tgcccacgat gttgaacagc acgttgaggc gtccacggtg 2040

tggcataccg atgacaactt cgtcgaggcc ctggcctgcg gcggtgtcga tggcggagtc 2100

catcagtggg ataagtgctt ctgcaccttc gagggagaag cgcttctggc cgacgtactt 2160

ggtctgcagg aagttctcga aagcctccgc ggcgttcagc ttctgcagga tgtacttctg 2220

ctctgcctgg gttggctttg gcatacctgc ttcgaggcgg tcctgcagcc aggtgcgctc 2280

gtcgcggtcc aggatgtggg tgtattcgga gccgaccttg agggtgtacg cagcgcggag 2340

gcgggacagt acctcgcgca gggtcatggt ctccttgccg ccgaagccac cgacgctgaa 2400

ggtacggtcc agatcccaga tggtcaggcc gtgggtctcg atgtcgaggt cgcggtggtc 2460

tggaactggc atgccaggct gaacccatga aagtgggttg gtgtcagcga tgaggtgtcc 2520

acgggagcgg tatgcctcaa tgagctgcat gacgcgggtg ttcttatcaa caccggtgtt 2580

tggaacgtcc tgtgcccaac gcattggggt gtaaggaacg ttcattgcgt cgaagatctc 2640

atcccagaag gaatcatcgg tgagcaggcg agacatggtg cgcaggaatt caccggacac 2700

agcaccctgg atcacgcggt gatcgtaggt ggaggtgatg gttactagct tgccaacgcc 2760

gagctctgca aggcggtctt cggaagcgcc ctggaactct gctgggtaat ccatggaacc 2820

gacaccgatg atggtgccct ggcccttggt cagacgtggg acagagtggc gggtaccgat 2880

gccacctggg ttggtcaagg aaacggtaac gccctggtag tcatccatgg tgagcttgcc 2940

cttgcgggag cgtgtcacga tgtcttcgta tgctgcgagg aactcggaga agttcatctt 3000

ctcggtttcc ttgatggctg ctacgacaag tgcgcgggag ccgtccttct gaggaaggtc 3060

gatagcaagg cccaggttga tgtgctcagg cacgatcagg gttggcttgc cgtcgatgac 3120

gtcgtaggag ttgttcatgt ccgggtgagc catgactgcc ttcaccatgg cgtagccaat 3180

gatgtgggtg aaggagatct tgccaccgcg ggtgcgcttg agctgatcgt tgaccatcgc 3240

gcggttttcg aacatgaggc gagctggcat atcgcgaacc gaggttgcgg ttgggatttc 3300

cagggagata tccatgttct tcgcgatgga cttgaaaata cccctgattg gggtttgtcc 3360

tggctccgga agcttaggtt gctgtggcac tgaggactcc ttggcctttg gggcggcctt 3420

ggcggccggc ttggtttcta cgcgcggtgc tgccttggct gcaggggcag cctttggtgc 3480

tggtttcgca gactccttgg gcgctgaagg ctgtgcttct gttgtagcgg gggtagtatt 3540

tggtcccccc tgcgcctcaa agagttctct ccattccttg tccacggact tggggtcctt 3600

ctggaactgc tggaacatct cgtctaccag ccacgcattc tggccgaaag tactagcgct 3660

gctcac 3666

<210> 3

<211> 1221

<212> PRT

<213> Corynebacterium glutamicum (Corynebacterium glutamicum)

<400> 3

Met Ser Ser Ala Ser Thr Phe Gly Gln Asn Ala Trp Leu Val Asp Glu

1 5 10 15

Met Phe Gln Gln Phe Gln Lys Asp Pro Lys Ser Val Asp Lys Glu Trp

20 25 30

Arg Glu Leu Phe Glu Ala Gln Gly Gly Pro Asn Thr Thr Pro Ala Thr

35 40 45

Thr Glu Ala Gln Pro Ser Ala Pro Lys Glu Ser Ala Lys Pro Ala Pro

50 55 60

Lys Ala Ala Pro Ala Ala Lys Ala Ala Pro Arg Val Glu Thr Lys Pro

65 70 75 80

Ala Ala Lys Ala Ala Pro Lys Ala Lys Glu Ser Ser Val Pro Gln Gln

85 90 95

Pro Lys Leu Pro Glu Pro Gly Gln Thr Pro Ile Arg Gly Ile Phe Lys

100 105 110

Ser Ile Ala Lys Asn Met Asp Ile Ser Leu Glu Ile Pro Thr Ala Thr

115 120 125

Ser Val Arg Asp Met Pro Ala Arg Leu Met Phe Glu Asn Arg Ala Met

130 135 140

Val Asn Asp Gln Leu Lys Arg Thr Arg Gly Gly Lys Ile Ser Phe Thr

145 150 155 160

His Ile Ile Gly Tyr Ala Met Val Lys Ala Val Met Ala His Pro Asp

165 170 175

Met Asn Asn Ser Tyr Asp Val Ile Asp Gly Lys Pro Thr Leu Ile Val

180 185 190

Pro Glu His Ile Asn Leu Gly Leu Ala Ile Asp Leu Pro Gln Lys Asp

195 200 205

Gly Ser Arg Ala Leu Val Val Ala Ala Ile Lys Glu Thr Glu Lys Met

210 215 220

Asn Phe Ser Glu Phe Leu Ala Ala Tyr Glu Asp Ile Val Thr Arg Ser

225 230 235 240

Arg Lys Gly Lys Leu Thr Met Asp Asp Tyr Gln Gly Val Thr Val Ser

245 250 255

Leu Thr Asn Pro Gly Gly Ile Gly Thr Arg His Ser Val Pro Arg Leu

260 265 270

Thr Lys Gly Gln Gly Thr Ile Ile Gly Val Gly Ser Met Asp Tyr Pro

275 280 285

Ala Glu Phe Gln Gly Ala Ser Glu Asp Arg Leu Ala Glu Leu Gly Val

290 295 300

Gly Lys Leu Val Thr Ile Thr Ser Thr Tyr Asp His Arg Val Ile Gln

305 310 315 320

Gly Ala Val Ser Gly Glu Phe Leu Arg Thr Met Ser Arg Leu Leu Thr

325 330 335

Asp Asp Ser Phe Trp Asp Glu Ile Phe Asp Ala Met Asn Val Pro Tyr

340 345 350

Thr Pro Met Arg Trp Ala Gln Asp Val Pro Asn Thr Gly Val Asp Lys

355 360 365

Asn Thr Arg Val Met Gln Leu Ile Glu Ala Tyr Arg Ser Arg Gly His

370 375 380

Leu Ile Ala Asp Thr Asn Pro Leu Ser Trp Val Gln Pro Gly Met Pro

385 390 395 400

Val Pro Asp His Arg Asp Leu Asp Ile Glu Thr His Gly Leu Thr Ile

405 410 415

Trp Asp Leu Asp Arg Thr Phe Ser Val Gly Gly Phe Gly Gly Lys Glu

420 425 430

Thr Met Thr Leu Arg Glu Val Leu Ser Arg Leu Arg Ala Ala Tyr Thr

435 440 445

Leu Lys Val Gly Ser Glu Tyr Thr His Ile Leu Asp Arg Asp Glu Arg

450 455 460

Thr Trp Leu Gln Asp Arg Leu Glu Ala Gly Met Pro Lys Pro Thr Gln

465 470 475 480

Ala Glu Gln Lys Tyr Ile Leu Gln Lys Leu Asn Ala Ala Glu Ala Phe

485 490 495

Glu Asn Phe Leu Gln Thr Lys Tyr Val Gly Gln Lys Arg Phe Ser Leu

500 505 510

Glu Gly Ala Glu Ala Leu Ile Pro Leu Met Asp Ser Ala Ile Asp Thr

515 520 525

Ala Ala Gly Gln Gly Leu Asp Glu Val Val Ile Gly Met Pro His Arg

530 535 540

Gly Arg Leu Asn Val Leu Phe Asn Ile Val Gly Lys Pro Leu Ala Ser

545 550 555 560

Ile Phe Asn Glu Phe Glu Gly Gln Met Glu Gln Gly Gln Ile Gly Gly

565 570 575

Ser Gly Asp Val Lys Tyr His Leu Gly Ser Glu Gly Gln His Leu Gln

580 585 590

Met Phe Gly Asp Gly Glu Ile Lys Val Ser Leu Thr Ala Asn Pro Ser

595 600 605

His Leu Glu Ala Val Asn Pro Val Met Glu Gly Ile Val Arg Ala Lys

610 615 620

Gln Asp Tyr Leu Asp Lys Gly Val Asp Gly Lys Thr Val Val Pro Leu

625 630 635 640

Leu Leu His Gly Asp Ala Ala Phe Ala Gly Leu Gly Ile Val Pro Glu

645 650 655

Thr Ile Asn Leu Ala Lys Leu Arg Gly Tyr Asp Val Gly Gly Thr Ile

660 665 670

His Ile Val Val Asn Asn Gln Ile Gly Phe Thr Thr Thr Pro Asp Ser

675 680 685

Ser Arg Ser Met His Tyr Ala Thr Asp Tyr Ala Lys Ala Phe Gly Cys

690 695 700

Pro Val Phe His Val Asn Gly Asp Asp Pro Glu Ala Val Val Trp Val

705 710 715 720

Gly Gln Leu Ala Thr Glu Tyr Arg Arg Arg Phe Gly Lys Asp Val Phe

725 730 735

Ile Asp Leu Val Cys Tyr Arg Leu Arg Gly His Asn Glu Ala Asp Asp

740 745 750

Pro Ser Met Thr Gln Pro Lys Met Tyr Glu Leu Ile Thr Gly Arg Glu

755 760 765

Thr Val Arg Ala Gln Tyr Thr Glu Asp Leu Leu Gly Arg Gly Asp Leu

770 775 780

Ser Asn Glu Asp Ala Glu Ala Val Val Arg Asp Phe His Asp Gln Met

785 790 795 800

Glu Ser Val Phe Asn Glu Val Lys Glu Gly Gly Lys Lys Gln Ala Glu

805 810 815

Ala Gln Thr Gly Ile Thr Gly Ser Gln Lys Leu Pro His Gly Leu Glu

820 825 830

Thr Asn Ile Ser Arg Glu Glu Leu Leu Glu Leu Gly Gln Ala Phe Ala

835 840 845

Asn Thr Pro Glu Gly Phe Asn Tyr His Pro Arg Val Ala Pro Val Ala

850 855 860

Lys Lys Arg Val Ser Ser Val Thr Glu Gly Gly Ile Asp Trp Ala Trp

865 870 875 880

Gly Glu Leu Leu Ala Phe Gly Ser Leu Ala Asn Ser Gly Arg Leu Val

885 890 895

Arg Leu Ala Gly Glu Asp Ser Arg Arg Gly Thr Phe Thr Gln Arg His

900 905 910

Ala Val Ala Ile Asp Pro Ala Thr Ala Glu Glu Phe Asn Pro Leu His

915 920 925

Glu Leu Ala Gln Ser Lys Gly Asn Asn Gly Lys Phe Leu Val Tyr Asn

930 935 940

Ser Ala Leu Thr Glu Tyr Ala Gly Met Gly Phe Glu Tyr Gly Tyr Ser

945 950 955 960

Val Gly Asn Glu Asp Ser Val Val Ala Trp Glu Ala Gln Phe Gly Asp

965 970 975

Phe Ala Asn Gly Ala Gln Thr Ile Ile Asp Glu Tyr Val Ser Ser Gly

980 985 990

Glu Ala Lys Trp Gly Gln Thr Ser Lys Leu Ile Leu Leu Leu Pro His

995 1000 1005

Gly Tyr Glu Gly Gln Gly Pro Asp His Ser Ser Ala Arg Ile Glu Arg

1010 1015 1020

Phe Leu Gln Leu Cys Ala Glu Gly Ser Met Thr Val Ala Gln Pro Ser

1025 1030 1035 1040

Thr Pro Ala Asn His Phe His Leu Leu Arg Arg His Ala Leu Ser Asp

1045 1050 1055

Leu Lys Arg Pro Leu Val Ile Phe Thr Pro Lys Ser Met Leu Arg Asn

1060 1065 1070

Lys Ala Ala Ala Ser Ala Pro Glu Asp Phe Thr Glu Val Thr Lys Phe

1075 1080 1085

Gln Ser Val Ile Asp Asp Pro Asn Val Ala Asp Ala Ala Lys Val Lys

1090 1095 1100

Lys Val Met Leu Val Ser Gly Lys Leu Tyr Tyr Glu Leu Ala Lys Arg

1105 1110 1115 1120

Lys Glu Lys Asp Gly Arg Asp Asp Ile Ala Ile Val Arg Ile Glu Met

1125 1130 1135

Leu His Pro Ile Pro Phe Asn Arg Ile Ser Glu Ala Leu Ala Gly Tyr

1140 1145 1150

Pro Asn Ala Glu Glu Val Leu Phe Val Gln Asp Glu Pro Ala Asn Gln

1155 1160 1165

Gly Pro Trp Pro Phe Tyr Gln Glu His Leu Pro Glu Leu Ile Pro Asn

1170 1175 1180

Met Pro Lys Met Arg Arg Val Ser Arg Arg Ala Gln Ser Ser Thr Ala

1185 1190 1195 1200

Thr Gly Val Ala Lys Val His Gln Leu Glu Glu Lys Gln Leu Ile Asp

1205 1210 1215

Glu Ala Phe Glu Ala

1220

<210> 4

<211> 1221

<212> PRT

<213> Corynebacterium glutamicum (Corynebacterium glutamicum)

<400> 4

Met Ser Ser Ala Ser Thr Phe Gly Gln Asn Ala Trp Leu Val Asp Glu

1 5 10 15

Met Phe Gln Gln Phe Gln Lys Asp Pro Lys Ser Val Asp Lys Glu Trp

20 25 30

Arg Glu Leu Phe Glu Ala Gln Gly Gly Pro Asn Thr Thr Pro Ala Thr

35 40 45

Thr Glu Ala Gln Pro Ser Ala Pro Lys Glu Ser Ala Lys Pro Ala Pro

50 55 60

Lys Ala Ala Pro Ala Ala Lys Ala Ala Pro Arg Val Glu Thr Lys Pro

65 70 75 80

Ala Ala Lys Ala Ala Pro Lys Ala Lys Glu Ser Ser Val Pro Gln Gln

85 90 95

Pro Lys Leu Pro Glu Pro Gly Gln Thr Pro Ile Arg Gly Ile Phe Lys

100 105 110

Ser Ile Ala Lys Asn Met Asp Ile Ser Leu Glu Ile Pro Thr Ala Thr

115 120 125

Ser Val Arg Asp Met Pro Ala Arg Leu Met Phe Glu Asn Arg Ala Met

130 135 140

Val Asn Asp Gln Leu Lys Arg Thr Arg Gly Gly Lys Ile Ser Phe Thr

145 150 155 160

His Ile Ile Gly Tyr Ala Met Val Lys Ala Val Met Ala His Pro Asp

165 170 175

Met Asn Asn Ser Tyr Asp Val Ile Asp Gly Lys Pro Thr Leu Ile Val

180 185 190

Pro Glu His Ile Asn Leu Gly Leu Ala Ile Asp Leu Pro Gln Lys Asp

195 200 205

Gly Ser Arg Ala Leu Val Val Ala Ala Ile Lys Glu Thr Glu Lys Met

210 215 220

Asn Phe Ser Glu Phe Leu Ala Ala Tyr Glu Asp Ile Val Thr Arg Ser

225 230 235 240

Arg Lys Gly Lys Leu Thr Met Asp Asp Tyr Gln Gly Val Thr Val Ser

245 250 255

Leu Thr Asn Pro Gly Gly Ile Gly Thr Arg His Ser Val Pro Arg Leu

260 265 270

Thr Lys Gly Gln Gly Thr Ile Ile Gly Val Gly Ser Met Asp Tyr Pro

275 280 285

Ala Glu Phe Gln Gly Ala Ser Glu Asp Arg Leu Ala Glu Leu Gly Val

290 295 300

Gly Lys Leu Val Thr Ile Thr Ser Thr Tyr Asp His Arg Val Ile Gln

305 310 315 320

Gly Ala Val Ser Gly Glu Phe Leu Arg Thr Met Ser Arg Leu Leu Thr

325 330 335

Asp Asp Ser Phe Trp Asp Glu Ile Phe Asp Ala Met Asn Val Pro Tyr

340 345 350

Thr Pro Met Arg Trp Ala Gln Asp Val Pro Asn Thr Gly Val Asp Lys

355 360 365

Asn Thr Arg Val Met Gln Leu Ile Glu Ala Tyr Arg Ser Arg Gly His

370 375 380

Leu Ile Ala Asp Thr Asn Pro Leu Ser Trp Val Gln Pro Gly Met Pro

385 390 395 400

Val Pro Asp His Arg Asp Leu Asp Ile Glu Thr His Gly Leu Thr Ile

405 410 415

Trp Asp Leu Asp Arg Thr Phe Ser Val Gly Gly Phe Gly Gly Lys Glu

420 425 430

Thr Met Thr Leu Arg Glu Val Leu Ser Arg Leu Arg Ala Ala Tyr Thr

435 440 445

Leu Lys Val Gly Ser Glu Tyr Thr His Ile Leu Asp Arg Asp Glu Arg

450 455 460

Thr Trp Leu Gln Asp Arg Leu Glu Ala Gly Met Pro Lys Pro Thr Gln

465 470 475 480

Ala Glu Gln Lys Tyr Ile Leu Gln Lys Leu Asn Ala Ala Glu Ala Phe

485 490 495

Glu Asn Phe Leu Gln Thr Lys Tyr Val Gly Gln Lys Arg Phe Ser Leu

500 505 510

Glu Gly Ala Glu Ala Leu Ile Pro Leu Met Asp Ser Ala Ile Asp Thr

515 520 525

Ala Ala Gly Gln Gly Leu Asp Glu Val Val Ile Gly Met Pro His Arg

530 535 540

Gly Arg Leu Asn Val Leu Phe Asn Ile Val Gly Lys Pro Leu Ala Ser

545 550 555 560

Ile Phe Asn Glu Phe Glu Gly Gln Met Glu Gln Gly Gln Ile Gly Gly

565 570 575

Ser Gly Asp Val Lys Tyr His Leu Gly Ser Glu Gly Gln His Leu Gln

580 585 590

Met Phe Gly Asp Gly Glu Ile Lys Val Ser Leu Thr Ala Asn Pro Ser

595 600 605

His Leu Glu Ala Val Asn Pro Val Met Glu Gly Ile Val Arg Ala Lys

610 615 620

Gln Asp Tyr Leu Asp Lys Gly Val Asp Gly Lys Thr Val Val Pro Leu

625 630 635 640

Leu Leu His Gly Asp Ala Ala Phe Ala Gly Leu Gly Ile Val Pro Glu

645 650 655

Thr Ile Asn Leu Ala Lys Leu Arg Gly Tyr Asp Val Gly Gly Thr Ile

660 665 670

His Ile Val Val Asn Asn Gln Ile Gly Phe Thr Thr Thr Pro Asp Ser

675 680 685

Ser Arg Ser Met His Tyr Ala Thr Asp Tyr Ala Lys Ala Phe Gly Cys

690 695 700

Pro Val Phe His Val Asn Gly Asp Asp Pro Glu Ala Val Val Trp Val

705 710 715 720

Gly Gln Leu Ala Thr Glu Tyr Arg Arg Arg Phe Gly Lys Asp Val Phe

725 730 735

Ile Asp Leu Val Cys Tyr Arg Leu Arg Gly His Asn Glu Ala Asp Asp

740 745 750

Pro Ser Met Thr Gln Pro Lys Met Tyr Glu Leu Ile Thr Gly Arg Glu

755 760 765

Thr Val Arg Ala Gln Tyr Thr Glu Asp Leu Leu Gly Arg Gly Asp Leu

770 775 780

Ser Asn Glu Asp Ala Glu Ala Val Val Arg Asp Phe His Asp Gln Met

785 790 795 800

Glu Ser Val Phe Asn Glu Val Lys Lys Gly Gly Lys Lys Gln Ala Glu

805 810 815

Ala Gln Thr Gly Ile Thr Gly Ser Gln Lys Leu Pro His Gly Leu Glu

820 825 830

Thr Asn Ile Ser Arg Glu Glu Leu Leu Glu Leu Gly Gln Ala Phe Ala

835 840 845

Asn Thr Pro Glu Gly Phe Asn Tyr His Pro Arg Val Ala Pro Val Ala

850 855 860

Lys Lys Arg Val Ser Ser Val Thr Glu Gly Gly Ile Asp Trp Ala Trp

865 870 875 880

Gly Glu Leu Leu Ala Phe Gly Ser Leu Ala Asn Ser Gly Arg Leu Val

885 890 895

Arg Leu Ala Gly Glu Asp Ser Arg Arg Gly Thr Phe Thr Gln Arg His

900 905 910

Ala Val Ala Ile Asp Pro Ala Thr Ala Glu Glu Phe Asn Pro Leu His

915 920 925

Glu Leu Ala Gln Ser Lys Gly Asn Asn Gly Lys Phe Leu Val Tyr Asn

930 935 940

Ser Ala Leu Thr Glu Tyr Ala Gly Met Gly Phe Glu Tyr Gly Tyr Ser

945 950 955 960

Val Gly Asn Glu Asp Ser Val Val Ala Trp Glu Ala Gln Phe Gly Asp

965 970 975

Phe Ala Asn Gly Ala Gln Thr Ile Ile Asp Glu Tyr Val Ser Ser Gly

980 985 990

Glu Ala Lys Trp Gly Gln Thr Ser Lys Leu Ile Leu Leu Leu Pro His

995 1000 1005

Gly Tyr Glu Gly Gln Gly Pro Asp His Ser Ser Ala Arg Ile Glu Arg

1010 1015 1020

Phe Leu Gln Leu Cys Ala Glu Gly Ser Met Thr Val Ala Gln Pro Ser

1025 1030 1035 1040

Thr Pro Ala Asn His Phe His Leu Leu Arg Arg His Ala Leu Ser Asp

1045 1050 1055

Leu Lys Arg Pro Leu Val Ile Phe Thr Pro Lys Ser Met Leu Arg Asn

1060 1065 1070

Lys Ala Ala Ala Ser Ala Pro Glu Asp Phe Thr Glu Val Thr Lys Phe

1075 1080 1085

Gln Ser Val Ile Asp Asp Pro Asn Val Ala Asp Ala Ala Lys Val Lys

1090 1095 1100

Lys Val Met Leu Val Ser Gly Lys Leu Tyr Tyr Glu Leu Ala Lys Arg

1105 1110 1115 1120

Lys Glu Lys Asp Gly Arg Asp Asp Ile Ala Ile Val Arg Ile Glu Met

1125 1130 1135

Leu His Pro Ile Pro Phe Asn Arg Ile Ser Glu Ala Leu Ala Gly Tyr

1140 1145 1150

Pro Asn Ala Glu Glu Val Leu Phe Val Gln Asp Glu Pro Ala Asn Gln

1155 1160 1165

Gly Pro Trp Pro Phe Tyr Gln Glu His Leu Pro Glu Leu Ile Pro Asn

1170 1175 1180

Met Pro Lys Met Arg Arg Val Ser Arg Arg Ala Gln Ser Ser Thr Ala

1185 1190 1195 1200

Thr Gly Val Ala Lys Val His Gln Leu Glu Glu Lys Gln Leu Ile Asp

1205 1210 1215

Glu Ala Phe Glu Ala

1220

<210> 5

<211> 54

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

cagtgccaag cttgcatgcc tgcaggtcga ctctagttgt tacgcagcat ggac 54

<210> 6

<211> 37

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

ccagatggaa tctgtgttca acgaagtcaa gaaaggc 37

<210> 7

<211> 37

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

gcctttcttg acttcgttga acacagattc catctgg 37

<210> 8

<211> 56

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

cagctatgac catgattacg aattcgagct cggtaccctt tgaaggccaa atggag 56

<210> 9

<211> 18

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

ttcggtgaca gaggagac 18

<210> 10

<211> 18

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

atgacccagc caaagatg 18

<210> 11

<211> 55

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 11

cagtgccaag cttgcatgcc tgcaggtcga ctctaggttg gtattgatgt cgcag 55

<210> 12

<211> 36

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 12

gaggctttcg aggcttaatg gacttcctaa agaggg 36

<210> 13

<211> 36

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 13

ccctctttag gaagtccatt aagcctcgaa agcctc 36

<210> 14

<211> 39

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 14

gatagctacc ccaaatactc acgttatttt taggagaac 39

<210> 15

<211> 39

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 15

gttctcctaa aaataacgtg agtatttggg gtagctatc 39

<210> 16

<211> 57

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 16

cagctatgac catgattacg aattcgagct cggtaccccg acctgattca aagcctc 57

<210> 17

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 17

tagggtcagc ttgtaaaac 19

<210> 18

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 18

ttccaatccg tgatcgacg 19

<210> 19

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 19

gaaggctgtg cttctgttg 19

<210> 20

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 20

ctcaactacc agccaaatc 19

<210> 21

<211> 54

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 21

gcttgcatgc ctgcaggtcg actctagagg atccccttaa gcctcgaaag cctc 54

<210> 22

<211> 54

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 22

atcaggctga aaatcttctc tcatccgcca aaaccacgtt atttttagga gaac 54

<210> 23

<211> 55

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 23

cagtgccaag cttgcatgcc tgcaggtcga ctctagtttt cacgctagtt cagcc 55

<210> 24

<211> 38

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 24

caacaaatta atgctacaac agctggagga gaagcagc 38

<210> 25

<211> 38

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 25

gctgcttctc ctccagctgt tgtagcatta atttgttg 38

<210> 26

<211> 56

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 26

cagctatgac catgattacg aattcgagct cggtacccga tccgatccta gaaaac 56

<210> 27

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 27

ttttcacgct agttcagcc 19

<210> 28

<211> 18

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 28

gatccgatcc tagaaaac 18

Claims

1. A polynucleotide sequence comprising a polynucleotide encoding the amino acid sequence shown in SEQ ID NO. 3 or a homologous sequence thereof, and having point mutations such that the glutamic acid at position 809 of said amino acid sequence is substituted with a different amino acid.

Preferably, the glutamic acid at position 809 is substituted with lysine.

Preferably, the polynucleotide sequence encoding the amino acid sequence shown in SEQ ID NO. 3 comprises the polynucleotide sequence shown in SEQ ID NO. 1.

2. A polynucleotide sequence according to claim 1, wherein the point mutation comprises a mutation at base 2425 of the polynucleotide sequence shown in SEQ ID NO. 1.

Preferably, the mutation comprises the mutation of the 2425 th cytosine (C) of the polynucleotide sequence shown in SEQ ID NO. 1 into thymine (T).

Preferably, the polynucleotide sequence comprises the polynucleotide sequence shown in SEQ ID NO. 2.

3. 3 or a homologous sequence thereof, and the 809 th glutamic acid of the amino acid sequence is replaced by a different amino acid.

Preferably, the glutamic acid at position 809 is substituted with lysine.

The amino acid sequence shown in SEQ ID NO. 3 is preferred, wherein the amino acid sequence of which 809 th glutamic acid is replaced by lysine is shown in SEQ ID NO. 4.

4. The amino acid sequence of claim 3, which is encoded by the polynucleotide sequence of claim 1.

5. A recombinant vector constructed by introducing the polynucleotide sequence of any one of claims 1-2 into a plasmid.

Preferably, the plasmid is pK18mobsacB plasmid or pXMJ19 plasmid.

6. A recombinant strain having improved expression of a polynucleotide encoding the amino acid sequence of SEQ ID No. 3 or a homologous sequence thereof.

Preferably, the improved expression of the polynucleotide sequence is achieved by incorporating a polynucleotide encoding the amino acid sequence of SEQ ID NO. 3 or a homologous sequence thereof with a promoter sequence into an expression vector, and introducing the expression vector into a host cell, thereby overexpressing the amino acid sequence.

Preferably, the polynucleotide having a point mutation according to claim 1 having a promoter sequence is incorporated into a specific site of a chromosome of a microorganism, thereby overexpressing the nucleic acid sequence.

Preferably, the polynucleotide having a point mutation according to claim 1 having a promoter sequence is incorporated into an expression vector, and the expression vector is introduced into a host cell, thereby overexpressing the amino acid sequence.

Preferably, the polynucleotide sequence expression enhancement is the incorporation of the polynucleotide having a point mutation of claim 1 into an expression vector, and the introduction of the expression vector into a host cell, thereby increasing the copy number.

7. The recombinant strain according to claim 6, which contains the polynucleotide sequence of claim 2.

Preferably, the recombinant strain is formed by introducing the recombinant vector of claim 5 into a host strain.

Preferably, the host bacterium of the recombinant strain is ATCC15168 or CGMCC NO. 20437.

8. A method of producing L-isoleucine, said method comprising: culturing the recombinant strain of any one of claims 6-7, and recovering L-isoleucine from the culture.

9. Use of the polynucleotide sequence of any one of claims 1-2, the amino acid sequence of any one of claims 3-4, the recombinant vector of claim 5, or the recombinant strain of any one of claims 6-7 for the production of L-isoleucine.