CN104911137A - Shikimic acid-producing corynebacterium glutamicum, and construction method and application thereof - Google Patents
Shikimic acid-producing corynebacterium glutamicum, and construction method and application thereof Download PDFInfo
- Publication number
- CN104911137A CN104911137A CN201510175678.8A CN201510175678A CN104911137A CN 104911137 A CN104911137 A CN 104911137A CN 201510175678 A CN201510175678 A CN 201510175678A CN 104911137 A CN104911137 A CN 104911137A
- Authority
- CN
- China
- Prior art keywords
- gene
- pxmj19
- arod
- arob
- aroe
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/10—Transferases (2.)
- C12N9/12—Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)
- C12N9/1205—Phosphotransferases with an alcohol group as acceptor (2.7.1), e.g. protein kinases
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/74—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora
- C12N15/77—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora for Corynebacterium; for Brevibacterium
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P7/00—Preparation of oxygen-containing organic compounds
- C12P7/40—Preparation of oxygen-containing organic compounds containing a carboxyl group including Peroxycarboxylic acids
- C12P7/42—Hydroxy-carboxylic acids
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y207/00—Transferases transferring phosphorus-containing groups (2.7)
- C12Y207/01—Phosphotransferases with an alcohol group as acceptor (2.7.1)
- C12Y207/01071—Shikimate kinase (2.7.1.71)
Abstract
The invention provides a shikimic acid-producing corynebacterium glutamicum, including aroG, aroB, aroD and aroE genes, also contains RBS1 for regulating the expression of the aroG gene, RBS2 for regulating the expression of the aroB gene, RBS3 for regulating the expression of aroD gene, and RBS4 for regulating the expression of the aroE gene. The gene sequence of RBS1 is shown as SEQ ID NO: 1; the gene sequence of RBS2 is shown as SEQ ID NO: 2; the gene sequence of RBS3 is shown as SEQ ID: 3; and the gene sequence of RBS4 is shown as SEQ ID NO: 4. The invention also provides a construction method and application of the above shikimic acid-producing corynebacterium glutamicum. The invention employs appropriate RBS sequences to adjust the expression level of aroG, aroB, aroD and aroE genes in shikimic acid expression pathway, and greatly improves the yield of shikimic acid.
Description
Technical field
The present invention relates to microbial technology field, be specifically related to a kind of produce shikimic acid Corynebacterium glutamicum and construction process and application.
Background technology
Shikimic acid (3,4,5-trihydroxy-1-cyclohexene-1-carboxylic acid, shikimic acid, SA) in white crystalline, specific rotatory power [α]=-157 ° × cm
3/ g × dm
-1, maximal ultraviolet absorption is at 235nm, and it has multiple isomers, but only has the isomers of α type to have biologic activity.Shikimic acid, except can be used for synthetic styrene-acrylic propylhomoserin, TYR, tryptophane, also can be used for the compound such as synthesise vitamins, hexanodioic acid.Shikimic acid can pass through the means such as chemosynthesis, fermentable, plant extraction and obtain.Traditional shikimic acid is produced and is carried out mainly through plant extraction, and the fruit of plant star anise is the main source of industrial acquisition shikimic acid.But because star anise is only distributed in global only a few area, the impact of the factors such as its output climate, physical environment, therefore seriously limits the output of shikimic acid.Chemosynthesis shikimic acid is because productive rate is not high, high thus the failing of complex process, price is extensively carried out.Utilize fermentable produce shikimic acid have simple to operate, energy consumption is little, production cost and the low advantage such as pollution-free,, energy shortage comparatively large at current resources requirement, environmental requirement improve constantly, present distinctive superiority and wide development space.
The bacterial strain of existing product shikimic acid mainly passes through aroG, aroB, aroD, aroE tetra-genes in the mode process LAN approach of shikimic acid pathway genetic modification, although the bacterial strain transformed through above method can promote the production efficiency of shikimic acid under certain condition, but the gene Reconstruc-tion policy of shikimic acid pathway only highlighted in process LAN approach, and use identical RBS element to carry out the expression of controlling gene in translation skill, limit the further raising to shikimic acid ability to express.Such as: the people such as Chen transform intestinal bacteria, the shikimic acid output of its bacterial strain is only 1.85g/L (Chen K, Dou J, Tang S, Yang Y, Wang H, Fang H, Zhou C (2012) Deletion of the aroK gene is essential for high shikimic acid accumulation through the shikimate pathway in E.coli.Bioresour Technol 119:141-7).The people such as Cui transform intestinal bacteria, the shikimic acid output of its bacterial strain is also only 3.12g/L (Cui YY, Ling C, Zhang YY, Huang J, Liu JZ (2014) Production of shikimic acid from Escherichia coli through chemically inducible chromosomal evolution and cofactor metabolic engineering.Microb Cell Fact 13:21).
Summary of the invention
The object of this invention is to provide a kind of produce shikimic acid Corynebacterium glutamicum and construction process and application, by selecting the expression amount of aroG, aroB, aroD, aroE gene in suitable RBS sequence adjustment shikimic acid expression approach, thus greatly improve the output of shikimic acid.
The invention provides a kind of Corynebacterium glutamicum producing shikimic acid, comprise aroG, aroB, aroD and aroE gene, the RBS3 of the RBS1 also comprising regulation and control aroG genetic expression, the RBS2 regulating and controlling aroB genetic expression, regulation and control aroD genetic expression and the RBS4 of regulation and control aroE genetic expression; The gene order of aroG is for shown in SEQ ID NO:6, and the gene order of aroB is for shown in SEQ ID NO:7, and the gene order of aroD is for shown in SEQ ID NO:8, and the gene order of aroE is for shown in SEQ ID NO:9;
In technique scheme, the gene order of RBS1 is for shown in SEQ ID NO:1, and the gene order of RBS2 is for shown in SEQ ID NO:2, and the gene order of RBS3 is for shown in SEQ ID NO:3, and the gene order of RBS4 is for shown in SEQ ID NO:4.
In technique scheme, be also inserted with terminator 2 between aroB gene and aroD gene, the gene order of terminator 2 is for shown in SEQ ID NO:11.
In technique scheme, also comprise RiboJ gene, the gene order of RiboJ is for shown in SEQ ID NO:5.
In technique scheme, RiboJ gene is inserted with between the promotor of aroG gene and aroG gene, be inserted with RiboJ gene between described aroB gene and the promotor of aroB gene, between described aroD gene and the promotor of aroD gene, be inserted with RiboJ gene, between described aroE gene and the promotor of aroE gene, be inserted with RiboJ gene.
Present invention also offers a kind of construction process producing the Corynebacterium glutamicum of shikimic acid, comprise the steps:
1) by aroG, aroB, aroD and aroE gene insertion vector pXMJ19 respectively, carrier pXMJ19-aroG, pXMJ19-aroB, pXMJ19-aroD, pXMJ19-aroE is obtained;
2) by HindIII and the PstI restriction enzyme site in aroG, BamHI and the SpeI restriction enzyme site in aroB, the PstI restriction enzyme site in aroD, EcoRI and the SalI restriction enzyme site in aroE suddenlys change, and obtains carrier pXMJ19-aroG
mU, pXMJ19-aroB
mU, pXMJ19-aroD
mU, pXMJ19-aroE
mU;
3) by RiboJ gene insertion vector pXMJ19, carrier pXMJ19-RiboJ is obtained;
4) by fluorescence protein gene insertion vector pXMJ19-RiboJ, carrier pZB is obtained;
5) use primer MU-RBSAG-F and MU-RBSAG-R with pXMJ19-aroG
mUfor template amplification gene fragment aroG
mU, with primer MU-RBSAB-F and MU-RBSAB-R with pXMJ19-aroB
mUfor template amplification gene fragment aroB
mU, with primer MU-RBSAD-F and MU-RBSAD-R with pXMJ19-aroD
mUfor template amplification gene fragment aroD
mU, with primer MU-RBSAE-F and MU-RBSAE-R with pXMJ19-aroE
mUfor template amplification gene fragment aroE
mU;
6) by step 5) the middle gene fragment aroG increased
mU, aroB
mU, aroD
mUand aroE
mUinsertion vector pZB, obtains carrier pZB-aroG, pZB-aroB, pZB-aroD and pZB-aroE respectively;
7) step 6) carrier that obtains transformation of E. coli respectively, the clone obtained is checked order, by carrier pZB-aroG, pZB-aroB, pZB-aroD and pZB-aroE cotransformation errorless for order-checking in Corynebacterium glutamicum Δ aroK, cultivate and fluorescence intensity;
8) use primer aroG-H-F, aroG-H-R with pXMJ19-aroG
mUfor template amplification gene fragment aroG-H and insertion vector pXMJ19-RiboJ, obtain carrier pXMJ19-RiboJ-aroG
mU-H; The gene order of described aroG-H is as shown in SEQ ID NO:13;
9) use primer aroB-M-F, aroB-M-R with pXMJ19-aroB
mUfor template amplification gene fragment aroB-M; With aroD-M-F, aroD-M-R with pXMJ19-aroD
mUfor template amplification gene fragment aroD-M; With aroE-M-F, aroE-M-R with pXMJ19-aroE
mUfor template amplification gene fragment aroE-M; By gene fragment aroB-M, aroD-M and the aroE-M insertion vector pXMJ19-RiboJ of amplification, obtain carrier pXMJ19-RiboJ-aroB
mU-M, pXMJ19-RiboJ-aroD
mU-M and pXMJ19-RiboJ-aroE
mU-M; The gene order of described aroB-M, aroD-M and aroE-M is successively respectively as shown in SEQ ID NO:14, SEQ ID NO:15 and SEQ ID NO:16;
10) use primer PB-F, PB-R with pXMJ19-RiboJ-aroB
mU-M is template amplification gene fragment Ptac-aroB-M; With primer PD-F, PD-R with pXMJ19-RiboJ-aroD
mU-M is template amplification gene fragment Ptac-aroD-M; With primer PE-F, PE-R with pXMJ19-RiboJ-aroE
mU-M is template amplification gene fragment Ptac-aroE-M, by gene fragment Ptac-aroB-M insertion vector pXMJ19-RiboJ-aroG
mU-H, obtains carrier pXMJ19-GHBM; The gene order of described Ptac-aroB-M is as shown in SEQ ID NO:17;
11) by fragment Ptac-aroD-M insertion vector pXMJ19-GHBM, carrier pXMJ19-GHBMDM is obtained; The gene order of described Ptac-aroD-M is as shown in SEQ ID NO:18.
12) by fragment Ptac-aroE-M insertion vector carrier pXMJ19-GHBMDM, carrier pXMJ19-GBDE is obtained; The gene order of described Ptac-aroE-M is as shown in SEQ ID NO:19;
13) primer Terminator2-F, Terminator2-R is used to take pXMJ19 as template amplification terminator 2, terminator 2 and carrier pXMJ19-GBDE are carried out enzyme with XmaI respectively cut, reclaim terminator 2 fragment and carrier, terminator 2 fragment is connected with carrier, obtains carrier pXMJ19-GBTDE;
14) pXMJ19-GBTDE is converted into C.glutamicum RES167 Δ aroK, obtains the Corynebacterium glutamicum producing shikimic acid.
In the construction process of the Corynebacterium glutamicum of above-mentioned product shikimic acid, step 4) in fluorescence protein gene be egfp gene.
Present invention also offers a kind of method of producing shikimic acid, comprise the steps:
Be chilled in the fermention medium of leavening temperature by the Corynebacterium glutamicum seed liquor of the above-mentioned arbitrary product shikimic acid of inoculum size inoculation of 2% ~ 4% volume ratio after sterilizing, the OD value of described seed liquor is 14, temperature is 30 DEG C, Ventilation Rate is 3vvm, sucrose is added in fermenting process, mixing speed is cultivation and fermentation 3 ~ 5 days under the condition of 300rpm, and obtaining containing shikimic acid concentration is the fermented liquid of 10 ~ 12g/L.
Add in sucrose step in fermenting process, add sucrose in fermentation 20 hours and fermentation when 34 hours respectively, 35g sucrose added by often liter of fermented liquid.
In the method for above-mentioned production shikimic acid, the substratum that the Corynebacterium glutamicum seed liquor of shikimic acid is produced in preparation is: K
2hPO
43H
2o 0.5g/L, KH
2pO
40.5g/L, (NH
4)
2sO
410g/L, glucose 40g/L, MgSO
47H
2o 0.2g/L, phenylalanine 0.15g/L, tyrosine 0.15g/L, tryptophane 0.15g/L, CaCO
330g/L, FeSO
47H
2o 0.02g/L, MnSO
44H
2o 0.02g/L, vitamin H 50 μ g/L, VitB1 200 μ g/L, pH 7.4.
In the method for above-mentioned production shikimic acid, the fermention medium producing shikimic acid is: K
2hPO
43H
2o 0.5g/L, KH
2pO
40.5g/L, urea 3g/L, sucrose 38g/L, MgSO
47H
2o 0.2g/L, yeast powder 10g/L, peptone 4g/L, FeSO
47H
2o 0.02g/L, MnSO
44H
2o 0.02g/L, vitamin H 50 μ g/L, VitB1 200 μ g/L, pH 7.4.
The present invention selects different RBS respectively by key gene aroG, aroB, aroD, the aroE of the shikimic acid route of synthesis for Corynebacterium glutamicum, makes four kinds of gene expression amounts be conducive to the shikimic acid synthesis of Corynebacterium glutamicum most; The present invention inserts RiboJ gene respectively after the promotor of key gene aroG, aroB, aroD, aroE, thus eliminates impact non-coding region that Ptac promotor formed after transcribing caused protein translation.
Accompanying drawing explanation
Fig. 1 is key gene and the controlling element structure iron of the Corynebacterium glutamicum of the product shikimic acid that the embodiment of the present invention provides;
Fig. 2 is the shikimic acid Yield mapping of the Corynebacterium glutamicum of the shake-flask culture product shikimic acid that the embodiment of the present invention provides;
Fig. 3 is high performance liquid chromatography (HPLC) the detected result figure of the fermented liquid composition of the Corynebacterium glutamicum of the product shikimic acid that the embodiment of the present invention provides.
Embodiment
Following examples further illustrate of the present invention, but the invention is not restricted to following embodiment.
Experimental technique in following embodiment, if no special instructions, is ordinary method.Test materials used in following embodiment, if no special instructions, is routine biochemistry reagent shop and purchases available.Quantitative test in following examples, all arranges and repeats experiment for three times, results averaged.Intestinal bacteria in following examples are: E.coli DH5 α, the bacterial strain Corynebacterium glutamicum Δ aroK/pXMJ19-GBTDE that the auxotrophic strain (Corynebacterium glutamicum Δ aroK) of Corynebacterium glutamicum shikimate kinase gene knockout and the present invention build, be preserved in China Committee for Culture Collection of Microorganisms's common micro-organisms center (China General Microbiological Culture Collection Center, CGMCC), the deposit number of Corynebacterium glutamicum Δ aroK is: CGMCC No.10678, Corynebacterium glutamicum Δ aroK/pXMJ19-GBTDE deposit number is: CGMCC No.10679, the preservation address of two bacterial strains is all: No. 3, Yard 1, BeiChen xi Road, Chaoyang District, Beijing City, preservation date is all: on April 1st, 2015.
Embodiment 1
The structure of pXMJ19-aroG, pXMJ19-aroB, pXMJ19-aroD, pXMJ19-aroE carrier
Increase aroG, aroB, aroD and aroE gene from the genome of Corynebacterium glutamicum, the primer is aroG-F, aroG-R, aroB-F, aroB-R, aroD-F, aroD-R, aroE-F and aroE-R, wherein, aroG-F is the forward primer for aroG gene, aroG-R is the reverse primer for aroG gene, by that analogy.Use endonuclease KpnI, SalI enzyme cuts aroG, aroB, aroD gene and carrier pXMJ19, reclaim gene fragment and carrier, by the aroG reclaimed, aroB, aroD gene fragment is connected in carrier pXMJ19 (purchased from Hangzhou Gong Dao Bioisystech Co., Ltd), use endonuclease KpnI, PstI enzyme cuts aroE gene fragment and carrier pXMJ19, reclaim gene fragment and carrier, gene fragment is connected with carrier, aroG is cloned into the KpnI of carrier, SalI site, aroB is cloned into the KpnI of carrier, SalI site, aroD is cloned into the KpnI of carrier, SalI site, aroE is cloned into the KpnI of carrier, PstI site.The method of attachment of aroG, aroB, aroD and aroE gene fragment and carrier is: add in the PCR pipe of sterilizing by T4DNA ligase enzyme damping fluid 2.5 μ l, adds DNA fragmentation 1 μ l and the carrier DNA 7 μ l of recovery, adds T4DNA ligase enzyme 1 μ l, add ddH
2o 13.5 μ l, 16 DEG C are reacted 2 hours, obtain recombinant plasmid vector, and the carrier obtained is called after pXMJ19-aroG, pXMJ19-aroB, pXMJ19-aroD, pXMJ19-aroE respectively.
The primer sequence is as follows:
| aroG-F | CGCGCGTCGACATGAATAGGGGTGTGAGTTG |
| aroG-R | CGCGCGGTACCTTAGTTACGCAGCATTTCTGCAACG |
| aroB-F | CGCGCGTCGACATGAGCGCAGTGCAGATTTTC |
| aroB-R | CGCGCGGTACCTTAGTGGCTGATTGCCTCATAGCA |
| aroD-F | CGCGCGTCGACATGCCTGGAAAAATTCTCCT |
| aroD-R | CGCGCGGTACCTTACTTTTTGAGATTTGCCAGGATA |
| aroE-F | CGCGCCTGCATATGGGTTCTCACATCACTCAC |
[0042]
| aroE-R | CGCGCGGTACCTTAGTGTTCTTCTGAGATGCCT |
Embodiment 2
Restriction enzyme site suddenlys change
Conveniently follow-up vector construction, to restriction enzyme site HindIII, PstI in aroG, restriction enzyme site BamHI, SpeI in aroB, the restriction enzyme site PstI in aroD, restriction enzyme site EcoRI, SalI in aroE suddenly change.The primer is MU-aroG-1-F, MU-aroG-1-R, MU-aroG-2-F, MU-aroG-2-R, MU-aroG-3-F, MU-aroG-3-R, MU-aroB-1-F, MU-aroB-1-R, MU-aroB-2-F, MU-aroB-2-R, MU-aroD-F, MU-aroD-R, MU-aroE-1-F, MU-aroE-1-R, MU-aroE-2-F, MU-aroE-2-R, wherein, MU-aroG-1-F, MU-aroG-1-R is the pair of primers for aroG gene containing mutational site, MU-aroG-2-F, MU-aroG-2-R is the second pair of primer for aroG gene containing mutational site, by that analogy.With above-mentioned primer with pXMJ19-aroG, pXMJ19-aroB, pXMJ19-aroD, pXMJ19-aroE for template carries out PCR respectively, the PCR primer obtained, transformation of E. coli competent cell, the clone grown adopts s-generation DNA sequencing technology to check order, and selects the carrier of correct sudden change according to sequencing result.The carrier obtained is called after pXMJ19-aroG respectively
mU, pXMJ19-aroB
mU, pXMJ19-aroD
mU, pXMJ19-aroE
mU.Carrying out suddenlys change is conveniently follow-up carrier and the assembling of DNA fragmentation, aroG, aroB, aroD, aroE gene internal is included in follow-up assembling the restriction enzyme sites such as BamHI, EcoRI, KpnI, the SalI needing to use, deposit in case in these sites, cannot test according to the restriction enzyme site designed in advance, therefore need above-mentioned site to suddenly change.
The primer sequence is as follows:
Embodiment 3
The insertion of RiboJ gene
RiboJ gene buys spontaneous work biotechnology (Shanghai) limited-liability company, and is cloned in the pUC19 of Sangon Biotech's purchase.Use primer RiboJ-F, RiboJ-R amplification RiboJ gene, the gene fragment of amplification is through reclaiming, cut RiboJ gene and carrier pXMJ19 with endonuclease HindIII, PstI enzyme, reclaim RiboJ gene fragment and carrier, RiboJ gene fragment is connected with carrier, method of attachment is: add in the PCR pipe of sterilizing by T4DNA ligase enzyme damping fluid 2.5 μ l, add DNA fragmentation 1 μ l and the carrier DNA 7 μ l of recovery, add T4DNA ligase enzyme 1 μ l, add ddH
2o 13.5 μ l, 16 DEG C are reacted 2 hours, obtain recombinant plasmid vector, the carrier called after pXMJ19-RiboJ obtained.
The effect of RiboJ: the non-coding region of Ptac promotor after transcribing can impact the translation of protein, after adding RiboJ fragment, after transcribing, RiboJ can form the secondary structure of ribozyme form and the sequence of self front end be cut off, thus eliminates the impact that non-coding region that Ptac promotor formed after transcribing can cause protein translation.
The primer sequence is as follows:
| RiboJ-F | CGCGAAGCTTAGCTGTCACCGGATGTGCTTTCCGGTCTGATGAGTC |
| RiboJ-R | CGCGCTGCAGTTAAACAAAATTATTTGTAGAGGCTGTTTCG |
Embodiment 4
The insertion of EGFP gene
Primer EGFP-F is used from carrier pACGFP, EGFP-R amplification egfp gene (enhanced green fluorescent protein gene), the gene fragment of above-mentioned primer amplification is through reclaiming, use endonuclease EcoRI, KpnI enzyme cuts egfp gene fragment and carrier pXMJ19-RiboJ, reclaim egfp gene fragment and carrier, egfp gene is connected with carrier, method of attachment: T4DNA ligase enzyme damping fluid 2.5 μ l is added in the PCR pipe of sterilizing, add DNA fragmentation 1 μ l and the carrier DNA 7 μ l of recovery, add T4DNA ligase enzyme 1 μ l, add ddH2O 13.5 μ l, 16 DEG C are reacted 2 hours, obtain recombinant plasmid vector, the carrier called after pZB obtained.
The primer sequence is as follows:
| EGFP-F | CGCGGGTACCGTGAGCAAGGGCGCCGAGC |
| EGFP-R | CGCGGAATTCTCACTTGTACAGCTCATCCATGCCGTGGGT |
Embodiment 5
The insertion of RBS sequence
With primer MU-RBSAG-F, MU-RBSAG-R, MU-RBSAB-F, MU-RBSAB-R, MU-RBSAD-F, MU-RBSAD-R, MU-RBSAE-F, MU-RBSAE-R respectively with pXMJ19-aroG
mU, pXMJ19-aroB
mU, pXMJ19-aroD
mU, pXMJ19-aroE
mUfor template amplification goes out gene fragment, the gene fragment of above-mentioned primer amplification is through reclaiming, the gene fragment cut back to close with endonuclease SalI, KpnI enzyme and carrier pXMJ19, the gene fragment of recovery is connected with carrier, method of attachment: T4DNA ligase enzyme damping fluid 2.5 μ l is added in the PCR pipe of sterilizing, add DNA fragmentation 1 μ l and the carrier DNA 7 μ l of recovery, add T4DNA ligase enzyme 1 μ l, add ddH
2o 13.5 μ l, 16 DEG C are reacted 2 hours, obtain recombinant plasmid vector, plasmid vector called after pZB-aroG, pZB-aroB, pZB-aroD, pZB-aroE of obtaining.By above-mentioned plasmid vector transformation of E. coli respectively.S-generation DNA sequencing technology is adopted to check order to the clone obtained.
The primer sequence is as follows:
Embodiment 6
Fluorescence intensity detects
The errorless plasmid that checks order in embodiment 5 is converted in Corynebacterium glutamicum Δ aroK again, and in MS substratum, 0.5mM IPTG induces, 30 DEG C, and 200rpm cultivates fluorescence intensity and OD600 after 48 hours.The detection of OD600 and fluorescence intensity uses
synergy H4Hybrid microplate reader.(often liter of substratum contains MS substratum: Na
2hPO
4-12H
2o 2.0g, KH
2pO
40.5g, MgSO
4-7H
2o 0.03g, NH
4c1 0.53g, trace element solution 2m1, vitamin H 100g, VITMAIN B1 500g, pH 8.0).Wherein, trace element solution consists of: EDTA0.500g, ZnSO
4-7H
2o 0.220g, CaC1
20.055g, MnCl
2-4H
2o 0.051g, FeSO
4-7H
2o 0.0499g, (NH
4)
6mo
7o
24-4H
2o 0.011g, CuSO
4-5H
2o 0.0157g, CoCl
2-6H
2o 0.0161g, adds water to 1000ml; PH 6.0.
Through detecting the relative intensity of fluorescence finding that different RBS is corresponding: RBS1:AAAGGGTGAATCT is 250985.7, RBS2:AAAGGCATGTTCT is 603334, RBS3:AAAGGCATGGCCG is 277826, RBS4:AAAGG AGAACGTG is 233609.
Embodiment 7
Carrier pXMJ19-RiboJ-aroG
mU-H builds
Use primer aroG-H-F, aroG-H-R with pXMJ19-aroG respectively
mUfor template amplification goes out the gene fragment of the above-mentioned primer amplification of gene fragment aroG-H through reclaiming, with endonuclease SalI, BamHI respectively enzyme cut aroG-H gene fragment and carrier pXMJ19-RiboJ, reclaim gene fragment and carrier, gene fragment is connected with carrier, method of attachment: T4DNA ligase enzyme damping fluid 2.5 μ l is added in the PCR pipe of sterilizing, add DNA fragmentation 1 μ l and the carrier 7 μ l of recovery, add T4DNA ligase enzyme 1 μ l, add ddH
2o 13.5 μ l, 16 DEG C are reacted 2 hours, obtain recombinant plasmid vector, the carrier called after pXMJ19-RiboJ-aroG obtained
mU-H.
The primer sequence is as follows:
| aroG-H-F | CGCGCGTCGACAAAGGGTGAATCTATGAATAGGGGTGTGAGTTG |
| aroG-H-R | CGCGCGGATCCTTAGTTACGCAGCATTTCTGCAACG |
Embodiment 8
Carrier pXMJ19-RiboJ-aroB
mU-M, pXMJ19-RiboJ-aroD
mU-M, pXMJ19-RiboJ-aroE
mUthe structure of-M
Use primer aroB-M-F respectively, aroB-M-R, aroD-M-F, aroD-M-R, aroE-M-F, aroE-M-R increases aroB-M, aroD-M, aroE-M gene, the gene of amplification is through reclaiming, use endonuclease SalI, BamHI respectively enzyme cuts aroB-M, aroD-M, aroE-M gene fragment and carrier pXMJ19-RiboJ, reclaim gene fragment and carrier, gene fragment is connected with carrier, method of attachment: T4DNA ligase enzyme damping fluid 2.5 μ l is added in the PCR pipe of sterilizing, add DNA fragmentation 1 μ l and the carrier DNA 7 μ l of recovery, add T4DNA ligase enzyme 1 μ l, add ddH
2o 13.5 μ l, 16 DEG C are reacted 2 hours, obtain recombinant plasmid vector, the carrier called after pXMJ19-RiboJ-aroB obtained
mU-M, pXMJ19-RiboJ-aroD
mU-M, pXMJ19-RiboJ-aroE
mU-M.
The primer sequence is as follows:
| aroB-M-F | CGCGCGTCGACAAAGGCATGTTCTATGAGCGCAGTGCAGATTTTC |
[0079]
| aroB-M-R | CGCGCGGATCCTTAGTGGCTGATTGCCTCATAAGCA |
| aroD-M-F | CGCGCGTCGACAAAGGCATGGCCGATGCCTGGAAAAATTCTCCT |
| aroD-M-R | CGCGCGGATCCTTACTTTTTGAGATTTGCCAGGATA |
| aroE-M-F | CGCGCGTCGACAAAGGAGAACGTGATGGGTTCTCACATCACTCAC |
| aroE-M-R | CGCGCGGATCCTTAGTGTTCTTCTGAGATGCCT |
Embodiment 9
Carrier pXMJ19-GHBM builds
With primer PB-F, PB-R, PD-F, PD-R, PE-F, PE-R respectively with pXMJ19-RiboJ-aroB
mU-M, pXMJ19-RiboJ-aroD
mU-M, pXMJ19-RiboJ-aroE
mU-M is that template amplification goes out gene fragment Ptac-aroB-M, Ptac-aroD-M, Ptac-aroE-M, the gene fragment of amplification through reclaiming, with endonuclease BamHI, XmaI respectively enzyme cut Ptac-aroB-M gene fragment and carrier pXMJ19-RiboJ-aroG
mU-H, reclaims gene fragment and carrier, gene fragment is connected with carrier, method of attachment: add in the PCR pipe of sterilizing by T4DNA ligase enzyme damping fluid 2.5 μ l, adds DNA fragmentation 1 μ l and the carrier 7 μ l of recovery, add T4DNA ligase enzyme 1 μ l, add ddH
2o 13.5 μ l, 16 DEG C are reacted 2 hours, obtain recombinant plasmid vector, obtain carrier called after pXMJ19-GHBM.
The primer sequence is as follows:
| PB-F | CGCGGGATCCTTGCGCCGACATCATAACGGTT |
| PB-R | CGCGCCCGGGTTAGTGGCTGATTGCCTCATAAGCA |
| PD-F | CGCGCCCGGGTTGCGCCGACATCATAACGGTT |
| PD-R | CGCGGGTACCTTACTTTTTGAGATTTGCCAGGATA |
| PE-F | CGCGGGTACCTTGCGCCGACATCATAACGGTT |
| PE-R | CGCGGAATTCTTAGTGTTCTTCTGAGATGCCT |
Embodiment 10
Carrier pXMJ19-GHBMDM builds
Again with KpnI, XmaI respectively enzyme cut gene fragment Ptac-aroD-M and carrier pXMJ19-GHBM, reclaim gene fragment and carrier, gene fragment is connected with carrier, method of attachment: T4DNA ligase enzyme damping fluid 2.5 μ l is added in the PCR pipe of sterilizing, add DNA fragmentation 1 μ l and the carrier 7 μ l of recovery, add T4DNA ligase enzyme 1 μ l, add ddH
2o 13.5 μ l, 16 DEG C are reacted 2 hours, obtain recombinant plasmid pXMJ19-GHBMDM.
Embodiment 11
Carrier pXMJ19-GBDE builds
With EcoRI, XmaI respectively enzyme cut gene fragment Ptac-aroE-M and carrier pXMJ19-GHBMDM, reclaim gene fragment and carrier, gene fragment is connected with carrier, method of attachment: T4DNA ligase enzyme damping fluid 2.5 μ l is added in the PCR pipe of sterilizing, add DNA fragmentation 1 μ l and the carrier 7 μ l of recovery, add T4DNA ligase enzyme 1 μ l, add ddH
2o 13.5 μ l, 16 DEG C are reacted 2 hours, obtain recombinant plasmid pXMJ19-GBDE.
Embodiment 12
Be that template amplification goes out terminator 1, terminator 2, terminator 3 gene fragment with primer Terminator1-F, Terminator1-R, Terminator2-F, Terminator2-R, Terminator3-F, Terminator3-R with pXMJ19, wherein, Terminator1-F, Terminator1-R are the pair of primers for terminator 1, by that analogy.The sequence of terminator 1, terminator 2 and terminator 3 is successively respectively as shown in the SEQ ID NO:10 in sequence table, SEQ ID NO:11 and SEQ ID NO:12.In the present invention, terminator stops transcribing of disparate modules on transcriptional level.Meanwhile, the generation of reading over phenomenon can also effectively be prevented.What is called is readed over and is referred to, in the polygenic situation of tandem expression, rrna is crossed terminator codon UAA and continues to translate the situation of downstream sequence.Terminator 1 gene fragment and carrier pXMJ19-GBDE XmaI are carried out enzyme cut, reclaim gene fragment and carrier, gene fragment is connected with carrier, method of attachment: T4DNA ligase enzyme damping fluid 2.5 μ l is added in the PCR pipe of sterilizing, add DNA fragmentation 1 μ l and the carrier 7 μ l of recovery, add T4DNA ligase enzyme 1 μ l, add ddH
2o 13.5 μ l, 16 DEG C are reacted 2 hours, obtain recombinant plasmid pXMJ19-GBTDE.
Terminator 2 gene fragment and carrier pXMJ19-GBTDE KpnI are carried out enzyme cut, reclaim gene fragment and carrier, gene fragment is connected with carrier, method of attachment: T4DNA ligase enzyme damping fluid 2.5 μ l is added in the PCR pipe of sterilizing, add DNA fragmentation 1 μ l and the carrier 7 μ l of recovery, add T4DNA ligase enzyme 1 μ l, add ddH
2o 13.5 μ l, 16 DEG C are reacted 2 hours, obtain recombinant plasmid pXMJ19-GBTDTE.
Terminator 3 gene fragment and carrier pXMJ19-GBTDTE BamHI are carried out enzyme cut, reclaim gene fragment and carrier, gene fragment is connected with carrier, method of attachment: T4DNA ligase enzyme damping fluid 2.5 μ l is added in the PCR pipe of sterilizing, add DNA fragmentation 1 μ l and the carrier 7 μ l of recovery, add T4DNA ligase enzyme 1 μ l, add ddH
2o 13.5 μ l, 16 DEG C are reacted 2 hours, obtain recombinant plasmid pXMJ19-GTBTDTE.
Embodiment 13
By carrier pXMJ19-GBDE, pXMJ19-GBTDE, pXMJ19-GBTDTE, pXMJ19-GTBTDTE is converted into C.glutamicum RES167 Δ aroK (this bacterium is the auxotrophic strain of the shikimate kinase gene knockout that oneself builds) respectively, (be preserved in China Committee for Culture Collection of Microorganisms's common micro-organisms center (China General Microbiological Culture Collection Center, CGMCC), deposit number CGMCC No.10678, in 250mL triangular flask, initial OD 600 is about 0.15, 0.5mM IPTG induces, 30 DEG C, 200rpm, cultivate 72 hours under the condition of dress liquid 50mL, shikimic acid output as shown in Figure 2.Wherein control strain is that under same culture condition, its shikimic acid output is 0.08g/L not through the shikimic acid output of the bacterial strain C.glutamicum RES167 Δ aroK of engineering science transformation.Nutrient media components and content as follows, often liter of substratum contains: K
2hPO
43H
2o 0.5g, KH
2pO
40.5g, (NH
4)
2sO
410g, glucose 40g, MgSO
47H
2o 0.2g, phenylalanine 0.15g, tyrosine 0.15g, tryptophane 0.15g, CaCO
330g, FeSO
47H
2o 0.02g, MnSO
44H
2o 0.02g, vitamin H 50 μ g, VitB1 200 μ g, pH 7.4.
Carrier pXMJ19-GBTDE is converted in C.glutamicum RES167 Δ aroK (this bacterium is the auxotrophic strain of the shikimate kinase gene knockout that oneself builds), in 250mL triangular flask, initial OD 600 is about 0.15,0.5mM IPTG induces, 30 DEG C, 200rpm, cultivate 72 hours under the condition of dress liquid 50mL, shikimic acid output can reach 4.3g/L.Wherein control strain is that under same culture condition, its shikimic acid output is 0.77g/L not through the bacterial strain C.glutamicum RES167 Δ aroK of engineering science transformation.In 5L fermentor tank, inoculum size is 5% inoculation by volume, the OD600 value of seed liquor is that 14,0.5mM IPTG induces, and temperature is 30 DEG C, Ventilation Rate is 3vvm, dissolved oxygen 50%, adds sucrose in 20 hours and 34 hours in fermentation in fermenting process respectively, and 35 grams of sucrose added by often liter of fermented liquid, mixing speed is cultivation and fermentation 3 ~ 5 days under the condition of 300rpm, and shikimic acid output is 11.3g/L.Substratum composition and content as follows, often liter of substratum contains: K
2hPO
43H
2o 0.5g, KH
2pO
40.5g, urea 3g, sucrose 38g, MgSO
47H
2o 0.2g, yeast powder 10g, peptone 4g, FeSO
47H
2o 0.02g, MnSO
44H
2o 0.02g, vitamin H 50 μ g, thiamine 200 μ g, pH 7.4.
The detection method of shikimic acid: get appropriate fermented liquid, centrifugal 10 minutes of 12000rpm, gets supernatant liquor deionized water and dilutes suitable multiple, detects shikimic acid output by high performance liquid chromatography (HPLC).Chromatographic column is Zorbax Eclipse XDB-C18 (Agilent Technologies, USA); Moving phase is the phosphate aqueous solution (95:5, v/v) of methyl alcohol and pH 2.5; Isocratic elution; Flow velocity 0.35mL/min; Column temperature 30 DEG C; Sample size 5 μ L; Detector: DAD (Agilent Technologies, USA), 215nm.
Shikimic acid Production rate method: the standard substance buying shikimic acid from sigma company, the shikimic acid standardized solution of preparation different concns, 0g/L, 0.01g/L, 0.05g/L, 0.1g/L, 0.2g/L, 0.4g/L, 0.8g/L, 1g/L, respectively above-mentioned reference liquid HPLC is detected peak area, calculating typical curve according to the densitometer of peak area and shikimic acid standardized solution is Y=80759X+63.56, wherein Y is the peak area of respective concentration shikimic acid, and X is the concentration of shikimic acid).The shikimic acid sample of unknown concentration is detected by HPLC and can obtain a peak area, bring above-mentioned typical curve formula into and draw concentration.As shown in Figure 3, the peak at 12.078 places is shikimic acid to result.
Claims (8)
1. one kind is produced the Corynebacterium glutamicum of shikimic acid, it is characterized in that, comprise aroG, aroB, aroD and aroE gene, the RBS1 also comprising to regulate and control described aroG genetic expression, the RBS2 regulating and controlling described aroB genetic expression, regulate and control the RBS3 of described aroD genetic expression and regulate and control the RBS4 of described aroE genetic expression; The gene order of described aroG is for shown in SEQ ID NO:6, and the gene order of described aroB is for shown in SEQ ID NO:7, and the gene order of described aroD is for shown in SEQ ID NO:8, and the gene order of described aroE is for shown in SEQ ID NO:9;
The gene order of described RBS1 is for shown in SEQ ID NO:1, and the gene order of described RBS2 is for shown in SEQ ID NO:2, and the gene order of described RBS3 is for shown in SEQ ID NO:3, and the gene order of described RBS4 is for shown in SEQ ID NO:4.
2. the Corynebacterium glutamicum producing shikimic acid as claimed in claim 1, it is characterized in that, be also inserted with terminator 2 between described aroB gene and aroD gene, the gene order of described terminator 2 is for shown in SEQ ID NO:11.
3. the Corynebacterium glutamicum producing shikimic acid as claimed in claim 1 or 2, it is characterized in that, also comprise RiboJ gene, the gene order of described RiboJ is for shown in SEQ ID NO:5.
4. the Corynebacterium glutamicum producing shikimic acid as claimed in claim 3, it is characterized in that, RiboJ gene is inserted with between described aroG gene and the promotor of aroG gene, be inserted with RiboJ gene between described aroB gene and the promotor of aroB gene, between described aroD gene and the promotor of aroD gene, be inserted with RiboJ gene, between described aroE gene and the promotor of aroE gene, be inserted with RiboJ gene.
5. produce a construction process for the Corynebacterium glutamicum of shikimic acid, it is characterized in that, comprise the steps:
1) by aroG, aroB, aroD and aroE gene insertion vector pXMJ19 respectively, carrier pXMJ19-aroG, pXMJ19-aroB, pXMJ19-aroD, pXMJ19-aroE is obtained;
2) by HindIII and the PstI restriction enzyme site in aroG gene, BamHI and the SpeI restriction enzyme site in aroB gene, the PstI restriction enzyme site in aroD gene, EcoRI and the SalI restriction enzyme site in aroE gene suddenlys change, and obtains carrier pXMJ19-aroG
mU, pXMJ19-aroB
mU, pXMJ19-aroD
mU, pXMJ19-aroE
mU;
3) by RiboJ gene insertion vector pXMJ19, carrier pXMJ19-RiboJ is obtained;
4) fluorescence protein gene is inserted described carrier pXMJ19-RiboJ, obtain carrier pZB;
5) use primer MU-RBSAG-F and MU-RBSAG-R with described pXMJ19-aroG
mUfor template amplification gene fragment aroG
mU, with primer MU-RBSAB-F and MU-RBSAB-R with described pXMJ19-aroB
mUfor template amplification gene fragment aroB
mU, with primer MU-RBSAD-F and MU-RBSAD-R with described pXMJ19-aroD
mUfor template amplification gene fragment aroD
mU, with primer MU-RBSAE-F and MU-RBSAE-R with described pXMJ19-aroE
mUfor template amplification gene fragment aroE
mU;
6) by step 5) the middle gene fragment aroG increased
mU, aroB
mU, aroD
mUand aroE
mUinsertion vector pZB, obtains carrier pZB-aroG, pZB-aroB, pZB-aroD and pZB-aroE respectively;
7) step 6) carrier that obtains transformation of E. coli respectively, the clone obtained is checked order, by described carrier pZB-aroG, pZB-aroB, pZB-aroD and pZB-aroE cotransformation errorless for order-checking in Corynebacterium glutamicum Δ aroK, cultivate and fluorescence intensity;
8) use primer aroG-H-F, aroG-H-R with described pXMJ19-aroG
mUinsert described carrier pXMJ19-RiboJ for template amplification gene fragment aroG-H, obtain carrier pXMJ19-RiboJ-aroG
mU-H; The gene order of described aroG-H is as shown in SEQ ID NO:13;
9) use primer aroB-M-F, aroB-M-R with described pXMJ19-aroB
mUfor template amplification gene fragment aroB-M; With aroD-M-F, aroD-M-R with described pXMJ19-aroD
mUfor template amplification gene fragment aroD-M; With aroE-M-F, aroE-M-R with described pXMJ19-aroE
mUfor template amplification gene fragment aroE-M; The gene fragment aroB-M of amplification, aroD-M and aroE-M are inserted described carrier pXMJ19-RiboJ respectively, obtains carrier pX MJ19-RiboJ-aroB
mU-M, pXMJ19-RiboJ-aroD
mU-M and pXMJ19-RiboJ-aroE
mU-M; The gene order of described ar oB-M, aroD-M and aroE-M is successively respectively as shown in SEQ ID NO:14, SEQ ID NO:15 and S EQ ID NO:16;
10) use primer PB-F, PB-R with described pXMJ19-RiboJ-aroB
mU-M is template amplification gene fragment Ptac-aroB-M; With primer PD-F, PD-R with described pXMJ19-RiboJ-aroD
mU-M is template amplification gene fragment Ptac-aroD-M; With primer PE-F, PE-R with described pXMJ19-RiboJ-aroE
mU-M is template amplification gene fragment Ptac-aroE-M, gene fragment Ptac-aroB-M is inserted described carrier pXMJ19-RiboJ-aroG
mU-H, obtains carrier pXMJ19-GHBM; The gene order of described Ptac-aroB-M is as shown in SEQ ID NO:17;
11) fragment Ptac-aroD-M is inserted described carrier pXMJ19-GHBM, obtain carrier pXMJ19-GHBMDM; The gene order of described Ptac-aroD-M is as shown in SEQ ID NO:18.
12) fragment Ptac-aroE-M is inserted described carrier pXMJ19-GHBMDM, obtain carrier pXMJ19-GBDE; The gene order of described Ptac-aroE-M is as shown in SEQ ID NO:19;
13) primer Terminator2-F, Terminator2-R is used to take pXMJ19 as template amplification terminator 2, terminator 2 and described carrier pXMJ19-GBDE are carried out enzyme with XmaI respectively cut, reclaim terminator 2 fragment and carrier pXMJ19-GBDE, terminator 2 fragment is connected with carrier pXMJ19-GBDE, obtains carrier pXMJ19-GBTDE;
14) described pXMJ19-GBTDE is converted into C.glutamicum RES167 Δ aroK, obtains the Corynebacterium glutamicum producing shikimic acid.
6. produce as described in claim 5 the construction process of the Corynebacterium glutamicum of shikimic acid, it is characterized in that, step 4) described in fluorescence protein gene be egfp gene.
7. produce a method for shikimic acid, it is characterized in that, comprise the steps:
Be chilled in the fermention medium of leavening temperature by the Corynebacterium glutamicum seed liquor of arbitrary product shikimic acid in the inoculum size inoculation Claims 1-4 of 2% ~ 4% volume ratio after sterilizing, the OD600 value of described seed liquor is 14, temperature is 30 DEG C, Ventilation Rate is 3vvm, sucrose is added in fermenting process, mixing speed is cultivation and fermentation 3 ~ 5 days under the condition of 300rpm, and obtaining containing shikimic acid concentration is the fermented liquid of 10 ~ 12g/L.
8. method of producing shikimic acid as claimed in claim 7, is characterized in that, add in sucrose step in described fermenting process, and add sucrose in fermentation 20 hours and fermentation when 34 hours respectively, 35g sucrose added by often liter of fermented liquid.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510175678.8A CN104911137B (en) | 2015-04-14 | A kind of Corynebacterium glutamicum for producing shikimic acid and its construction method and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510175678.8A CN104911137B (en) | 2015-04-14 | A kind of Corynebacterium glutamicum for producing shikimic acid and its construction method and application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104911137A true CN104911137A (en) | 2015-09-16 |
| CN104911137B CN104911137B (en) | 2018-06-01 |
Family
ID=
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111057672A (en) * | 2019-12-20 | 2020-04-24 | 东莞市东阳光生物合成药有限公司 | Recombinant strain and application thereof |
| CN112538491A (en) * | 2020-12-28 | 2021-03-23 | 宁夏伊品生物科技股份有限公司 | YH 66-08550 gene-based recombinant strain for producing L-isoleucine and construction method and application thereof |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2008128076A1 (en) * | 2007-04-13 | 2008-10-23 | Monsanto Technology Llc | Use of glyphosate to produce shikimic acid in microorganisms |
| CN102304539A (en) * | 2011-08-26 | 2012-01-04 | 河南孟成生物药业股份有限公司 | Construction method of genetic engineering strain for producing shikimic acid |
| CN104220587A (en) * | 2012-01-30 | 2014-12-17 | 麦兰特公司 | Production of muconic acid from genetically engineered microorganisms |
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2008128076A1 (en) * | 2007-04-13 | 2008-10-23 | Monsanto Technology Llc | Use of glyphosate to produce shikimic acid in microorganisms |
| CN102304539A (en) * | 2011-08-26 | 2012-01-04 | 河南孟成生物药业股份有限公司 | Construction method of genetic engineering strain for producing shikimic acid |
| CN104220587A (en) * | 2012-01-30 | 2014-12-17 | 麦兰特公司 | Production of muconic acid from genetically engineered microorganisms |
Non-Patent Citations (2)
| Title |
|---|
| CHUNBO LOU 等: "Ribozyme-based insulator parts buffer synthetic circuits from genetic context", 《NAT BIOTECHNOL》 * |
| KATHARINA PFEIFER-SANCAR 等: "Comprehensive analysis of the Corynebacterium glutamicum transcriptome using an improved RNAseq technique", 《BMC GENOMICS》 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111057672A (en) * | 2019-12-20 | 2020-04-24 | 东莞市东阳光生物合成药有限公司 | Recombinant strain and application thereof |
| CN111057672B (en) * | 2019-12-20 | 2022-02-15 | 宜昌东阳光生化制药有限公司 | Recombinant strain and application thereof |
| CN112538491A (en) * | 2020-12-28 | 2021-03-23 | 宁夏伊品生物科技股份有限公司 | YH 66-08550 gene-based recombinant strain for producing L-isoleucine and construction method and application thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103981203B (en) | 5 amino-laevulic acid superior strains and its preparation method and application | |
| CN103243066B (en) | Bacterial strain for producing lycopene and application of bacterial strain | |
| Du et al. | Energy-efficient butanol production by Clostridium acetobutylicum with histidine kinase knockouts to improve strain tolerance and process robustness | |
| CN102816729B (en) | Construction and application of polygene knockout strain of Halomonas sp. TD01 | |
| CN102453691A (en) | Escherichia coli engineering bacteria capable of realizing high yield of L-tryptophan | |
| CN102199570B (en) | Method for constructing gene engineering bacterium for improving microbial fermentation for1,3-propanediol production from glycerol | |
| CN103555779A (en) | Method for producing gamma-aminobutyric acid through fermentation | |
| CN104651291A (en) | Recombinant strain for producing phenol and application of strain | |
| CN104651287A (en) | Engineering bacterium for synthesizing glycosylglycerol and application thereof | |
| CN104694601A (en) | High-efficiency preparation method of Iturin A and homologue of Iturin A | |
| CN107287143A (en) | The Recombinant organism and its construction method of high yield butanol and application | |
| CN107043730A (en) | Engineering strain, Preparation method and use for producing the formamide of azophenlyene 1 | |
| CN104762239A (en) | Klebsiella pneumoniae, application thereof and method for producing 1, 3-propylene glycol | |
| CN104560852A (en) | Corynebacterium-glutamicum recombinant strain for increasing conversion rate of L-phenylalanine saccharic acid | |
| CN105647844A (en) | Recombinant bacteria using xylose to produce glycollic acid and building method and application of recombinant bacteria | |
| CN104195190A (en) | Method for producing 5-aminolevulinic acid by carrying out anaerobic fermentation by utilizing recombinant escherichia coli | |
| CN105483069A (en) | Recombination strain for producing trans-4-hydroxy-L-proline and building and application of recombination strain | |
| CN101205541B (en) | Recombinant expression carrier and method for high-yield of 1,3-propanediol by fermenting glycerin using host cell converted thereby | |
| CN111057672B (en) | Recombinant strain and application thereof | |
| CN104911137A (en) | Shikimic acid-producing corynebacterium glutamicum, and construction method and application thereof | |
| CN101348775B (en) | Enterobacteria recombinant strain and use thereof | |
| CN106085931A (en) | Produce engineering bacteria and the application thereof of trans 4 hydroxyprolines | |
| CN102181368A (en) | Technique for biotransforming CO2 into isopropyl alcohol by utilizing blue algae | |
| CN102382807B (en) | Novel glucoamylase VGA (video graphics array), gene thereof and application thereof | |
| CN103820506A (en) | Method for producing coenzyme Q10 by fermenting genetic recombinant bacteria |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |