CN102181368A - Technique for biotransforming CO2 into isopropyl alcohol by utilizing blue algae - Google Patents
Technique for biotransforming CO2 into isopropyl alcohol by utilizing blue algae Download PDFInfo
- Publication number
- CN102181368A CN102181368A CN 201110038190 CN201110038190A CN102181368A CN 102181368 A CN102181368 A CN 102181368A CN 201110038190 CN201110038190 CN 201110038190 CN 201110038190 A CN201110038190 A CN 201110038190A CN 102181368 A CN102181368 A CN 102181368A
- Authority
- CN
- China
- Prior art keywords
- dna
- gene
- sequence
- blue
- algae
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
Abstract
The invention discloses a technique for biotransforming CO2 into isopropyl alcohol by utilizing blue algae, and provides the following six methods for preparing recombined blue algae: (1) leading a CoA transferase gene, an acetoacetate decarboxylase gene and an alcohol dehydrogenase gene into the blue algae; (2) leading the CoA transferase gene and the acetoacetate decarboxylase gene into the blue algae; (3) leading a coded gene of the alcohol dehydrogenase into the recombined blue algae in (2); (4) leading an acetyl-CoA acetyltransferase gene, an acetoacetyl-CoA transferase gene, the acetoacetate decarboxylase gene and the alcohol dehydrogenase gene into the blue algae; (5) leading the acetyl CoA acetyltransferase gene, the acetoacetyl-CoA transferase gene and the acetoacetate decarboxylase gene into the blue algae; and (6) leading the alcohol dehydrogenase gene into the recombined algae generating acetone in (5). The technique provided by the invention is one of ideal paths for realizing the continuous and healthy development of renewable and clean energy by utilizing the recombined algae to produce acetone and the isopropyl alcohol.
Description
Technical field
The invention belongs to biological new energy field and field of environment protection, relate to and a kind ofly utilize blue-green algae CO
2Bio-transformation is the technology of Virahol, is specifically related to produce the recombined blue algae of Virahol.
Background technology
The energy problem that the whole world faces, environmental problem have proposed the requirement of development renewable and clean energy resource to people, and food shortage requires the development of renewable and clean energy resource will realize not striving grain, not striving ground, do not strive fresh water with people and crop with crop with the people.
Blue-green algae (blue-green algae) claims cyanobacteria (cyanobacteria) again, is to put the photosynthetic prokaryotic organism of oxygen.Blue-green algae extensively is distributed in fresh water, seawater or even the sewage, can utilize carbonic acid gas and sun power to breed fast, is the desirable host of biosynthesizing energy product.As prokaryotic organism, the blue-green algae cellularstructure is simple, genetic background is similar to intestinal bacteria, is easy to genetic manipulation.Recent two decades comes the molecular biological progress of blue-green algae for blue-green algae is carried out genetic modification and then synthetic Chemicals are laid a good foundation, and has the successful case (patent US6699696) of synthesizing alcohol in blue-green algae.Sun power is the inexhaustible energy on the earth, and carbonic acid gas is the greenhouse gases that cause global warming, and the whole world hundreds of millions of funds of annual input are used for carbon dioxide discharge-reduction.Therefore, by blue-green algae is carried out the pathways metabolism transformation, making blue-green algae that sun power and carbonic acid gas are converted into derived energy chemical product, is to realize one of desirable approach that renewable and clean energy resource continues, develops in a healthy way.
Virahol (isopropanol) is important chemical product and raw material.Be mainly used on pharmacy, makeup, plastics, spices, coating and the electronic industry as dewatering agent and clean-out system.Virahol is widespread use in the production in industry and consuming product as low cost solvent or extraction agent.Inferior Virahol also can be used in the automobile fuel.Virahol can replace ethanol to use in many cases.China in 2010 will reach 300,000 tons to the year total demand of Virahol, and mainly as solvent or extraction agent in printing ink, coating and the pharmaceutical industry process, its consumption accounts for 60% of Virahol aggregate consumption to China's Virahol.In the chemical intermediate field, China's Virahol is mainly used in produces Isopropylamine, isopropyl ether and some ester classes, and its consumption accounts for 25% of Virahol aggregate consumption.Virahol application in other respects mainly comprises cleaning agent for electronic industry, automobile antifreeze solution, sterilizing agent, articles for washing, daily chemical products etc., and its consumption accounts for 15% of Virahol aggregate consumption.
Virahol is first Chemicals that make from petroleum on the petrochemical complex development history.The Virahol of present industrial usefulness is still from petrochemicals.From the seventies, because oil crisis makes various alcohols fermentative production become the research focus, as bio-ethanol, biological butanol and biological Virahol.By the research in thirties years, resolved the route of synthesis and the relevant enzyme of above-mentioned alcohols, lay a good foundation for transforming the biological Virahol of microorganisms producing.In recent years, the scientist of the U.S. and Japan successively sets up the Virahol route of synthesis intestinal bacteria, and obtains utilizing glucose to produce the bacterial strain of Virahol.Though this method has been avoided aggravation fossil energy problem of shortage, but intestinal bacteria are heterotrophic bacterium, still need utilize the glucose production Virahol, solve conflicting of development bioenergy and food problem, can't realize the sustainable development of renewable energy source, the photoautotrophy bacterium blue-green algae that therefore can directly utilize sun power is to realize the biosynthetic desirable host of Virahol.
Summary of the invention
The purpose of this invention is to provide and a kind ofly utilize blue-green algae CO
2Bio-transformation is the technology of Virahol.
Recombined blue algae provided by the invention is in following (1) to (6) any one:
(1) encoding gene of the encoding gene of the encoding gene of acetoacetyl-CoA transferring enzyme, E.C. 4.1.1.4 and alcoholdehydrogenase is imported the recombined blue algae I of the product Virahol that the genomic dna of blue-green algae obtains; (2) encoding gene of the encoding gene of acetoacetyl-CoA transferring enzyme and E.C. 4.1.1.4 is imported the recombined blue algae II of the product acetone that the genomic dna of blue-green algae obtains; (3) encoding gene of alcoholdehydrogenase is imported the recombined blue algae III of the product Virahol that the genomic dna of the recombined blue algae II of described product acetone obtains; (4) encoding gene of the encoding gene of the encoding gene of the encoding gene of acetyl-CoA Transacetylase, acetoacetyl-CoA transferring enzyme, E.C. 4.1.1.4 and alcoholdehydrogenase is imported the recombined blue algae IV of the product Virahol that the genomic dna of blue-green algae obtains; (5) encoding gene of the encoding gene of the encoding gene of acetyl-CoA Transacetylase, acetoacetyl-CoA transferring enzyme and E.C. 4.1.1.4 is imported the recombined blue algae V of the product acetone that the genomic dna of blue-green algae obtains; (6) encoding gene of alcoholdehydrogenase is imported the recombined blue algae VI of the product Virahol that the genomic dna of the recombined blue algae V of described product acetone obtains.
In described (1) or (2) or (4) or (5), described acetoacetyl-CoA transferring enzyme can be following (a) or (b):
(a) protein of forming by the aminoacid sequence shown in the sequence in the sequence table 6;
(b) with the aminoacid sequence of sequence in the sequence table 6 through the replacement of one or several amino-acid residue and/or disappearance and/or interpolation and have acetoacetyl-CoA transferring enzyme function by (a) deutero-protein.
In described (1) or (2) or (4) or (5), described E.C. 4.1.1.4 can be following (c) or (d):
(c) protein of forming by the aminoacid sequence shown in the sequence in the sequence table 7;
(d) with the aminoacid sequence of sequence in the sequence table 7 through the replacement of one or several amino-acid residue and/or disappearance and/or interpolation and have the E.C. 4.1.1.4 function by (c) deutero-protein.
In described (1) or (3) or (4) or (6), described alcoholdehydrogenase can be following (e) or (f):
(e) protein of forming by the aminoacid sequence shown in the sequence in the sequence table 8;
(f) with the aminoacid sequence of sequence in the sequence table 8 through the replacement of one or several amino-acid residue and/or disappearance and/or interpolation and have the alcoholdehydrogenase function by (e) deutero-protein.
In described (4) or (5), described acetyl-CoA Transacetylase can be following (g) or (h):
(g) protein of forming by the aminoacid sequence shown in the sequence in the sequence table 12;
(h) with the aminoacid sequence of sequence in the sequence table 12 through the replacement of one or several amino-acid residue and/or disappearance and/or interpolation and have acetyl-CoA Transacetylase function by (g) deutero-protein.
The encoding gene of described acetoacetyl-CoA transferring enzyme can be following (I), (II) or (III):
(I) in the sequence table sequence 1 from the dna molecular shown in 5 ' terminal the 427th to 1746 Nucleotide;
(II) under stringent condition with the DNA hybridization that (I) limits and the dna molecular of encoding said proteins;
(III) dna molecular of 90% above homology and encoding said proteins is arranged with the dna sequence dna that (I) limits.
The encoding gene of described E.C. 4.1.1.4 can be following (IV), (V) or (VI):
(IV) in the sequence table sequence 1 from the dna molecular shown in 5 ' terminal the 1747th to 2481 Nucleotide;
(V) under stringent condition with the DNA hybridization that (IV) limits and the dna molecular of encoding said proteins;
(VI) dna molecular of 90% above homology and encoding said proteins is arranged with the dna sequence dna that (IV) limits.
The encoding gene of described alcoholdehydrogenase can be following (VII), (VIII) or (IX):
(VII) in the sequence table sequence 1 from the dna molecular shown in 5 ' terminal the 2482nd to 3537 Nucleotide;
(VIII) under stringent condition with the DNA hybridization that (VII) limits and the dna molecular of encoding said proteins;
(IX) dna molecular of 90% above homology and encoding said proteins is arranged with the dna sequence dna that (VII) limits.
The encoding gene of described acetyl-CoA Transacetylase can be following (X), (XI) or (XII):
(X) in the sequence table sequence 9 from the dna molecular shown in 5 ' terminal the 401st to 1579 Nucleotide;
(XI) under stringent condition with the DNA hybridization that (X) limits and the dna molecular of encoding said proteins;
(XII) dna molecular of 90% above homology and encoding said proteins is arranged with the dna sequence dna that (X) limits.
The recombined blue algae I of described product Virahol obtains the double-stranded DNA first by the genomic dna that homologous recombination imports blue-green algae; Described double-stranded DNA first comprises the encoding gene of the encoding gene of described acetoacetyl-CoA transferring enzyme, described E.C. 4.1.1.4 and the encoding gene of described alcoholdehydrogenase.The two ends of described double-stranded DNA first have the homology arm of the genomic dna of described blue-green algae respectively.The homology arm of the encoding gene (slr1829) of the two ends of described double-stranded DNA first preferably have poly--beta-hydroxybutyrate synthetic enzyme.Also has screening-gene on the described double-stranded DNA first.Described screening-gene is preferably chloramphenicol resistance gene.Obtain in the process of recombined blue algae I of described product Virahol, described homologous recombination realizes by the recombinant plasmid first being imported described blue-green algae; Carry described double-stranded DNA first on the described recombinant plasmid first.Described recombinant plasmid first is: with carrier pUC-18 is skeleton carrier, at the multiple clone site of the skeleton carrier recombinant plasmid that obtains from DNA shown in 5 ' terminal the 7th to 3537 Nucleotide from the sequence 1 of DNA shown in 5 ' terminal the 9th to 1653 Nucleotide and sequence table of the sequence 2 of insertion sequence table respectively.Described recombinant plasmid first is preferably: with carrier pUC-18 is skeleton carrier, in the sequence 2 of the Xba of skeleton carrier I site insertion sequence table from DNA shown in 5 ' terminal the 9th to 1653 Nucleotide, in the sequence 1 of the Bam of skeleton carrier H I site insertion sequence table from DNA shown in 5 ' terminal the 7th to 3537 Nucleotide, the recombinant plasmid that obtains.
The recombined blue algae II of described product acetone obtains double-stranded DNA second by the genomic dna that homologous recombination imports blue-green algae; Described double-stranded DNA second comprises the encoding gene of described acetoacetyl-CoA transferring enzyme and the encoding gene of described E.C. 4.1.1.4.The two ends of described double-stranded DNA second have the homology arm of the genomic dna of described blue-green algae respectively.The homology arm of the encoding gene of the two ends of described double-stranded DNA second preferably have poly--beta-hydroxybutyrate synthetic enzyme (slr1829).Also has screening-gene on the described double-stranded DNA second.Described screening-gene is preferably chloramphenicol resistance gene.Obtain in the process of recombined blue algae II of described product acetone, described homologous recombination realizes by recombinant plasmid second being imported described blue-green algae; Carry described double-stranded DNA second on the described recombinant plasmid second.Described recombinant plasmid second is: with carrier pUC-18 is skeleton carrier, at the multiple clone site of the skeleton carrier recombinant plasmid that obtains from DNA shown in 5 ' terminal the 7th to 2481 Nucleotide from the sequence 3 of DNA shown in 5 ' terminal the 9th to 1653 Nucleotide and sequence table of the sequence 2 of insertion sequence table respectively.Described recombinant plasmid second is preferably: with carrier pUC-18 is skeleton carrier, in the sequence 2 of the Xba of skeleton carrier I site insertion sequence table from DNA shown in 5 ' terminal the 9th to 1653 Nucleotide, in the sequence 3 of the Bam of skeleton carrier H I site insertion sequence table from DNA shown in 5 ' terminal the 7th to 2481 Nucleotide, the recombinant plasmid that obtains.
The recombined blue algae III of described product Virahol obtains double-stranded DNA third by the genomic dna that homologous recombination imports the recombined blue algae II of described product acetone; Described double-stranded DNA third comprises the encoding gene of described alcoholdehydrogenase.The two ends of described double-stranded DNA third preferably have the homology arm of the encoding gene (slr2079) of L-Glutamine deaminase.The two ends of described double-stranded DNA third have the homology arm of the genomic dna of described blue-green algae respectively.Also has screening-gene on the described double-stranded DNA third.Described screening-gene is preferably kalamycin resistance gene.Obtain in the process of recombined blue algae III of described product Virahol, described homologous recombination is to realize by the recombined blue algae II that recombinant plasmid third is imported described product acetone; Carry described double-stranded DNA third on the described recombinant plasmid third.Described recombinant plasmid third is: with carrier pUC-18 is skeleton carrier, at the multiple clone site of the skeleton carrier recombinant plasmid that obtains from DNA shown in 5 ' terminal the 7th to 1472 Nucleotide from the sequence 5 of DNA shown in 5 ' terminal the 7th to 1320 Nucleotide and sequence table of the sequence 4 of insertion sequence table respectively.Described recombinant plasmid third is preferably: with carrier pUC-18 is skeleton carrier, in the sequence 4 of the Xba of skeleton carrier I site insertion sequence table from DNA shown in 5 ' terminal the 7th to 1320 Nucleotide, at the Bam of skeleton carrier H I site insertion sequence 5 from 5 ' terminal the 7th to 1472 Nucleotide, the recombinant plasmid that obtains.
The recombined blue algae IV of described product Virahol obtains the double-stranded DNA fourth by the genomic dna that homologous recombination imports blue-green algae; Described double-stranded DNA fourth comprises the encoding gene of the encoding gene of described acetyl-CoA Transacetylase, the encoding gene of described acetoacetyl-CoA transferring enzyme, described E.C. 4.1.1.4 and the encoding gene of described alcoholdehydrogenase.The two ends of described double-stranded DNA fourth have the homology arm of the genomic dna of described blue-green algae respectively.The two ends of described double-stranded DNA fourth preferably have the homology arm of Genbank Accession NO.SYNPCC7002_A1630 gene.Also has screening-gene on the described double-stranded DNA fourth.Described screening-gene is preferably chloramphenicol resistance gene.Obtain in the process of recombined blue algae IV of described product Virahol, described homologous recombination realizes by the recombinant plasmid fourth being imported described blue-green algae; Carry described double-stranded DNA fourth on the described recombinant plasmid fourth.Described recombinant plasmid fourth is the recombinant plasmid that the sequence 9 of insertion sequence table in pMD-18T obtains from DNA shown in 5 ' terminal the 1st to 6141 Nucleotide.
The recombined blue algae V of described product acetone obtains double-stranded DNA penta by the genomic dna that homologous recombination imports blue-green algae; Described double-stranded DNA penta comprises the encoding gene of the encoding gene of described acetyl-CoA Transacetylase, described acetoacetyl-CoA transferring enzyme and the encoding gene of described E.C. 4.1.1.4.The two ends of described double-stranded DNA penta have the homology arm of the genomic dna of described blue-green algae respectively.The two ends of described double-stranded DNA penta preferably have the homology arm of Genbank Accession NO.SYNPCC7002_A1630 gene.Also has screening-gene on the described double-stranded DNA penta.Described screening-gene is preferably chloramphenicol resistance gene.Obtain in the process of recombined blue algae V of described product acetone, described homologous recombination realizes by recombinant plasmid penta is imported described blue-green algae; Carry described double-stranded DNA penta on the described recombinant plasmid penta.The recombinant plasmid that the sequence 10 that described recombinant plasmid penta is an insertion sequence table in pMD-18T obtains from DNA shown in 5 ' terminal the 1st to 5085 Nucleotide.
The recombined blue algae VI of described product Virahol obtains double-stranded DNA by the genomic dna that homologous recombination imports the recombined blue algae V of described product acetone; Described double-stranded DNA has comprised the encoding gene of described alcoholdehydrogenase.Described double-stranded DNA two ends have the homology arm of the genomic dna of described blue-green algae respectively.Described double-stranded DNA two ends preferably have the homology arm of GenbankAccession NO.SYNPCC7002_A0909 gene.Described double-stranded DNA has been gone up also has screening-gene.Described screening-gene is preferably kalamycin resistance gene.Obtain in the process of recombined blue algae VI of described product Virahol, described homologous recombination is to realize by the recombined blue algae V that recombinant plasmid has been imported described product acetone; Described recombinant plasmid has carried described double-stranded DNA on.Described recombinant plasmid has been the recombinant plasmid that the sequence 11 of insertion sequence table in pMD-18T obtains from DNA shown in 5 ' terminal the 1st to 2899 Nucleotide.
Described blue-green algae specifically can be fresh water blue-green algae cytoalgae 6803 or seawater blue-green algae synechococcus 7002.
Described recombined blue algae can be used for producing Virahol and/or acetone.
The invention provides new approaches and method with blue-green algae biosynthesizing Virahol.The Virahol route of synthesis of setting up in blue-green algae as shown in Figure 1.The acetyl-CoA Transacetylase can be the blue-green algae endogenous enzyme, also can be the isozyme that derives from clostridium, intestinal bacteria or other microorganism, the acetyl-CoA Transacetylase of preferably endogenous from blue-green algae and the acetone clostridium butylicum of the present invention.The acetoacetyl-CoA transferring enzyme can be from clostridium, intestinal bacteria or other microorganism or have the isozyme of catalysis coenzyme A forwarding function, and the present invention is preferably from the acetoacetyl-CoA transferring enzyme of acetone clostridium butylicum.E.C. 4.1.1.4 can be the isozyme from clostridium or other microorganism, and the present invention is preferably from the E.C. 4.1.1.4 of acetone clostridium butylicum.Alcoholdehydrogenase can be from the isozyme of clostridium, intestinal bacteria or other microorganism, and the present invention is preferably from Bai Shi clostridial alcoholdehydrogenase.Blue-green algae can the fresh water blue-green algae or the seawater blue-green algae in any blue-green algae or other photoautotrophy bacterium, preferred fresh water blue-green algae cytoalgae 6803 and seawater blue-green algae synechococcus 7002 among the present invention.Outstanding advantage of the present invention is to utilize the phototroph blue-green algae that inexhaustible sun power on the earth and greenhouse gases carbonic acid gas are converted into the Chemicals Virahol, promptly by the utilization of blue-green algae to sun power and industrial gaseous waste carbonic acid gas, realize the production of Chemicals Virahol, avoided in the energy regeneration process organic uses such as grains, can utilize seawater and carbonic acid gas to help environment again simultaneously.Therefore, utilizing recombined blue algae of the present invention to produce acetone and Virahol is to realize one of desirable approach that renewable and clean energy resource continues, develops in a healthy way.
Description of drawings
Fig. 1 sets up the pathways metabolism schema of petrohol in blue-green algae.
Fig. 2 identifies figure for recombined blue algae S.M3.
Fig. 3 detects product Virahol in the recombined blue algae S.M3 fermented liquid for HPLC.
Fig. 4 identifies figure for recombined blue algae S.M4.
Fig. 5 detects product acetone in the recombined blue algae S.M4 fermented liquid for HPLC.
Fig. 6 identifies figure for recombined blue algae S.M5.
Fig. 7 detects product Virahol in the recombined blue algae S.M5 fermented liquid for HPLC.
Fig. 8 identifies figure for recombined blue algae S.M6.
Fig. 9 detects product Virahol in the recombined blue algae S.M6 fermented liquid for HPLC.
Figure 10 identifies figure for recombined blue algae S.M7.
Figure 11 detects product acetone in the recombined blue algae S.M7 fermented liquid for HPLC.
Figure 12 identifies figure for recombined blue algae S.M8.
Figure 13 detects product Virahol in the recombined blue algae S.M8 fermented liquid for HPLC.
Embodiment
Following embodiment is convenient to understand better the present invention, but does not limit the present invention.Experimental technique among the following embodiment if no special instructions, is ordinary method.Used test materials among the following embodiment if no special instructions, is to buy from routine biochemistry reagent shop and obtains.Quantitative test in following examples all is provided with repeated experiments three times, results averaged.NRRL is an american agriculture research DSMZ.ATCC is a U.S. representative microbial DSMZ.Intestinal bacteria (E.coli) DH5 α is available from the Beijing Quanshijin Biotechnology Co., Ltd.Carrier pUC-18: available from the Beijing Quanshijin Biotechnology Co., Ltd.PMD-18T: available from the Beijing Quanshijin Biotechnology Co., Ltd.Available from NRRL, NRRL is numbered B593 to Bai Shi clostridium (Clostridium beijerinckii).Available from ATCC, ATCC is numbered 824 to clostridium acetobutylicum (Clostridium acetobutylicum).
Fresh water blue-green algae cytoalgae 6803 (Synechocystis sp.PCC 6803) belongs to Chroococcaceae, synechocystis; Reference: Zhang S, Spann KW, et al.Identification of two genes, sll0804and slr1306, as putative components of the CO2-concentrating mechanism in the cyanobacterium Synechocystis sp.strain PCC 6803.
J Bacteriol.2008190:8234-7.
Seawater blue-green algae synechococcus 7002 (Synechococcus sp.PCC 7002) belongs to Chroococcaceae, synechococcus belongs to; Reference: Cantrell A and Bryant DA. Molecular cloning and nucleotide sequence of the psaA and psaB genes of the cyanobacterium Synechoc
Plasmid pRL271: reference: Wei TF, Ramasubramanian TS, et al.Anabaena sp.strain PCC7120 ntcA Gene required for growth on nitrate and heterocyst development.JBacteriol.1994,176:4473-4482..
Blue-green algae expression vector pAM2770: reference: Wu X, Li DW, et al.The Anabaena sp.strain PCC 7120asr1734 gene encodes a negative regulator of heterocyst Development.Molecul Microbiol.2007,64:782-794..
BG-11 substratum composition sees Table 1.Trace metal mix A5 composition sees Table 2.
Table 1BG-11 substratum is formed
| Component | Content (/L) |
| ?NaNO 3 | 1.5g |
| ?K 2HPO 4 | 0.04g |
| ?MgSO 4·7H 2O | 0.075g |
| ?CaCl 2·2H 2O | 0.036g |
| Citric acid (Citric acid) | 0.006g |
| Ferric ammonium citrate (Ferric ammonium citrate) | 0.006g |
| ?EDTA(disodium?salt) | 0.001g |
| ?Na 2CO 3 | 0.02g |
| Trace metal mix A5 (composition sees Table 2) | 1.0ml |
| Agar Agar | 10.0g |
| Distilled water | 1.0L |
| ?pH | 8.0 |
Table 2Trace metal mix A5 forms
| Component | Content (/L) |
| H 3BO 3 | 2.86g |
| MnCl 2·4H 2O | 1.81g |
| ZnSO 4·7H 2O | 0.222g |
| NaMoO 4·2H 2O | 0.39g |
| CuSO 4·5H 2O | 0.079g |
| Co(N0 3) 2·6H 2O | 49.4mg |
| Distilled water | 1.0L |
Embodiment 1, application fresh water blue-green algae produce Virahol
In fresh water blue-green algae cytoalgae 6803, set up the Virahol route of synthesis.Owing in the cytoalgae acetyl-CoA Transacetylase is arranged, therefore in cytoalgae, express acetoacetyl-CoA transferring enzyme encoding gene (ctfAB), E.C. 4.1.1.4 encoding gene (adc) and alcoholdehydrogenase encoding gene (adh), can set up the Virahol route of synthesis.
One, the structure of recombinant plasmid pHR-ctfAB::adc::adh (cytoalgae homologous recombination integrating expression vector)
1, the acquisition of acetoacetyl-CoA transferring enzyme encoding gene ctfAB and E.C. 4.1.1.4 encoding gene adc
CtfAB and adc are two adjacent genes on the acetone-butanol clostridium gene group.Therefore, be template with the genomic dna of clostridium acetobutylicum, the primer of forming with ctfABF and adcR obtains PCR product (about 2kb) to carrying out pcr amplification, is the ctfAB-adc fusion gene.
ctfABF：5’-ATGAACTCTAAAATAATTAG-3’；
adcR：5’-TTACTTAAGATAATCATATAT-3’。
2, the acquisition of alcoholdehydrogenase encoding gene adh
With Bai Shi clostridial genomic dna is template, and the primer of forming with adhF and adhR obtains pcr amplification product (about 1000bp) to carrying out pcr amplification, is the adh gene.
adhF：5’-ATGAAAGGTT?TTGCAATGCT-3’；
adhR：5’-TTATAATATA?ACTACTGCTT-3’。
3, the structure of recombinant plasmid pHR-ctfAB::adc::adh
(1) genomic dna with blue-green algae cytoalgae 6803 is a template, respectively pcr amplification gathered-the upstream and downstream dna fragmentation of beta-hydroxybutyrate synthase gene (pha) is as the integration platform of homologous recombination, called after respectively: Up-1 fragment (about 400bp) and Down-1 fragment (about 600bp).The segmental primer of pcr amplification Up-1 is to as follows:
Up-1F：5’-T?ACACCGCCGA?AATCCAACAC-3’；
Up-1R：5’-GGTCAAAATCCACCTTACTACTGGC-3’。
The segmental primer of pcr amplification Down-1 is to as follows:
Down-1F：5’-TTGCTGGAATACATTAGGGCAAC-3’；
Down-1R：5’-AATATCGAAGCGGACAACGGCAT-3’。
(2) preparation of chloramphenicol resistance gene
Genomic dna with plasmid pRL271 is a template, and pcr amplification obtains Cm gene (about 1000bp), as selection markers.
The primer of pcr amplification chloramphenicol resistance gene is to as follows:
5’-GTTGATAATGAACTGTGCTGAT-3’；
5’-ATCGAATTTCTGCCATTCATCCG-3’。
(3) with ctfAB-adc fusion gene and adh gene simultaneously as template, merge PCR with the combination of primers of ctfABF, adcadhFR and adhR composition, obtain the ctfAB-adc-adh fusion gene.
adcadhFR：5’-AGCATTGCAAAACCTTTCATTTACTTAAGATAATCATATAT-3’。
(4) with Up-1 fragment and ctfAB-adc-adh fusion gene simultaneously as template, merge PCR with the combination of primers of F1, UpctfFR and R1 composition, the pcr amplification product called after dna fragmentation first that obtains is shown in the sequence 1 of sequence table.
F1:5 '-CGC
GGATCCT ACACCGCCGA AATCCAACAC-3 ' (underscore mark BamHI site); UpctfFR:
5’-CTAATTATTTTAGAGTTCATGGTCAAAATCCACCTTACTACTGGC-3’；
R1:5 '-CGC
GGATCCTTATAATATA ACTACTGCTT-3 ' (underscore mark BamHI site).
(5) with Down-1 fragment and Cm gene simultaneously as template, merge PCR with the combination of primers of CmF, CmRF and DownR composition, the pcr amplification product called after dna fragmentation second that obtains is shown in the sequence 2 of sequence table.
Primer is to as follows:
CmF:5 '-GC
TCTAGAGTTGATAATGAACTGTGCTGAT-3 ' (underscore mark XbaI site);
CmRF：5’-GTTGCCCTAATGTATTCCAGCAAATCGAATTTCTGCCATTCATCCG-3’；
DownR:5 '-GC
TCTAGAATATCGAAGCGGACAACGGCAT-3 ' (underscore mark XbaI site).
(6) dna fragmentation second is cut the back with restriction enzyme Xba I enzyme and insert between the Xba I site of carrier pUC-18, obtain the recombinant plasmid first.
(7) the dna fragmentation first is cut the back with restriction enzyme BamH I enzyme and insert between the BamH I site of recombinant plasmid first, obtain recombinant plasmid pHR-ctfAB::adc::adh.
Two, the preparation of recombined blue algae and evaluation
1, the preparation of recombined blue algae
Recombinant plasmid pHR-ctfAB::adc::adh is transformed fresh water blue-green algae cytoalgae 6803, use 10 μ g/ml paraxin screening reorganization bacterium (transformant), its called after recombined blue algae S.M3.
2, gene level is identified
Genomic dna with recombined blue algae S.M3 is a template, and the primer of forming with Up-1F and Down-1R is to carrying out pcr amplification, and pcr amplification product carries out agarose gel electrophoresis, and electrophorogram is seen Fig. 2.Electrophoresis result shows the dna fragmentation of about 5000bp that increases in the recombined blue algae S.M3 genome, and the dna fragmentation of about 3000bp that increases in fresh water blue-green algae cytoalgae 6803 (S.6803) genome, be consistent with the expection clip size, prove that the required ctfAB gene of Virahol route of synthesis, adc gene and adh gene successfully change among the recombined blue algae S.M3.
Three, application project blue-green algae S.M3 produces Virahol
Because of the gene that imports in recombined blue algae S.M3 (engineering algae) only just has activity under the situation in anaerobic, therefore, adopt the dark place fermentation culture to induce.
1, recombined blue algae S.M3 places illumination box shaking culture to the logarithmic growth later stage (to make its cell density reach OD
730=1.5); Temperature is 30 ℃, and light intensity is 100 μ m/m2s, and oscillation frequency is 130r/min, and substratum is BG-11.
2, then with the dark static cultivation of recombined blue algae S.M3 72 hours, it is carried out from fermentation.
3, centrifugal, get supernatant, with the generation of liquid chromatographic detection Virahol.
Chromatographic condition: Agilent 1200 liquid chromatographs, the differential detector; BioRad Aminex HPX-87H organic acid post (300*7.8mm), 15 ℃ of column temperatures; Applied sample amount 10 μ l; Moving phase is 0.05mM H
2SO
4Solution, flow velocity 0.5ml/min.
The results are shown in Figure 3.The Virahol appearance time is about 24 minutes.According to typical curve y=0.372x-0.004, calculate Virahol output and account for 10% of dry cell weight.
In fresh water blue-green algae cytoalgae 6803, set up the acetone approach earlier, on the basis of producing acetone, set up the Virahol approach.From Fig. 1 Virahol route of synthesis as can be seen, Virahol is by the acetone dehydrogenation.Therefore, carry out in two steps in the present embodiment, promptly obtain producing the reorganization algae of acetone earlier, in this reorganization algae, import alcoholdehydrogenase then, obtain to produce the reorganization algae of Virahol.With poly-on the cytoalgae genome-beta-hydroxybutyrate synthase gene (pha) is an integration platform, in cytoalgae, express acetoacetyl-CoA transferring enzyme encoding gene (ctfAB), E.C. 4.1.1.4 encoding gene (adc) by homologous recombination, set up the acetone route of synthesis; Alcoholdehydrogenase encoding gene (adh) is that integration platform is expressed in cytoalgae with L-Glutamine deaminase gene (slr2079), finishes the foundation of Virahol route of synthesis.
One, produces preparation and the evaluation of acetone recombined blue algae S.M4
1, the preparation of recombined blue algae S.M4
(1) with the ctfAB-adc fusion gene of the Up-1 fragment of embodiment 1 and embodiment 1 simultaneously as template, the combination of primers of forming with F-1, UpctfFR and adcR1 merges PCR, the pcr amplification product called after dna fragmentation the third that obtains is shown in the sequence 3 of sequence table.
AdcR1:5 '-CGC
GGATCCTTACTTAAGATAATCATATAT-3 ' (underscore mark BamHI site).
(2) the dna fragmentation third usefulness restriction enzyme Bam H I enzyme is cut the Bam H that the recombinant plasmid first of embodiment 1 is inserted in the back
Between the I site, obtain recombinant plasmid pHR-ctfAB::adc.
(3) recombinant plasmid pHR-ctfAB::adc is transformed fresh water blue-green algae cytoalgae 6803, use 10 μ g/ml paraxin screening reorganization bacterium (transformant), its called after recombined blue algae S.M4.
2, the gene level of recombined blue algae S.M4 is identified
Genomic dna with recombined blue algae S.M4 is a template, carries out pcr amplification with Up-1F and Down-1R, and pcr amplification product carries out agarose gel electrophoresis, and electrophorogram is seen Fig. 4.The dna fragmentation of about 4000bp increases in the genome of electrophoresis showed recombined blue algae S.M4, and the dna fragmentation of about 3000bp that from fresh water blue-green algae cytoalgae 6803 (S.6803) genome, increases, be consistent with the expection clip size, prove that synthetic required ctfAB gene and the adc gene of acetone approach successfully changes among the recombined blue algae S.M4.
3, recombined blue algae S.M4 produces the evaluation of acetone ability
(1) recombined blue algae S.M4 places illumination box shaking culture to the logarithmic growth later stage (to make its cell density reach OD
730=1.5); Temperature is 30 ℃, and light intensity is 100 μ m/m2s, and oscillation frequency is 130r/min, and substratum is BG-11.
(2) then with the dark static cultivation of recombined blue algae S.M4 48 hours, it is carried out from fermentation.
(3) centrifugal, get supernatant, with the generation of liquid chromatographic detection acetone.
Chromatographic condition: Agilent 1200 liquid chromatographs, the differential detector; BioRad Aminex HPX-87H organic acid post (300*7.8mm), 15 ℃ of column temperatures; Applied sample amount 10 μ l; Moving phase is 0.05mM H
2SO
4Solution, flow velocity 0.5ml/min.
The results are shown in Figure 5.The acetone appearance time is 27 minutes.
Two, the preparation of recombined blue algae S.M5 and evaluation
1, the structure of recombinant plasmid pHR-adh
(1) genomic dna with fresh water blue-green algae cytoalgae 6803 is a template, and pcr amplification obtains Up-2 fragment (about 400bp) and Down-2 fragment (about 400bp) respectively.The Up-2 fragment is a slr2079 upstream region of gene dna fragmentation in the blue-green algae genomic dna, and the Down-2 fragment is a slr2079 gene downstream DNA fragment in the blue-green algae genomic dna.
The segmental primer of pcr amplification Up-2 is to as follows:
5’-T?ATATTTCTCCGCTCCATCCA-3’；
5’-TCTTGATCTCGTTATTCACC-3’。
The segmental primer of pcr amplification Down-2 is to as follows:
5’-TTAGCAAA?CCATCTTCTC?TA-3’；
5’-CAGATATATC?TTGCCCGTTG?C-3’。
(2) preparation of kalamycin resistance gene
Genomic dna with blue-green algae expression vector pAM2770 is a template, and pcr amplification obtains Km gene (about 1000bp).
The primer of pcr amplification kalamycin resistance gene is to as follows:
5’-GACAGGATGA?GGATCGTTTC-3’；
5’-AAGTTGTAAC?CATTTAAAAC?C-3’。
(3) with Down-2 fragment and Km gene simultaneously as template, merge PCR with the combination of primers of KmF, Kmdown2RF and Down2R composition, the pcr amplification product called after dna fragmentation fourth that obtains is shown in the sequence 4 of sequence table.
KmF:5 '-GC
TCTAGAGACAGGATGAGGATCGTTTC-3 '; (the line standard laid down by the ministries or commissions of the Central Government is annotated Xba I site);
Kmdown2RF：5’-TAGAGAAGAT?GGTTTGCTAAAAGTTGTAAC?CATTTAAAAC?C-3’；
Down2R:3 '-GC
TCTAGACAGATATATC TTGCCCGTTG C (the line part marks Xba I site).
(4) with the Up-2 fragment and with the adh gene of embodiment 1 simultaneously as template, merge PCR with the combination of primers of Up2F, Up2adhRF and adhR1 composition, the pcr amplification product called after dna fragmentation penta that obtains is shown in the sequence 5 of sequence table.
Up2F:5 '-CGC
GGATCCT ATATTTCTCCGCTCCATCCA-3 '; (the line part marks BamH I site);
Up2adhRF：5’-AGCATTGCAA?AACCTTTCATTCTTGATCTCGTTATTCACC-3’；
AdhR1:5 '-CGC
GGATCCTTATAATATA ACTACTGCTT-3 ' (the line part marks BamH I site).
(5) the dna fragmentation fourth is cut between the Xba I restriction enzyme site that inserts carrier pUC-18 in the back with restriction enzyme Xba I enzyme, obtain recombinant plasmid second.
(6) dna fragmentation penta usefulness restriction enzyme Bam H I enzyme is cut between the Bam H I restriction enzyme site that inserts recombinant plasmid second in the back, obtained cytoalgae recombinant plasmid pHR-adh.
2, the preparation of recombined blue algae S.M5
Cytoalgae recombinant plasmid pHR-adh is transformed recombined blue algae S.M4, use 10 μ g/ml paraxin and 10 μ g/ml kantlex screening reorganization bacterium (transformant), its called after recombined blue algae S.M5.
3, the gene level of recombined blue algae S.M5 is identified
(1) gene level is identified
Genomic dna with recombined blue algae S.M5 is a template, carries out pcr amplification with adhF and adhR, and pcr amplification product carries out agarose gel electrophoresis, and electrophorogram is seen Fig. 6.The band of electrophoresis showed 1000bp proves that the required adh gene of above-mentioned catalysis acetone petrohol successfully changes among the recombined blue algae S.M5.
(2) use recombined blue algae S.M5 and produce Virahol
1. recombined blue algae S.M5 places illumination box shaking culture to the logarithmic growth later stage (to make its cell density reach OD
730=1.5); Temperature is 30 ℃, and light intensity is 100 μ m/m2s, and oscillation frequency is 130r/min, and substratum is BG-11.
2. then with the dark static cultivation of recombined blue algae S.M5 48 hours, it is carried out from fermentation.
3. centrifugal, get supernatant, with the generation of liquid chromatographic detection Virahol.
Chromatographic condition: Agilent 1200 liquid chromatographs, the differential detector; BioRad Aminex HPX-87H organic acid post (300*7.8mm), 15 ℃ of column temperatures; Applied sample amount 10 μ l; Moving phase is 0.05mM H
2SO
4Solution, flow velocity 0.5ml/min.
The results are shown in Figure 7.The Virahol appearance time is 24.3 minutes.According to typical curve y=0.372x-0.004, calculate Virahol output and account for 10% of dry cell weight.
One, the structure of recombinant plasmid pHR-thl::ctfAB::adc::adh (synechococcus homologous recombination integrating expression vector)
1, the acquisition of the encoding gene of acetyl-CoA Transacetylase (thl)
Owing to do not have the acetyl-CoA Transacetylase in the synechococcus, therefore, need in synechococcus, express this enzyme.Genomic dna with clostridium acetobutylicum is a template, and the primer of forming with thlF and thlR obtains PCR product (about 1100bp) to carrying out pcr amplification, is the thl gene.
thlF：5’-ATGAAAGAAG?TTGTAATAGC-3’
thlR：5’-CTAGCACTTT?TCTAGCAAT-3’
2, with the adh gene of the ctfAB-adc fusion gene of thl gene, embodiment 1 and embodiment 1 simultaneously as template, the combination of primers of forming with thlF, thlctfABFR, adcadhFR and adhR merges PCR, obtains the thl-ctfAB-adc-adh fusion gene.
thlctfABFR：5’-CTAATTATTT?TAGAGTTCATCTAGCACTTT?TCTAGCAAT-3’。
3, the genomic dna with seawater blue-green algae synechococcus 7002 is a template, and pcr amplification obtains Up-3 fragment (about 400bp) and Down-3 fragment (about 400bp) respectively, as the integration platform of gene insertion.Up-3 and Down-3 fragment are respectively the upstream and downstream dna fragmentation of synechococcus genomic dna SYNPCC7002_A1630 gene.
The segmental primer of pcr amplification Up-3 is to as follows:
Up3F：5’-ACGGCAACCT?AGCTCCATAA-3’；
Up3R：5’-TTTACATTGG?AAATTTGTCC-3’。
The segmental primer of pcr amplification Down-3 is to as follows:
Down3F：5’-ATGTCTTCTC?TCGTAATTTT-3’；
Down3R：5’-GGTGGGGTGC?CTCACAAACA?A-3’。
4, Cm gene and the Down-3 fragment with Up-3 fragment, thl-ctfAB-adc-adh fusion gene, embodiment 1 is template simultaneously, the combination of primers of forming with Up3F, Up3thlRF, adhCmRF, Cmdown3RF and Down3R merges PCR, the pcr amplification product called after dna fragmentation that obtains, shown in the sequence 9 of sequence table.
Up3thlRF：5’-GCTATTACAA CTTCTTTCAT?TTTACATTGG AAATTTGTCC-3’；
adhCmRF：5’-
ATCAGCACAGTTCATTATCAACTTATAATATAACTACTGCTT-3’；
Cmdown3RF：5’-AAAATTACGAGAGAAGACAT?ATCGAATTTCTGCCATTCATCCG-3’。
5, dna fragmentation has been cloned on the pMD-18T, has obtained recombinant plasmid pHR-thl::ctfAB::adc::adh.
Two, the preparation of recombined blue algae and evaluation
1, the preparation of recombined blue algae
Recombinant plasmid pHR-thl::ctfAB::adc::adh is transformed seawater blue-green algae synechococcus 7002, use 10 μ g/ml paraxin screening reorganization bacterium (transformant), its called after recombined blue algae S.M6.
2, gene level is identified
Genomic dna with recombined blue algae S.M6 is a template, and the primer of forming with Up3F and Down3R is to carrying out pcr amplification, and pcr amplification product carries out agarose gel electrophoresis, and electrophorogram is seen Fig. 8.Electrophoresis result shows the dna fragmentation of about 6000bp that increases in the recombined blue algae S.M6 genome, and the dna fragmentation of about 3000bp that increases in seawater blue-green algae synechococcus 7002 (S.7002) genome, be consistent with the expection clip size, prove that the required thl gene of Virahol route of synthesis, ctfAB gene, adc gene and adh gene successfully change among the recombined blue algae S.M6.
Three, application project blue-green algae S.M6 produces Virahol
1, recombined blue algae S.M6 places illumination box shaking culture to the logarithmic growth later stage (to make its cell density reach OD
730=1.5); Temperature is 30 ℃, and light intensity is 100 μ m/m2s, and oscillation frequency is 130r/min, and substratum is BG-11.
2, then with the dark static cultivation of recombined blue algae S.M6 72 hours, it is carried out from fermentation.
3, centrifugal, get supernatant, with the generation of liquid chromatographic detection Virahol.
Chromatographic condition: Agilent 1200 liquid chromatographs, the differential detector; BioRad Aminex HPX-87H organic acid post (300*7.8mm), 15 ℃ of column temperatures; Applied sample amount 10 μ l; Moving phase is 0.05mM H
2SO
4Solution, flow velocity 0.5ml/min.
The results are shown in Figure 9.The Virahol appearance time is about 24 minutes.According to typical curve y=0.372x-0.004, calculate Virahol output and account for 10% of dry cell weight.
Embodiment 4, use seawater blue-green algae synechococcus and produce Virahol/and or acetone
One, the preparation of recombined blue algae S.M7 and evaluation
1, the preparation of recombined blue algae S.M7
(1) with the ctfAB-adc fusion gene of thl gene and embodiment 1 simultaneously as template, merge PCR with the combination of primers of thlF, thlctfABFR and adcR composition, obtain the thl-ctfAB-adc fusion gene.
(2) with Down-3 fragment, thl-ctfAB-adc fusion gene and the Cm gene of the Up-3 fragment of embodiment 3, embodiment 3 simultaneously as template, the combination of primers of forming with Up3F, Up3thlRF, adcCmRF, Cmdown3RF and Down3R merges PCR, the pcr amplification product called after dna fragmentation heptan that obtains is shown in the sequence 10 of sequence table.
adcCmRF：5’-ATCAGCACAGTTCATTATCAAC?TTACTTAAGATAATCATATAT-3’。
(3) dna fragmentation is cloned on the pMD-18T heptan, obtains recombinant plasmid pHR-thl::ctfAB::adc.
2, the preparation of recombined blue algae S.M7
Transform seawater blue-green algae synechococcus 7002 with recombinant plasmid pHR-thl::ctfAB::adc, use 10 μ g/ml paraxin screening reorganization bacterium (transformant), its called after recombined blue algae S.M7.
3, the gene level of recombined blue algae S.M7 is identified
Genomic dna with recombined blue algae S.M7 is a template, carries out pcr amplification with Up3F and Down3R, and pcr amplification product carries out agarose gel electrophoresis, and electrophorogram is seen Figure 10.Electrophoresis result shows the dna fragmentation of about 5000bp that increases in the recombined blue algae S.M6 genome, and the dna fragmentation of about 3000bp that increases in seawater blue-green algae synechococcus 7002 (S.7002) genome, be consistent with the expection clip size, prove that the required thl gene of acetone route of synthesis, ctfAB gene and adc gene successfully change among the recombined blue algae S.M7.
4, recombined blue algae S.M7 produces the evaluation of acetone ability
(1) recombined blue algae S.M7 places illumination box shaking culture to the logarithmic growth later stage (to make its cell density reach OD
730=1.5); Temperature is 30 ℃, and light intensity is 100 μ m/m2s, and oscillation frequency is 130r/min, and substratum is BG-11.
(2) then with the dark static cultivation of recombined blue algae S.M7 48 hours, it is carried out from fermentation.
(3) centrifugal, get supernatant, with the generation of liquid chromatographic detection acetone.
Chromatographic condition: Agilent 1200 liquid chromatographs, the differential detector; BioRad Aminex HPX-87H organic acid post (300*7.8mm), 15 ℃ of column temperatures; Applied sample amount 10 μ l; Moving phase is 0.05mM H
2SO
4Solution, flow velocity 0.5ml/min.
The results are shown in Figure 11.The acetone appearance time is 27 minutes.
Two, the preparation of recombined blue algae S.M8 and evaluation
1, the structure of recombinant plasmid pHR-adh
(1) genomic dna with seawater blue-green algae synechococcus 7002 is a template, and pcr amplification obtains Up-4 fragment (about 400bp) and Down-4 fragment (about 400bp) respectively.Up-4 and Down-4 fragment are respectively SYNPCC7002_A0909 gene upstream and downstream dna fragmentation in the synechococcus genomic dna.
The segmental primer of pcr amplification Up-4 is to as follows:
Up4F：5’-CAAAATCACATTTTCAAGGGCAC-3’；
Up4R：5’-AGCGTGAAAACCTCCACAGCG-3’。
The segmental primer of pcr amplification Down-4 is to as follows:
Down4F：5’-GGTTTCCCAAAGCTGCTACATT-3’；
Down4R：5’-TGTTGCCAAAGATTTTTGCGGC-3’。
(2) be template simultaneously with adh gene among Up-4 fragment, Down-4, the embodiment 1 and the Km gene among the embodiment 2, the combination of primers of forming with Up4F, Up4adhRF, adhKmRF, Kmdown4RF and Down4R merges PCR, the pcr amplification product called after dna fragmentation suffering that obtains is shown in the sequence 11 of sequence table.
Up4adhRF：5’-AGCATTGCAA?AACCTTTCAT?AGCGTGAAAACCTCCACAGCG-3’；
adhKmRF：5’-
GATCCTCATCCTGTCTCTTGATCTTATAATATAACTACTGCTT-3’；
Kmdown4RF：5’-AATGTAGCAG?CTTTGGGAAA?CC?AAGTTGTAAC?CATTTAAAAC?C-3’。
(2) the dna fragmentation suffering is cloned on the pMD-18T, obtains synechococcus recombinant plasmid pHR-adh.
2, the preparation of recombined blue algae S.M8
Synechococcus recombinant plasmid pHR-adh is transformed recombined blue algae S.M7, use 10 μ g/ml paraxin and 10 μ g/ml kantlex screening reorganization bacterium (transformant), its called after recombined blue algae S.M8.
3, the gene level of recombined blue algae S.M8 is identified
(1) gene level is identified
Genomic dna with recombined blue algae S.M8 is a template, carries out pcr amplification with adhF and adhR, and pcr amplification product carries out agarose gel electrophoresis, and electrophorogram is seen Figure 12.The band of electrophoresis showed 1000bp proves that the required adh gene of above-mentioned catalysis acetone petrohol successfully changes among the recombined blue algae S.M8.
(2) use recombined blue algae S.M8 and produce Virahol
1. recombined blue algae S.M8 places illumination box shaking culture to the logarithmic growth later stage (to make its cell density reach OD
730=1.5); Temperature is 30 ℃, and light intensity is 100 μ m/m
2S, oscillation frequency is 130r/min, substratum is BG-11.
2. then with the dark static cultivation of recombined blue algae S.M8 48 hours, it is carried out from fermentation.
3. centrifugal, get supernatant, with the generation of liquid chromatographic detection Virahol.
Chromatographic condition: Agilent 1200 liquid chromatographs, the differential detector; BioRad Aminex HPX-87H organic acid post (300*7.8mm), 15 ℃ of column temperatures; Applied sample amount 10 μ l; Moving phase is 0.05mM H
2SO
4Solution, flow velocity 0.5ml/min.
The results are shown in Figure 13.The Virahol appearance time is 24.3 minutes.According to typical curve y=0.372x-0.004, calculate Virahol output and account for 10% of dry cell weight.
Claims (10)
1. recombined blue algae is in following (1) to (6) any one:
(1) encoding gene of the encoding gene of the encoding gene of acetoacetyl-CoA transferring enzyme, E.C. 4.1.1.4 and alcoholdehydrogenase is imported the recombined blue algae I of the product Virahol that the genomic dna of blue-green algae obtains;
(2) encoding gene of the encoding gene of acetoacetyl-CoA transferring enzyme and E.C. 4.1.1.4 is imported the recombined blue algae II of the product acetone that the genomic dna of blue-green algae obtains;
(3) encoding gene of alcoholdehydrogenase is imported the recombined blue algae III of the product Virahol that the genomic dna of the recombined blue algae II of described product acetone obtains;
(4) encoding gene of the encoding gene of the encoding gene of the encoding gene of acetyl-CoA Transacetylase, acetoacetyl-CoA transferring enzyme, E.C. 4.1.1.4 and alcoholdehydrogenase is imported the recombined blue algae IV of the product Virahol that the genomic dna of blue-green algae obtains;
(5) encoding gene of the encoding gene of the encoding gene of acetyl-CoA Transacetylase, acetoacetyl-CoA transferring enzyme and E.C. 4.1.1.4 is imported the recombined blue algae V of the product acetone that the genomic dna of blue-green algae obtains;
(6) encoding gene of alcoholdehydrogenase is imported the recombined blue algae VI of the product Virahol that the genomic dna of the recombined blue algae V of described product acetone obtains.
2. recombined blue algae as claimed in claim 1 is characterized in that:
In described (1) or (2) or (4) or (5), described acetoacetyl-CoA transferring enzyme is following (a) or (b):
(a) protein of forming by the aminoacid sequence shown in the sequence in the sequence table 6;
(b) with the aminoacid sequence of sequence in the sequence table 6 through the replacement of one or several amino-acid residue and/or disappearance and/or interpolation and have acetoacetyl-CoA transferring enzyme function by (a) deutero-protein;
In described (1) or (2) or (4) or (5), described E.C. 4.1.1.4 is following (c) or (d):
(c) protein of forming by the aminoacid sequence shown in the sequence in the sequence table 7;
(d) with the aminoacid sequence of sequence in the sequence table 7 through the replacement of one or several amino-acid residue and/or disappearance and/or interpolation and have the E.C. 4.1.1.4 function by (c) deutero-protein;
In described (1) or (3) or (4) or (6), described alcoholdehydrogenase is following (e) or (f):
(e) protein of forming by the aminoacid sequence shown in the sequence in the sequence table 8;
(f) with the aminoacid sequence of sequence in the sequence table 8 through the replacement of one or several amino-acid residue and/or disappearance and/or interpolation and have the alcoholdehydrogenase function by (e) deutero-protein;
In described (4) or (5), described acetyl-CoA Transacetylase is following (g) or (h):
(g) protein of forming by the aminoacid sequence shown in the sequence in the sequence table 12;
(h) with the aminoacid sequence of sequence in the sequence table 12 through the replacement of one or several amino-acid residue and/or disappearance and/or interpolation and have acetyl-CoA Transacetylase function by (g) deutero-protein.
3. recombined blue algae as claimed in claim 2 is characterized in that:
The encoding gene of described acetoacetyl-CoA transferring enzyme is following (I), (II) or (III):
(I) in the sequence table sequence 1 from the dna molecular shown in 5 ' terminal the 427th to 1746 Nucleotide;
(II) under stringent condition with the DNA hybridization that (I) limits and the dna molecular of encoding said proteins;
(III) dna molecular of 90% above homology and encoding said proteins is arranged with the dna sequence dna that (I) limits;
The encoding gene of described E.C. 4.1.1.4 is following (IV), (V) or (VI):
(IV) in the sequence table sequence 1 from the dna molecular shown in 5 ' terminal the 1747th to 2481 Nucleotide;
(V) under stringent condition with the DNA hybridization that (IV) limits and the dna molecular of encoding said proteins;
(VI) dna molecular of 90% above homology and encoding said proteins is arranged with the dna sequence dna that (IV) limits;
The encoding gene of described alcoholdehydrogenase is following (VII), (VIII) or (IX):
(VII) in the sequence table sequence 1 from the dna molecular shown in 5 ' terminal the 2482nd to 3537 Nucleotide;
(VIII) under stringent condition with the DNA hybridization that (VII) limits and the dna molecular of encoding said proteins;
(IX) dna molecular of 90% above homology and encoding said proteins is arranged with the dna sequence dna that (VII) limits;
The encoding gene of described acetyl-CoA Transacetylase is following (X), (XI) or (XII):
(X) in the sequence table sequence 9 from the dna molecular shown in 5 ' terminal the 401st to 1579 Nucleotide;
(XI) under stringent condition with the DNA hybridization that (X) limits and the dna molecular of encoding said proteins;
(XII) dna molecular of 90% above homology and encoding said proteins is arranged with the dna sequence dna that (X) limits.
4. as arbitrary described recombined blue algae in the claim 1 to 3, it is characterized in that:
The recombined blue algae I of described product Virahol obtains the double-stranded DNA first by the genomic dna that homologous recombination imports blue-green algae; Described double-stranded DNA first comprises the encoding gene of the encoding gene of described acetoacetyl-CoA transferring enzyme, described E.C. 4.1.1.4 and the encoding gene of described alcoholdehydrogenase;
The recombined blue algae II of described product acetone obtains double-stranded DNA second by the genomic dna that homologous recombination imports blue-green algae; Described double-stranded DNA second comprises the encoding gene of described acetoacetyl-CoA transferring enzyme and the encoding gene of described E.C. 4.1.1.4;
The recombined blue algae III of described product Virahol obtains double-stranded DNA third by the genomic dna that homologous recombination imports the recombined blue algae II of described product acetone; Described double-stranded DNA third comprises the encoding gene of described alcoholdehydrogenase;
The recombined blue algae IV of described product Virahol obtains the double-stranded DNA fourth by the genomic dna that homologous recombination imports blue-green algae; Described double-stranded DNA fourth comprises the encoding gene of the encoding gene of described acetyl-CoA Transacetylase, the encoding gene of described acetoacetyl-CoA transferring enzyme, described E.C. 4.1.1.4 and the encoding gene of described alcoholdehydrogenase;
The recombined blue algae V of described product acetone obtains double-stranded DNA penta by the genomic dna that homologous recombination imports blue-green algae; Described double-stranded DNA penta comprises the encoding gene of the encoding gene of described acetyl-CoA Transacetylase, described acetoacetyl-CoA transferring enzyme and the encoding gene of described E.C. 4.1.1.4;
The recombined blue algae VI of described product Virahol obtains double-stranded DNA by the genomic dna that homologous recombination imports the recombined blue algae V of described product acetone; Described double-stranded DNA has comprised the encoding gene of described alcoholdehydrogenase.
5. recombined blue algae as claimed in claim 4 is characterized in that:
The two ends of described double-stranded DNA first have the homology arm of the genomic dna of described blue-green algae respectively; The two ends of described double-stranded DNA second have the homology arm of the genomic dna of described blue-green algae respectively; The two ends of described double-stranded DNA third have the homology arm of the genomic dna of described blue-green algae respectively; The two ends of described double-stranded DNA fourth have the homology arm of the genomic dna of described blue-green algae respectively; The two ends of described double-stranded DNA penta have the homology arm of the genomic dna of described blue-green algae respectively; Described double-stranded DNA two ends have the homology arm of the genomic dna of described blue-green algae respectively;
The homology arm of the encoding gene of the two ends of described double-stranded DNA first preferably have poly--beta-hydroxybutyrate synthetic enzyme; The homology arm of the encoding gene of the two ends of described double-stranded DNA second preferably have poly--beta-hydroxybutyrate synthetic enzyme; The two ends of described double-stranded DNA third preferably have the homology arm of the encoding gene of L-Glutamine deaminase; The two ends of described double-stranded DNA fourth preferably have the homology arm of Genbank Accession NO.SYNPCC7002_A1630 gene; The two ends of described double-stranded DNA penta preferably have the homology arm of Genbank Accession NO.SYNPCC7002_A1630 gene; Described double-stranded DNA two ends preferably have the homology arm of Genbank Accession NO.SYNPCC7002_A0909 gene.
6. as claim 4 or 5 described recombined blue algaes, it is characterized in that: also have screening-gene on the described double-stranded DNA first, described screening-gene is preferably chloramphenicol resistance gene; Also have screening-gene on the described double-stranded DNA second, described screening-gene is preferably chloramphenicol resistance gene; Also have screening-gene on the described double-stranded DNA third, described screening-gene is preferably kalamycin resistance gene; Also have screening-gene on the described double-stranded DNA fourth, described screening-gene is preferably chloramphenicol resistance gene; Also have screening-gene on the described double-stranded DNA penta, described screening-gene is preferably chloramphenicol resistance gene; Described double-stranded DNA has been gone up also has screening-gene, and described screening-gene is preferably kalamycin resistance gene.
7. as claim 4 or 5 or 6 described recombined blue algaes, it is characterized in that:
Obtain in the process of recombined blue algae I of described product Virahol, described homologous recombination realizes by the recombinant plasmid first being imported described blue-green algae; Carry described double-stranded DNA first on the described recombinant plasmid first;
Obtain in the process of recombined blue algae II of described product acetone, described homologous recombination realizes by recombinant plasmid second being imported described blue-green algae; Carry described double-stranded DNA second on the described recombinant plasmid second;
Obtain in the process of recombined blue algae III of described product Virahol, described homologous recombination is to realize by the recombined blue algae II that recombinant plasmid third is imported described product acetone; Carry described double-stranded DNA third on the described recombinant plasmid third;
Obtain in the process of recombined blue algae IV of described product Virahol, described homologous recombination realizes by the recombinant plasmid fourth being imported described blue-green algae; Carry described double-stranded DNA fourth on the described recombinant plasmid fourth;
Obtain in the process of recombined blue algae V of described product acetone, described homologous recombination realizes by recombinant plasmid penta is imported described blue-green algae; Carry described double-stranded DNA penta on the described recombinant plasmid penta;
Obtain in the process of recombined blue algae VI of described product Virahol, described homologous recombination is to realize by the recombined blue algae V that recombinant plasmid has been imported described product acetone; Described recombinant plasmid has carried described double-stranded DNA on.
8. recombined blue algae as claimed in claim 7 is characterized in that:
Described recombinant plasmid first is: with carrier pUC-18 is skeleton carrier, at the multiple clone site of the skeleton carrier recombinant plasmid that obtains from DNA shown in 5 ' terminal the 7th to 3537 Nucleotide from the sequence 1 of DNA shown in 5 ' terminal the 9th to 1653 Nucleotide and sequence table of the sequence 2 of insertion sequence table respectively; Described recombinant plasmid first is preferably: with carrier pUC-18 is skeleton carrier, in the sequence 2 of the Xba of skeleton carrier I site insertion sequence table from DNA shown in 5 ' terminal the 9th to 1653 Nucleotide, in the sequence 1 of the Bam of skeleton carrier H I site insertion sequence table from DNA shown in 5 ' terminal the 7th to 3537 Nucleotide, the recombinant plasmid that obtains;
Described recombinant plasmid second is: with carrier pUC-18 is skeleton carrier, at the multiple clone site of the skeleton carrier recombinant plasmid that obtains from DNA shown in 5 ' terminal the 7th to 2481 Nucleotide from the sequence 3 of DNA shown in 5 ' terminal the 9th to 1653 Nucleotide and sequence table of the sequence 2 of insertion sequence table respectively; Described recombinant plasmid second is preferably: with carrier pUC-18 is skeleton carrier, in the sequence 2 of the Xba of skeleton carrier I site insertion sequence table from DNA shown in 5 ' terminal the 9th to 1653 Nucleotide, in the sequence 3 of the Bam of skeleton carrier H I site insertion sequence table from DNA shown in 5 ' terminal the 7th to 2481 Nucleotide, the recombinant plasmid that obtains;
Described recombinant plasmid third is: with carrier pUC-18 is skeleton carrier, at the multiple clone site of the skeleton carrier recombinant plasmid that obtains from DNA shown in 5 ' terminal the 7th to 1472 Nucleotide from the sequence 5 of DNA shown in 5 ' terminal the 7th to 1320 Nucleotide and sequence table of the sequence 4 of insertion sequence table respectively; Described recombinant plasmid third is preferably: with carrier pUC-18 is skeleton carrier, in the sequence 4 of the Xba of skeleton carrier I site insertion sequence table from DNA shown in 5 ' terminal the 7th to 1320 Nucleotide, at the Bam of skeleton carrier H I site insertion sequence 5 from 5 ' terminal the 7th to 1472 Nucleotide, the recombinant plasmid that obtains;
Described recombinant plasmid fourth is the recombinant plasmid that the sequence 9 of insertion sequence table in pMD-18T obtains from DNA shown in 5 ' terminal the 1st to 6141 Nucleotide;
The recombinant plasmid that the sequence 10 that described recombinant plasmid penta is an insertion sequence table in pMD-18T obtains from DNA shown in 5 ' terminal the 1st to 5085 Nucleotide;
Described recombinant plasmid has been the recombinant plasmid that the sequence 11 of insertion sequence table in pMD-18T obtains from DNA shown in 5 ' terminal the 1st to 2899 Nucleotide.
9. as arbitrary described recombined blue algae in the claim 1 to 8, it is characterized in that: described blue-green algae is fresh water blue-green algae cytoalgae 6803 or seawater blue-green algae synechococcus 7002.
10. the application of arbitrary described recombined blue algae in producing Virahol and/or acetone in the claim 1 to 9.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 201110038190 CN102181368B (en) | 2011-02-15 | 2011-02-15 | Technique for biotransforming CO2 into isopropyl alcohol by utilizing blue algae |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 201110038190 CN102181368B (en) | 2011-02-15 | 2011-02-15 | Technique for biotransforming CO2 into isopropyl alcohol by utilizing blue algae |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102181368A true CN102181368A (en) | 2011-09-14 |
| CN102181368B CN102181368B (en) | 2013-06-12 |
Family
ID=44567657
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 201110038190 Expired - Fee Related CN102181368B (en) | 2011-02-15 | 2011-02-15 | Technique for biotransforming CO2 into isopropyl alcohol by utilizing blue algae |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102181368B (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102517303A (en) * | 2011-11-24 | 2012-06-27 | 中国科学院微生物研究所 | Recombination blue-green alga for producing lactic acid as well as preparation method and applications thereof |
| CN104726505A (en) * | 2015-03-31 | 2015-06-24 | 上海交通大学 | Method for producing three-carbon compounds by using gene engineering cyanobacteria |
| CN108728475A (en) * | 2018-06-25 | 2018-11-02 | 嘉兴欣贝莱生物科技有限公司 | A method of synthesizing Tagatose using cyanobacteria |
| CN111057686A (en) * | 2019-12-23 | 2020-04-24 | 浙江大学 | Alcohol dehydrogenase mutant and application thereof |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101918539A (en) * | 2007-12-17 | 2010-12-15 | 阿姆斯特丹大学 | Light-driven CO2 reduction to organic compounds to serve as fuels or as industrial half products by an autotroph containing a fermentative gene cassette |
-
2011
- 2011-02-15 CN CN 201110038190 patent/CN102181368B/en not_active Expired - Fee Related
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101918539A (en) * | 2007-12-17 | 2010-12-15 | 阿姆斯特丹大学 | Light-driven CO2 reduction to organic compounds to serve as fuels or as industrial half products by an autotroph containing a fermentative gene cassette |
Non-Patent Citations (8)
| Title |
|---|
| 《GenBanK, AF157307.2》 20050329 Rifaat,M.M. Clostridium beijerinckii strain NRRL B593 putative transcription activator (stc), NADP-dependent alcohol dehydrogenase (adh), and putative electron-transfer protein (hydG) genes, complete cds; and putative glutamate synthase small subunit (gltD) gene, part 全文 3 , * |
| 《GenBanK, M93363.1》 19970430 Petersen,D.J. Clostridium acetobutylicum acetoacetate decarboxylase, acetoacetyl-coenzyme A:acetate/butyrate:coenzyme A-transferase subunit, complete cds 全文 3 , * |
| 《GenBanK, NP_149326.1》 20090426 Nolling 等 ctfa gene product [Clostridium acetobutylicum ATCC 824] 全文 2 , * |
| 《GenBanK, NP_149328.1》 20090426 Nolling adc gene product [Clostridium acetobutylicum ATCC 824] 全文 2 , * |
| 《GenBanK, P25984.2》 20110208 Korkhin RecName: Full=NADP-dependent alcohol dehydrogenase; AltName: Full=CbADH 全文 2 , * |
| 《GenBanK, P45359.1》 20101130 Stim-Herndon RecName: Full=Acetyl-CoA acetyltransferase; AltName: Full=Acetoacetyl-CoA thiolase 全文 2 , * |
| 《GenBanK, U08465.1》 19951204 Stim-Herndon,K.P. Clostridium acetobutylicum ATCC 824 acetyl coenzyme A acetyltransferase gene, complete cds, and homolog of B. subtilis orfX gene, partial cds 全文 3 , * |
| 《GenBanK，NP_149327.1》 20090426 Nolling ctfb gene product [Clostridium acetobutylicum ATCC 824] 全文 2 , * |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102517303A (en) * | 2011-11-24 | 2012-06-27 | 中国科学院微生物研究所 | Recombination blue-green alga for producing lactic acid as well as preparation method and applications thereof |
| CN102517303B (en) * | 2011-11-24 | 2013-08-07 | 中国科学院微生物研究所 | Recombination blue-green alga for producing lactic acid as well as preparation method and applications thereof |
| CN104726505A (en) * | 2015-03-31 | 2015-06-24 | 上海交通大学 | Method for producing three-carbon compounds by using gene engineering cyanobacteria |
| CN108728475A (en) * | 2018-06-25 | 2018-11-02 | 嘉兴欣贝莱生物科技有限公司 | A method of synthesizing Tagatose using cyanobacteria |
| CN111057686A (en) * | 2019-12-23 | 2020-04-24 | 浙江大学 | Alcohol dehydrogenase mutant and application thereof |
| CN111057686B (en) * | 2019-12-23 | 2021-05-04 | 浙江大学 | Alcohol dehydrogenase mutant and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN102181368B (en) | 2013-06-12 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Bengelsdorf et al. | Bacterial synthesis gas (syngas) fermentation | |
| Shanmugam et al. | Recent developments and strategies in genome engineering and integrated fermentation approaches for biobutanol production from microalgae | |
| CN103502435B (en) | Recombinant microorganism and application thereof | |
| Kämäräinen et al. | Physiological tolerance and stoichiometric potential of cyanobacteria for hydrocarbon fuel production | |
| Jo et al. | The effects of pH on carbon material and energy balances in hydrogen-producing Clostridium tyrobutyricum JM1 | |
| CN103314101A (en) | Biofuel and chemical production by recombinant microorganisms via fermentation of proteinacious biomass | |
| KR100971792B1 (en) | Method for preparing butanol through butyryl-coa as an intermediate using yeast | |
| CN101748069B (en) | Recombinant blue-green algae | |
| CN104651287A (en) | Engineering bacterium for synthesizing glycosylglycerol and application thereof | |
| CN109321590B (en) | Genetically engineered bacterium for producing L-lactic acid by using acetic acid and construction method and application thereof | |
| CN102181368B (en) | Technique for biotransforming CO2 into isopropyl alcohol by utilizing blue algae | |
| CN107287143A (en) | The Recombinant organism and its construction method of high yield butanol and application | |
| CN105255951B (en) | A method of Alcohol Production efficiency is improved by overexpression HAC1 genes | |
| Jawed et al. | Enhanced H 2 production and redirected metabolic flux via overexpression of fhlA and pncB in Klebsiella HQ-3 strain | |
| ES2909579T3 (en) | Arginine as sole nitrogen source for C1-fixing microorganisms | |
| CN102517303B (en) | Recombination blue-green alga for producing lactic acid as well as preparation method and applications thereof | |
| CN103361375B (en) | Construct, bacterial strain and the method for cyanobacteria biosynthesis ethanol | |
| KR101506137B1 (en) | Cloning and expression of the genes encoding key clostridial catalyzing mechanisms for syngas to ethanol production and functional characterization thereof | |
| Miyasaka et al. | Polyhydroxyalkanoate (PHA) production from carbon dioxide by recombinant cyanobacteria | |
| CN102199614B (en) | Engineering bacteria for stably producing isopropanol and butanol and construction method and application thereof | |
| CN102952818B (en) | For improving construct and the method for fatty alcohol yield in cyanobacteria | |
| CN105255952B (en) | A method of Alcohol Production efficiency is improved by overexpression INO2 genes | |
| CN101372669B (en) | Cyanobacteria modified by gene engineering and use thereof for producing ethanol | |
| CN102978229B (en) | Blue-green algae integrant expression carrier and application thereof | |
| CN101423814B (en) | Clostridium for synthesizing glutathion and construction method and use thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20130612 Termination date: 20200215 |