CN109321590B - Genetically engineered bacterium for producing L-lactic acid by using acetic acid and construction method and application thereof - Google Patents

Abstract

The invention discloses a genetically engineered bacterium for producing L-lactic acid by using acetic acid, and a construction method and application thereof. The invention discloses a genetically engineered bacterium for producing L-lactic acid by using acetic acid, which is obtained by modifying a receptor bacterium as follows: knocking out poxB gene, pflB gene, aceEF gene, ldhA gene and lldD gene of recipient bacteria; increasing the content of the proteins coded by the acs gene, the pta gene, the ackA gene, the aceA gene, the aceK gene, the aceB gene, the maeA gene, the maeB gene and the ldh2 gene in the recipient bacterium. The yield of the L-lactic acid obtained by using acetic acid in shake flask culture of the engineering bacteria obtained by the invention can reach an ideal level, the use of carbon sources such as glucose and the like is avoided, the raw material cost of L-lactic acid fermentation is reduced, and the engineering bacteria have good application prospects.

Description

Genetically engineered bacterium for producing L-lactic acid by using acetic acid and construction method and application thereof

Technical Field

The invention belongs to the fields of biotechnology, genetic engineering and fermentation engineering, and particularly relates to a genetic engineering bacterium for producing L-lactic acid by using acetic acid, and a construction method and application thereof.

Background

The human society consumes a large amount of fossil resources such as petroleum and coal every year, and thus a large amount of greenhouse gases is emitted to cause concern about climate change. Therefore, the development and utilization of renewable biomass resources become one of the hot spots concerned by the current scientific and industrial fields. At present, glucose, xylose, starch, cellulose and the like from agriculture and planting are carbon sources and energy sources commonly used by microorganisms in the fermentation industry. China is a large country in the biological fermentation industry, the yield of a plurality of products is the first in the world, and a large amount of food resources are consumed every year. Therefore, food shortage and the continuous increase of the prices of agricultural and sideline products have become key factors for restricting the development of the biological fermentation industry. In order to solve the problems of 'competing for grains with people and competing for land with grains', the development of a novel fermentation carbon source with wide sources and low cost is urgently needed. Methanol, acetic acid, syngas and the like are gradually becoming research hot spots in the field of industrial biotechnology.

Acetic acid, also known as acetic acid, is a simple dicarboxylic acid and is also a major component of vinegar. Acetic acid is widely distributed in nature, mainly as esters in fruit and vegetable oils. Within the tissues, excreta and blood of animals, acetic acid exists in the form of free acid. Many microorganisms can convert organic matter to acetic acid by anaerobic fermentation. Examples of microorganisms capable of growing using acetic acid as a carbon source include bacteria, fungi, and yeasts, such as Escherichia coli, Saccharomyces cerevisiae, Bacillus subtilis, and Corynebacterium glutamicum.

Lactic acid, also known as 2-hydroxypropionic acid, is an important organic acid. The lactic acid molecule has a chiral carbon atom and has two configurations of D-lactic acid and L-lactic acid. Compared with D-lactic acid, L-lactic acid can be degraded by human body, and is widely used in the fields of food, beverage, medicine, cosmetics, etc. In addition, lactic acid can be polymerized into polylactic acid by a chemical method, and can be used as a biodegradable material. In 2015, the global lactic acid yield is about 50 ten thousand tons, the market demand is mainly based on L-lactic acid, the ratio of the L-lactic acid in the fields of food and beverage is close to 50%, and the ratio of the L-lactic acid in the field of polylactic acid is over 30%.

Common methods for producing lactic acid include chemical methods and microbial fermentation methods. The main routes for producing lactic acid by chemical methods include the lactonitrile method and the acrylonitrile method, and the lactonitrile method is the main route. According to the method, acetaldehyde and hydrocyanic acid are used as raw materials, lactonitrile is synthesized through alkaline catalysis, lactic acid is generated through distillation and purification and hydrolysis of concentrated acid, and finally products of different grades are obtained through esterification and refining. Acetaldehyde and hydrocyanic acid which are raw materials utilized by a chemical method have high toxicity, and a product is a mixture of D-lactic acid and L-lactic acid, so that the D-lactic acid is difficult to apply to the fields of foods, beverages and the like due to the metabolic problem of the D-lactic acid in a human body.

The microbial fermentation method has the advantages of low production cost, wide raw material source, high optical purity of the product and the like, and is a main method for industrially producing the lactic acid. The fermentation method uses strains such as lactobacillus, bacillus, rhizopus oryzae, etc. Although several studies have been made on the fermentation production of lactic acid from non-grain cheap raw materials such as cellulose, tapioca, molasses and jerusalem artichoke, corn starch is still the main raw material used in large-scale fermentation at present, thus leading to higher market price of L-lactic acid and limiting the wide application thereof in biodegradable materials and other fields.

Disclosure of Invention

The technical problem to be solved by the invention is how to utilize acetic acid, a potential bulk fermentation carbon source, to prepare L-lactic acid.

In order to solve the technical problems, the invention firstly provides a construction method of a recombinant bacterium, which comprises the following steps of carrying out A1-A14 transformation on a receptor bacterium to obtain the recombinant bacterium;

a1, knocking out pyruvate oxidase Gene (poxB Gene, GeneBank number: NC-000913.3, Gene ID: 946132) of the recipient bacterium, or inhibiting the expression of the poxB Gene or inhibiting the activity of a protein encoded by the poxB Gene;

a2, knocking out pyruvate formate lyase Gene (pflB Gene, GeneBank number: NC-000913.3, Gene ID: 945514) of the recipient bacterium, or inhibiting the expression of the pflB Gene or inhibiting the activity of a protein encoded by the pflB Gene;

a3, knocking out pyruvate dehydrogenase genes (aceE genes and aceF genes, which are marked as aceEF genes; aceE genes, GeneBank No.: NC-000913.3, Gene ID: 944834; aceF genes, GeneBank No.: NC-000913.3, Gene ID: 944794) of the recipient bacteria or inhibiting the expression of the aceEF genes or inhibiting the activity of proteins coded by the aceEF genes;

a4, knocking out the D-lactate dehydrogenase Gene (ldhA Gene, GeneBank No.: NC-000913.3, Gene ID: 946315) of the recipient bacterium, or inhibiting the expression of the ldhA Gene or inhibiting the activity of a protein encoded by the ldhA Gene;

a5, knocking out the L-lactate dehydrogenase Gene (lldD Gene, GeneBank number: NC-000913.3, Gene ID: 948121) of the recipient bacterium, or inhibiting the expression of the lldD Gene or inhibiting the activity of the protein encoded by the lldD Gene;

a6, increasing the content of or enhancing the activity of a protein encoded by an acetyl-CoA synthetase gene (acs gene) in the recipient bacterium;

a7, increasing the content of protein coded by phosphotransacetylase gene (pta gene) in the recipient bacterium or enhancing the activity of the protein coded by the pta gene;

a8, increasing the content of or enhancing the activity of a protein encoded by the acetate kinase gene (ackA gene) in the recipient bacterium;

a9, increasing the content of protein encoded by isocitrate lyase gene (aceA gene) in the recipient bacterium or enhancing the activity of protein encoded by the aceA gene;

a10, increasing the content of protein coded by isocitrate dehydrogenase kinase/phosphatase gene (aceK gene) in the recipient strain or enhancing the activity of protein coded by the aceK gene;

a11, increasing the content of protein coded by malic acid synthase gene (aceB gene) in the recipient bacterium or enhancing the activity of protein coded by aceB gene;

a12, increasing the content of or enhancing the activity of protein encoded by the maeA gene of the NAD-dependent malic enzyme gene in the recipient bacterium;

a13, increasing the content of or enhancing the activity of protein encoded by the maeB gene of the NADP-dependent malate gene in the recipient bacterium;

a14, increasing the content of protein coded by L-lactate dehydrogenase gene (ldh2 gene) in the recipient bacterium or enhancing the activity of protein coded by ldh2 gene;

the recipient bacterium is a bacterium or fungus containing the poxB gene, the pflB gene, the aceEF gene, the ldhA gene, and the lldD gene.

In the above method, the recipient bacterium may be 1) or 2):

1) e.coli;

2) escherichia coli MG 1655.

In the above method, the acs gene-encoding protein is a protein of a1) or a2) below:

a1) protein shown as a sequence 12 in a sequence table;

a2) the protein which is obtained by substituting and/or deleting and/or adding one or more amino acid residues to the amino acid sequence of the sequence 12 in the sequence table and has the same function;

and/or, the protein coded by the ackA gene is the protein of the following b1) or b 2):

b1) protein shown as a sequence 13 in a sequence table;

b2) protein which is obtained by substituting and/or deleting and/or adding one or more amino acid residues to the amino acid sequence of the sequence 13 in the sequence table and has the same function;

and/or, the pta gene encoding protein is the protein of c1) or c 2):

c1) protein shown as a sequence 14 in a sequence table;

c2) the protein which is obtained by substituting and/or deleting and/or adding one or more amino acid residues to the amino acid sequence of the sequence 14 in the sequence table and has the same function;

and/or, the aceA gene encodes a protein of d1) or d2) below:

d1) protein shown as a sequence 15 in a sequence table;

d2) the protein which is obtained by substituting and/or deleting and/or adding one or more amino acid residues to the amino acid sequence of the sequence 15 in the sequence table and has the same function;

and/or, the aceK gene encoding protein is the protein of e1) or e 2):

e1) protein shown as a sequence 16 in a sequence table;

e2) the protein which is obtained by substituting and/or deleting and/or adding one or more amino acid residues to the amino acid sequence of the sequence 16 in the sequence table and has the same function;

and/or, the aceB gene encodes a protein of the following f1) or f 2):

f1) protein shown as a sequence 17 in a sequence table;

f2) the protein which is obtained by substituting and/or deleting and/or adding one or more amino acid residues to the amino acid sequence of the sequence 17 in the sequence table and has the same function;

and/or, the maeA gene encodes protein of the following g1) or g 2):

g1) protein shown as a sequence 18 in a sequence table;

g2) the protein which is obtained by substituting and/or deleting and/or adding one or more amino acid residues to the amino acid sequence of the sequence 18 in the sequence table and has the same function;

and/or, the maeB gene encodes protein of h1) or h2) as follows:

h1) protein shown as a sequence 19 in a sequence table;

h2) the protein which is obtained by substituting and/or deleting and/or adding one or more amino acid residues to the amino acid sequence of the sequence 19 in the sequence table and has the same function;

and/or, the protein coded by the ldh2 gene is the protein of the following i1) or i 2):

i1) protein shown as a sequence 20 in a sequence table;

i2) and (b) the protein which is obtained by substituting and/or deleting and/or adding one or more amino acid residues in the amino acid sequence of the sequence 20 in the sequence table and has the same function.

In the above method, the substitution and/or deletion and/or addition of one or more amino acid residues may be a substitution and/or deletion and/or addition of 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 amino acid residues.

In the above method, A1 is obtained by introducing a DNA fragment containing the homology arms at the upstream and downstream of the poxB gene into the recipient bacterium;

and/or, A2 is realized by introducing a DNA fragment containing homologous arms at the upstream and the downstream of the pflB gene into the recipient bacterium;

and/or, A3 is realized by introducing a DNA fragment containing the upstream and downstream homology arms of the aceEF gene into the recipient bacterium;

and/or A4 is realized by introducing a DNA fragment containing the upstream and downstream homology arms of the ldhA gene into the recipient bacterium;

and/or, A5 is realized by introducing a DNA fragment containing the upstream and downstream homology arms of the lldD gene into the recipient bacterium;

and/or, A6 is realized by introducing acs gene expression box containing the acs gene into the recipient bacterium;

and/or, A7 is realized by introducing a pta gene expression cassette containing the pta gene into the recipient bacterium;

and/or A8 is achieved by introducing into the recipient bacterium an ackA gene expression cassette comprising the ackA gene;

and/or, A9 is realized by introducing an aceA gene expression cassette containing the aceA gene into the recipient bacterium;

and/or, A10 is realized by introducing an aceK gene expression cassette containing the aceK gene into the recipient bacterium;

and/or, A11 is realized by introducing an aceB gene expression cassette containing the aceB gene into the recipient bacterium;

and/or, A12 is realized by introducing a maeA gene expression cassette containing the maeA gene into the recipient bacterium;

and/or, A13 is realized by introducing a maeB gene expression cassette containing the maeB gene into the recipient bacterium;

and/or A14 is achieved by introducing into the recipient bacterium an ldh2 gene expression cassette comprising the ldh2 gene.

The introduction of each expression cassette into the recipient bacterium can be effected by introducing an expression vector containing the corresponding expression cassette into the recipient bacterium.

The expression vector may be a plasmid, cosmid, phage, or viral vector. The plasmid can be pBBR1MCS-2 or pUC 19.

In the above method, the knockout of each gene can be achieved by a lambda-red homologous recombination.

In the method, the DNA fragment containing the upstream and downstream homology arms of the poxB gene is a DNA molecule shown as a sequence 8 in a sequence table;

the DNA fragment containing upstream and downstream homology arms of the pflB gene is a DNA molecule shown as a sequence 9 in a sequence table;

the DNA fragment containing the upstream and downstream homology arms of the aceEF gene is a DNA molecule shown as a sequence 7 in a sequence table;

the DNA fragment containing the upstream and downstream homologous arms of the ldhA gene is a DNA molecule shown as a sequence 10 in a sequence table;

the DNA fragment containing the upstream and downstream homology arms of the lldD gene is a DNA molecule shown as a sequence 11 in a sequence table;

and/or the promoters in the acs gene expression cassette, the pta gene expression cassette, the ackA gene expression cassette, the aceA gene expression cassette, the aceK gene expression cassette, the aceB gene expression cassette, the maeA gene expression cassette, the maeB gene expression cassette and the ldh2 gene expression cassette are the following j1) or j 2):

j1) DNA molecules shown in 9 th to 51 th sites of a sequence 1 in a sequence table;

j2) a DNA molecule having 75% or more identity to the nucleotide sequence defined in j1) and having a promoter function;

and/or, the acs gene in the acs gene expression cassette is k1) or k 2):

k1) a DNA molecule shown in 70 th-2028 th site of a sequence 1 in a sequence table;

k2) a DNA molecule which has 75 percent or more than 75 percent of identity with the nucleotide sequence defined by k1) and has the same function;

and/or, the pta gene in the pta gene expression cassette is l1) or l2) as follows:

l1) DNA molecule shown in the 1347-3491 position of the sequence 2 in the sequence table;

l2) and l1) have identity of 75 percent or more than 75 percent and have the same function;

and/or, the ackA gene in the ackA gene expression cassette is m1) or m2) as follows:

m1) DNA molecule shown in the 70 th-1272 th site of the sequence 2 in the sequence table;

m2) and m1) are identical with each other by 75 percent or more than 75 percent, and have the same function;

and/or, the aceA gene in the aceA gene expression cassette is n1) or n2) as follows:

n1) in the sequence table, as shown in the 70 th to 1374 th sites of the sequence 3;

n2) and n1) have 75 percent of identity or more than 75 percent of identity, and have the same function;

and/or, the aceK gene in the aceK gene expression cassette is o1) or o2) as follows:

o1) DNA molecule shown in the 1436-3172 position of the sequence 3 in the sequence table;

o2) and o1) have 75 percent or more than 75 percent of identity and have the same function;

and/or, the aceB gene in the aceB gene expression cassette is p1) or p2) as follows:

p1) DNA molecule shown in 70 th-1671 th site of sequence 4 in the sequence table;

p2) and p1) have 75 percent or more than 75 percent of identity and have the same function;

and/or, the maeA gene in the maeA gene expression cassette is q1) or q2) as follows:

q1) DNA molecule shown in 70 th-1767 th site of sequence 5 in the sequence table;

q2) and q1) have 75 percent or more identity and have the same function;

and/or, the maeB gene in the maeB gene expression cassette is r1) or r2) as follows:

r1) DNA molecule shown in 1791-4070 position of sequence 5 in the sequence table;

r2) and r1) have identity of 75 percent or more than 75 percent and have the same function;

and/or, the ldh2 gene in the ldh2 gene expression cassette is s1) or s2) as follows:

s1) DNA molecule shown in 70 th-1050 th position of sequence 6 in the sequence table;

s2) and s1) have identity of 75 percent or more than 75 percent of the nucleotide sequence and have the same function;

in the above methods, the 75% or greater than 75% identity may be 80%, 85%, 90%, or 95% or greater identity.

In the method, the acs gene expression cassette is a DNA molecule shown in 9 th-2028 th sites of a sequence 1 in a sequence table;

the pta gene expression cassette and the ackA gene expression cassette are DNA molecules shown in 9 th-3491 th sites of a sequence 2 in the sequence;

the aceA gene expression cassette and the aceK gene expression cassette are DNA molecules shown in the 9 th-3172 th site of a sequence 3 in a sequence table;

the aceB gene expression cassette is a DNA molecule shown in the 9 th-1671 th site of a sequence 4 in a sequence table;

the maeA gene expression cassette and the maeB gene expression cassette are DNA molecules shown in 9 th-4070 th sites of a sequence 5 in a sequence table;

the ldh2 gene expression cassette is a DNA molecule shown in the 9 th-1050 th site of a sequence 6 in a sequence table.

The invention also provides a recombinant bacterium prepared by the method.

The invention also provides a kit reagent, which consists of the DNA fragment containing the upstream and downstream homology arms of the poxB gene, the DNA fragment containing the upstream and downstream homology arms of the pflB gene, the DNA fragment containing the upstream and downstream homology arms of the aceEF gene, the DNA fragment containing the upstream and downstream homology arms of the ldhA gene, the DNA fragment containing the upstream and downstream homology arms of the lldD gene, the acs gene expression cassette, the pta gene expression cassette, the ackA gene expression cassette, the aceA gene expression cassette, the aceK gene expression cassette, the aceB gene expression cassette, the maeA gene expression cassette, the maeB gene expression cassette and the ldh2 gene expression cassette.

The kit can be used for producing L-lactic acid and/or degrading acetic acid.

The invention also provides any one of the following applications of the kit or the recombinant bacterium:

x1, producing L-lactic acid;

x2, preparing and producing an L-lactic acid product;

x3, degrading acetic acid;

and X4, and preparing a degraded acetic acid product.

The invention also provides a preparation method of the L-lactic acid, which comprises the following steps: and (3) taking acetic acid as a carbon source, and carrying out biotransformation by using the recombinant bacteria to prepare the L-lactic acid.

Wherein the biotransformation is carried out in MM liquid medium.

The composition of the MM liquid medium is as follows: the culture medium contains 8g acetic acid and 2g NH per liter₄Cl、5g(NH₄)₂SO₄、6g KH₂PO₄8g of 3-morpholine propanesulfonic acid, 0.5g of NaCl, 1mL of trace element solution and the balance of water.

The composition of the trace element solution is as follows: the solution of trace elements contains 3.6g FeCl per liter₂·4H₂O、5g CaCl₂·2H₂O、1.3g MnCl₂·2H₂O、0.38g CuCl₂·2H₂O、0.5g CoCl₂·6H₂O、0.94g ZnCl₂、0.03g H₃BO₃、0.4g Na₂EDTA·2H₂O, 1g of thiamine-HCl, the remainder being 0.5M HCl.

The conditions under which the bioconversion is carried out may be: shake culturing at 30-37 deg.C for 24-72h (e.g. 37 deg.C, 48 h). The rotation speed of the shake flask can be 50-200 rpm.

The invention has the beneficial effects that: according to the invention, 9 genes related to metabolic pathways are expressed in escherichia coli, 6 endogenous genes are knocked out, an engineering strain capable of obtaining L-lactic acid by fermentation with acetic acid as a carbon source is obtained, the yield of the L-lactic acid of the recombinant strain in shake flask culture can reach a higher level, the use of carbon sources such as glucose is avoided, the reduction of the raw material cost of L-lactic acid fermentation is facilitated, and the application prospect is better.

Drawings

FIG. 1 is a vector map of pMCS-LA 1.

FIG. 2 is a vector map of pMCS-LA 2.

FIG. 3 is a map of pUC19-LA1 vector.

FIG. 4 is a map of pUC19-LA2 vector.

FIG. 5 is a map of pUC19-LA3 vector.

FIG. 6 is a map of pUC19-LA4 vector.

FIG. 7 is a map of pUC19-LA24 vector.

Detailed Description

The present invention is described in further detail below with reference to specific embodiments, and the examples are given only for illustrating the present invention and not for limiting the scope of the present invention. The experimental procedures in the following examples are conventional unless otherwise specified. Materials, reagents, instruments and the like used in the following examples are commercially available unless otherwise specified. The quantitative tests in the following examples, all set up three replicates and the results averaged. In the following examples, unless otherwise specified, the 1 st position of each nucleotide sequence in the sequence listing is the 5 'terminal nucleotide of the corresponding DNA, and the last position is the 3' terminal nucleotide of the corresponding DNA.

The enzymes used in the following examples relating to molecular biological manipulations are all NEB (New England Biolabs, http:// www.neb-china. com /) products; the kits used for plasmid extraction and DNA fragment recovery are all products of the Beijing Bomaide Gene technology Co., Ltd (http:// www.biomed168.com /); the DNA synthesis and sequencing work described in the examples was carried out by Beijing Bomaide Gene technology, Inc.

Coli MG 1655: derived from E.coli Genetic Resources at Yale CGSC, The Coli Genetic Stock Center (http:// CGSC2.biology. Yale. edu /), numbered CGSC # 6300.

Coli NEB 5-alpha: from NEB (New England Biolabs), cat # C2987I.

Plasmid pKD 13: from E.coli Genetic Resources at Yale CGSC, The Coli Genetic Stock Center, accession number CGSC # 7633.

Plasmid pKD 46: derived from E.coli Genetic Resources at Yale CGSC, The Coli Genetic Stock Center, accession number CGSC # 7739.

Plasmid pCP 20: from E.coli Genetic Resources at Yale CGSC, The Coli Genetic Stock Center, accession number CGSC # 7637.

Plasmid pBBR1 MCS-2: publicly available from the self-submitting Gene Synthesis corporation according to the sequence of NCBI access number U23751.1, the plasmid is described in the following references: four new derivatives of the broad-host-range cloning vector pBBR1MCS, and a airborne differential anti-genetic-resistance cassettes,1995, Gene,166: 175-.

Plasmid pUC 19: from NEB (New England Biolabs) under the designation N3041S.

The composition of the MM liquid medium was as follows: the culture medium contains 8g acetic acid and 2g NH per liter₄Cl、5g(NH₄)₂SO₄、6g KH₂PO₄8g of 3-morpholine propanesulfonic acid, 0.5g of NaCl, 1mL of trace element solution and the balance of water.

The composition of the trace element solution was as follows: the solution of trace elements contains 3.6g FeCl per liter₂·4H₂O、5g CaCl₂·2H₂O、1.3g MnCl₂·2H₂O、0.38g CuCl₂·2H₂O、0.5g CoCl₂·6H₂O、0.94g ZnCl₂、0.03g H₃BO₃、0.4g Na₂EDTA·2H₂O, 1g of thiamine-HCl, the remainder being 0.5M HCl.

Example 1 construction of recombinant bacterium E.coli LA5(pMCS-LA2+ pUC19-LA4)

Construction of recombinant expression vectors pMCS2-LA1 and pMCS2-LA2

1. The DNA shown in sequence 1 in the sequence table is artificially synthesized, and contains an acs expression cassette, wherein the upstream is a SacI site, the downstream is an XbaI site, the 9 th to 51 th nucleotides are promoter sequences, and the 70 th to 2028 th nucleotides are acs gene sequences.

2. The DNA shown in the sequence 2 in the sequence table is artificially synthesized, and contains an ackA and pta expression cassette, wherein the upstream is an XbaI site, the downstream is an EcoRI site, the 9 th to 51 th nucleotides are promoter sequences, the 70 th to 1272 th nucleotides are ackA gene sequences, and the 1347 th and 3491 th nucleotides are pta gene sequences.

3. Using SacI and XbaI to double-digest the DNA sequence synthesized in the sequence 1, and recovering a DNA fragment with the size of about 2022 bp; the plasmid pBBR1MCS-2 is digested by SacI and XbaI, and a DNA fragment with the size of about 5124bp is recovered; the two DNA fragments of about 2022bp and 5124bp were ligated to obtain a ligation product, which was introduced into E.coli NEB5-alpha by chemical transformation, plated on LB solid medium containing kanamycin, and cultured at 37 ℃ for 16 hours to obtain a transformant. The plasmid of the transformant is extracted and verified by digestion with SacI and XbaI, the plasmids with the digestion product size of about 2022bp and 5124bp are positive plasmids, and the recombinant plasmid is named as a recombinant plasmid pMCS-LA 1. Sequencing the recombinant plasmid pMCS-LA1, and the result shows that: pMCS-LA1 is a recombinant plasmid obtained by replacing the DNA fragment between the SacI and XbaI recognition sequences of plasmid pBBR1MCS-2 with the acs expression cassette shown in positions 9-2028 of sequence 1 in the sequence table.

4. The DNA sequence synthesized in the sequence 2 is subjected to double digestion by XbaI and EcoRI, and a DNA fragment with the size of about 3489bp is recovered; the plasmid pMCS-LA1 was digested with XbaI and EcoRI, and the DNA molecule of 7116bp was recovered; the two DNA fragments of about 3489bp and 7116bp were ligated to each other to obtain a ligated product, which was introduced into E.coli NEB5-alpha by chemical transformation, plated on LB solid medium containing kanamycin, and cultured at 37 ℃ for 16 hours to obtain a transformant. The plasmid of the transformant was extracted and verified by digestion with XbaI and EcoRI, and the plasmid with the digestion product size of about 3489bp and 7116bp was designated as a positive plasmid, and this recombinant plasmid was designated as recombinant plasmid pMCS-LA 2. The recombinant plasmid pMCS-LA2 was sequenced, and the results showed that: pMCS-LA2 is a recombinant plasmid obtained by replacing the DNA fragment between the XbaI and EcoRI recognition sequences of plasmid pMCS-LA1 with the ackA and pta expression cassettes shown at positions 9-3491 of sequence 2 in the sequence table.

Secondly, construction of recombinant expression vectors pUC19-LA1 and pUC19-LA2

1. The DNA shown in the sequence 3 in the sequence table is artificially synthesized, and contains an aceA expression cassette and an aceK expression cassette, wherein the upstream is a SacI site, and the downstream is a SpeI site and a KpnI site, wherein the 9 th to 51 th nucleotides are promoter sequences, the 70 th to 1374 th nucleotides are aceA gene sequences, and the 1436 th and 3172 th nucleotides are aceK gene sequences.

2. The DNA shown in sequence 4 in the sequence table is artificially synthesized, and contains an aceB expression cassette, wherein the upstream is a SpeI site, the downstream is an XhoI site and a KpnI site, the 9 th to 51 th nucleotides are promoter sequences, and the 70 th to 1671 th nucleotides are aceB gene sequences.

3. Digesting the DNA sequence synthesized in the step 1 by SacI and KpnI, and recovering a DNA fragment with the size of about 3179 bp; the plasmid pUC19 was digested with SacI and KpnI, and a DNA fragment of approximately 2680bp was recovered; the two DNA fragments of about 3179bp and 2680bp were ligated to obtain a ligated product, which was introduced into E.coli NEB5-alpha by chemical transformation, spread on LB solid medium containing ampicillin, and cultured at 37 ℃ for 16 hours to obtain a transformant. The plasmid of the transformant was extracted and verified by digestion with SacI and KpnI, and the plasmid with the digestion product size of 3179bp and 2680bp was designated as a positive plasmid, and this recombinant plasmid was named pUC19-LA 1. Sequencing verification is carried out on the obtained recombinant plasmid pUC19-LA1, and the result shows that: pUC19-LA1 is a recombinant plasmid obtained by replacing the DNA fragment between SacI and KpnI recognition sequences of plasmid pUC19 with the DNA sequence shown in the 9 th-3181 th position of the sequence 3 in the sequence table, and the recombinant plasmid contains aceA and aceK expression cassettes shown in the 9 th-3172 th position of the sequence 3.

4. Carrying out double enzyme digestion on the DNA sequence synthesized in the step 2 by using SpeI and KpnI, and recovering a DNA fragment with the size of about 1682 bp; the plasmid pUC19-LA1 was digested with SpeI and KpnI, and a DNA fragment of about 5846bp was recovered; the two DNA fragments of about 1682bp and 5846bp were ligated to each other to obtain a ligated product, which was introduced into E.coli NEB5-alpha by chemical transformation, plated on LB solid medium containing ampicillin, and cultured at 37 ℃ for 16 hours to obtain a transformant. The plasmid of the transformant was extracted, and verified by digestion with SpeI and KpnI, the plasmid having the digestion product sizes of about 1682bp and 5846bp was a positive plasmid, and the recombinant plasmid was designated as pUC19-LA 2. Sequencing verification is carried out on the obtained recombinant plasmid pUC19-LA2, and the result shows that: pUC19-LA2 is a recombinant plasmid obtained by replacing a DNA fragment between SpeI and KpnI recognition sequences of plasmid pUC19-LA1 with a DNA sequence shown in the 9 th-1680 th site of the sequence 4 in the sequence table, and the recombinant plasmid contains an aceB expression cassette shown in the 9 th-1671 th site of the sequence 4.

Thirdly, construction of recombinant expression vector pUC19-LA3

1. The DNA shown in sequence 5 in the sequence table is artificially synthesized, and contains a maeA and a maeB expression cassette, wherein the upstream is an XhoI site, and the downstream is a KpnI site, wherein, the 9 th to 51 th nucleotides are a promoter sequence, the 70 th to 1767 th nucleotides are a maeA gene sequence, and the 1791 st and 4070 th nucleotides are a maeB gene sequence.

2. The DNA sequence synthesized in the step 1 is subjected to double enzyme digestion by XhoI and KpnI, and a DNA fragment with the size of about 4072bp is recovered; the plasmid pUC19-LA2 was digested with XhoI and KpnI, and a DNA fragment of about 7515bp was recovered; the two DNA fragments of 4072bp and 7515bp were ligated to obtain a ligated product, which was introduced into E.coli NEB5-alpha by chemical transformation, spread on LB solid medium containing ampicillin, and cultured at 37 ℃ for 16 hours to obtain a transformant. The plasmid of the transformant was extracted, and the plasmid having the size of about 4072bp and 7515bp as a positive plasmid was confirmed by digestion with XhoI and KpnI, and the recombinant plasmid was named pUC19-LA 3. Sequencing verification is carried out on the obtained recombinant plasmid pUC19-LA3, and the result shows that: pUC19-LA3 is a recombinant plasmid obtained by replacing the DNA fragment between the recognition sequences XhoI and KpnI of plasmid pUC19-LA2 with the expression cassettes maeA and maeB shown in the 9 th-4070 th sites of sequence 5 in the sequence table.

Fourthly, construction of recombinant expression vector pUC19-LA4

1. The DNA shown in sequence 6 in the sequence table is artificially synthesized, and comprises an ldh2 expression cassette, wherein the upstream is a KpnI site, the downstream is an XbaI site, the 9 th to 51 th nucleotides are promoter sequences, and the 70 th to 1050 th nucleotides are ldh2 gene sequences.

2. The DNA sequence synthesized in the step 1 is subjected to double enzyme digestion by KpnI and XbaI, and a DNA fragment with the size of about 1044bp is recovered; the plasmid pUC19-LA3 was digested with KpnI and XbaI, and a DNA fragment of about 11576bp was recovered; the two DNA fragments of about 1044bp and 11576bp were ligated to obtain a ligated product, which was introduced into E.coli NEB5-alpha by chemical transformation, spread on LB solid medium containing ampicillin, and cultured at 37 ℃ for 16 hours to obtain a transformant. The plasmid of the transformant was extracted, and verified by digestion with KpnI and XbaI, the plasmids with the digestion product sizes of about 1044bp and 11576bp were positive plasmids, and the recombinant plasmid was designated as pUC19-LA 4. Sequencing verification is carried out on the obtained recombinant plasmid pUC19-LA4, and the result shows that: pUC19-LA4 is a recombinant plasmid obtained by replacing the DNA fragment between the KpnI and XbaI recognition sequences of plasmid pUC19-LA3 with the ldh2 expression cassette shown in the 9 th-1050 th positions of sequence 6 in the sequence list.

Fifthly, construction of recombinant expression vector pUC19-LA24

1. The DNA shown in sequence 6 in the sequence table is artificially synthesized, and comprises an ldh2 expression cassette, wherein the upstream is a KpnI site, the downstream is an XbaI site, the 9 th to 51 th nucleotides are promoter sequences, and the 70 th to 1050 th nucleotides are ldh2 gene sequences.

2. The DNA sequence synthesized in the step 1 is subjected to double enzyme digestion by KpnI and XbaI, and a DNA fragment with the size of about 1044bp is recovered; the plasmid pUC19-LA2 was digested with KpnI and XbaI, and a DNA fragment of about 7517bp was recovered; the two DNA fragments of 1044bp and 7517bp are connected to obtain a connection product, the connection product is introduced into E.coli NEB5-alpha by a chemical conversion method, and the connection product is spread on an LB solid culture medium containing ampicillin and cultured for 16h at 37 ℃ to obtain a transformant. The plasmid of the transformant was extracted, and verified by digestion with KpnI and XbaI, the plasmid having the cleavage products of about 1044bp and 7517bp was positive, and the recombinant plasmid was designated as pUC19-LA 24. Sequencing verification is carried out on the obtained recombinant plasmid pUC19-LA24, and the result shows that: pUC19-LA24 is a recombinant plasmid obtained by replacing the DNA fragment between KpnI and XbaI recognition sequences of plasmid pUC19-LA2 with ldh2 expression cassette shown in the 9 th-1050 th positions of sequence 6 in the sequence table.

Sixthly, construction of Escherichia coli E.coli LA5

1. Knock-out of poxB Gene

1) Primers poxBF and poxBR used for the poxB gene knockout were synthesized with the following sequences:

poxBF：

5’-ATGAAACAAACGGTTGCAGCTTATATCGCCAAAACACTCGAATCGGCAGGGGTGAAACGCGTGTAGGCTGGAGC TGCTTCG-3’；

poxBR：

5’-GGGCGTCGCGGTAATCTTCCAGCGCTTTATCCAGAAACTTGCGATCGGCTTTTTCTTCCAATTCCGGGGATCCG TCGACC-3’。

2) the plasmid pKD13 is used as a template, primers poxBF and poxBR are adopted to carry out PCR amplification to obtain a DNA fragment of about 1500bp, the DNA fragment is named as poxB homologous recombination fragment, and agarose gel electrophoresis is carried out to purify the obtained DNA fragment. Through sequencing, the nucleotide sequence of the poxB homologous recombination fragment is sequence 8, wherein the 1 st to 60 th sites are the upstream homologous arm of the poxB gene, the 61 st to 1364 th sites are the FRT sequence and the Kan resistance gene, and the 1365 th site 1424 th site is the downstream homologous arm of the poxB gene.

3) pKD46 was transformed into the recipient strain E.coli MG1655 by the electrotransformation method, spread on LB solid medium containing ampicillin, cultured at 30 ℃ for 24h to obtain transformants, and the plasmid was verified to obtain a recombinant strain containing pKD46, denoted as E.coli MG1655(pKD 46).

4) Inoculating e.coli MG1655(pKD46) into LB liquid medium containing ampicillin, culturing at 30 ℃ for 1h, adding arabinose to a final concentration of 5g/L, continuing culturing for 1.5h, then preparing competent cells of e.coli MG1655(pKD46), transferring the DNA fragment obtained in step 2) into competent cells of e.coli MG1655(pKD46), spreading on LB solid medium containing kanamycin, and culturing at 37 ℃ for 24h to obtain transformants.

5) PCR was performed using poxBF and poxBR as primers by colony PCR, PCR products were purified and then sequenced, and clones were screened in which the correct poxB gene had been replaced with a Kan resistance gene, and were designated e.coli MG1655poxB-K (pKD 46).

6) Inoculating E.coli MG1655poxB-K (pKD46) into LB liquid culture medium, culturing at 42 ℃ for three times, removing pKD46 plasmid to obtain E.coli MG1655 poxB-K; coli MG1655poxB-K is e.coli MG1655 with the poxB gene replaced by Kan gene.

7) E.coli MG1655poxB-K was inoculated into LB liquid medium containing kanamycin, cultured at 37 ℃ for 24 hours, transferred into LB liquid medium containing kanamycin, cultured at 37 ℃ for 3 hours, and E.coli MG1655poxB-K competent cells were prepared.

8) The plasmid pCP20 was transformed into E.coli MG1655poxB-K competent cells by the electrotransformation method, plated on LB solid medium containing ampicillin and chloramphenicol, and cultured at 30 ℃ for 48 hours to obtain transformants. Transformants were verified by colony PCR using poxBF and poxBR as primers to obtain positive clones with a 202bp fragment. The positive clone was subjected to sequencing, which was a bacterium obtained by knocking out poxB gene on E.coli MG1655 genome, and the bacterium was inoculated into LB liquid medium, passaged three times at 42 ℃, pCP20 was removed, and the obtained strain was named mutant E.coli LA 1.

2. Knock-out of pflB Gene

Basically the same as the method of step 1 above, except that:

the pflB gene knockout primer sequences are as follows:

pflBF：

5’-

ATGTCCGAGCTTAATGAAAAGTTAGCCACAGCCTGGGAAGGTTTTACCAAAGGTGACTGGGTGTAGGCTGGAGCTGCTTCG-3’；

pflBR：

5’

-TTACATAGATTGAGTGAAGGTACGAGTAATAACGTCCTGCTGCTGTTCTTTAGTCAGCGAATTCCGGGGATCCGTCGACC-3’；

the nucleotide sequence of the pflB homologous recombination fragment obtained by using the pflB gene knockout primer is a sequence 9, wherein the 1 st to 60 th sites are an upstream homologous arm of the pflB gene, the 61 st to 1364 th sites are an FRT sequence and a Kan resistance gene, and the 1365 th and 1424 th sites are a downstream homologous arm of the pflB gene. Coli LA1, the recipient strain used was the mutant obtained in step 1 above. Transformants are verified by a colony PCR method, and 202bp fragment positive clones are obtained by taking pflBF and pflBR as primers. The positive clone is sequenced, and is a bacterium obtained by knocking out pflB gene on an e.coli LA1 genome, the bacterium is inoculated into an LB liquid culture medium, passage is carried out for three times at 42 ℃, pCP20 is removed, and the obtained strain is named as a mutant e.coli LA 2.

3. Knock-out of aceEF Gene

Basically the same as the method of step 1 above, except that:

the aceEF gene knockout primer sequence is as follows:

aceEFF：

5’-ATGTCAGAACGTTTCCCAAATGACGTGGATCCGATCGAAACTCGCGACTGGCTCCAGGCGGTGTAGGCTGGA GCTGCTTCG-3’；

aceEFR：

5’-TTACATCACCAGACGGCGAATGTCAGACAGCGTGTTGTTAATGATGGTAATGAAACGGGCATTCCGGGGATC CGTCGACC-3’；

the nucleotide sequence of the aceEF homologous recombination fragment obtained by using the aceEF gene knockout primer is a sequence 7, wherein the 1 st to 60 th sites are the upstream homologous arm of the aceEF gene, the 61 st to 1364 th sites are an FRT sequence and a Kan resistance gene, and the 1365 th site 1424 th site is the downstream homologous arm of the aceEF gene. Coli LA2 obtained as a mutant in step 2 above. Transformants were verified by colony PCR using aceEFF and aceEFR primers to obtain 202bp fragment positive clones. The positive clone is sent to sequencing, and is a bacterium obtained by knocking out aceEF gene on E.coli LA2 genome, the bacterium is inoculated into LB liquid culture medium, passage is carried out for three times at 42 ℃, pCP20 is removed, and the obtained strain is named as mutant E.coli LA 3.

4. Knock-out of ldhA Gene

Basically the same as the method of step 1 above, except that:

the ldhA gene knockout primer sequence is as follows:

ldhAF：

5’-

ATGAAACTCGCCGTTTATAGCACAAAACAGTACGACAAGAAGTACCTGCAACAGGTGAACGTGTAGGCTGGAGCTGCTTCG-3’；

ldhAR：

5’-

TTAAACCAGTTCGTTCGGGCAGGTTTCGCCTTTTTCCAGATTGCTTAAGTTTTGCAGCGTATTCCGGGGATCCGTCGACC-3’；

the nucleotide sequence of the ldhA homologous recombination fragment obtained by using the ldhA gene knockout primer is a sequence 10, wherein the 1 st to 60 th sites are the upstream homologous arm of the ldhA gene, the 61 st to 1364 th sites are an FRT sequence and a Kan resistance gene, and the 1365 th and 1424 th sites are the downstream homologous arms of the ldhA gene. Coli LA3, the mutant obtained in step 3 above. The transformants were verified by colony PCR, and 202bp fragment-positive clones were obtained using ldhAF and ldhAR as primers. This positive clone was subjected to sequencing, and was a strain obtained by knocking out the ldhA gene on the e.coli LA3 genome, and this strain was inoculated into LB liquid medium, passaged three times at 42 ℃, and pCP20 was removed, and the resulting strain was named mutant e.coli LA 4.

5. Knock-out of lldD Gene

Basically the same as the method of step 1 above, except that:

the sequence of the lldD gene knockout primer is as follows:

lldDF：

5’-

ATGATTATTTCCGCAGCCAGCGATTATCGCGCCGCAGCGCAACGCATTCTGCCGCCGTTCGTGTAGGCTGGAGCTGCTTCG-3’；

lldDR：

5’-

CTATGCCGCATTCCCTTTCGCCATGGGAGCCAGTGCCGCAGGCAACTCTTTACCCAGCCCATTCCGGGGATCCGTCGACC-3’；

the nucleotide sequence of the lldD homologous recombination fragment obtained by using the lldD gene knockout primer is a sequence 11, wherein the 1 st to 60 th sites are the upstream homologous arm of the lldD gene, the 61 st to 1364 th sites are an FRT sequence and a Kan resistance gene, and the 1365 th and the 1424 th sites are the downstream homologous arm of the lldD gene. Coli LA4, the mutant obtained in step 4 above. Transformants are verified by a colony PCR method, and 202bp fragment positive clones are obtained by taking lldDF and lldDR as primers. The positive clone was sequenced, which was a bacterium obtained by knocking out the lldD gene on the e.coli LA4 genome, and this bacterium was inoculated into LB liquid medium, passaged three times at 42 ℃, and pCP20 was removed, and the obtained strain was named mutant e.coli LA 5.

Seventhly, construction of recombinant bacterium E.coli LA5(pMCS-LA2+ pUC19-LA4)

1. And (3) transforming the recombinant plasmid pMCS-LA2 obtained in the first step and the recombinant plasmid pUC19-LA4 obtained in the fourth step into the escherichia coli E.coli LA5 obtained in the sixth step by an electrotransformation method, coating the escherichia coli E.coli LA5 on an LB solid medium containing ampicillin and kanamycin, and culturing the escherichia coli E.coli LA5 at 37 ℃ for 24 hours.

2. The single clones were picked up in LB liquid medium containing ampicillin and kanamycin and cultured at 37 ℃ for 24 hours.

3. Plasmids of the transformants were extracted, and the correctness of transformation was verified, and a recombinant strain containing two plasmids (pMCS-LA2 and pUC19-LA4) was designated as E.coli LA5(pMCS-LA2+ pUC19-LA 4).

Coli LA5(pMCS-LA2+ pUC19-LA4) is a recombinant bacterium that knocks out E.coli MG1655 chromosomal genes poxB, pflB, aceEF, ldhA, and lldD, and contains exogenous expression cassettes for genes acs, pta, ackA, aceA, aceK, aceB, maeA, maeB, and ldh 2.

Eighth, construction of control bacterium E.coli LA5(pUC19-LA4)

1. The recombinant plasmid pUC19-LA4 obtained in the fourth step was transformed into E.coli LA5 obtained in the sixth step by electrotransformation, spread on LB solid medium containing ampicillin, and cultured at 37 ℃ for 24 hours.

2. The single clone was picked up in LB liquid medium containing ampicillin and cultured at 37 ℃ for 24 hours.

3. The plasmid of the transformant was extracted, and the correctness of transformation was verified, whereby a recombinant strain containing plasmid pUC19-LA4 was designated as E.coli LA5(pUC19-LA 4).

Coli LA5(pUC19-LA4) is a recombinant bacterium that knocks out e.coli MG1655 chromosomal genes poxB, pflB, aceEF, ldhA, and lldD, and contains exogenous expression cassettes for genes aceA, aceK, aceB, maeA, maeB, and ldh 2.

Construction of control bacterium E.coli LA5(pUC19-LA24)

1. The recombinant plasmid pUC19-LA24 obtained in the fifth step was transformed into E.coli LA5 obtained in the sixth step by the electrotransformation method, spread on LB solid medium containing ampicillin, and cultured at 37 ℃ for 24 hours.

2. A single clone was picked up in LB liquid medium containing ampicillin and cultured at 37 ℃ for 24 hours.

3. Plasmids of transformants were extracted, and correctness of transformation was verified to obtain a recombinant strain containing plasmid pUC19-LA24 as E.coli LA5(pUC19-LA 24).

Coli LA5(pUC19-LA24) is a recombinant bacterium which knocks out E.coli MG1655 chromosomal genes poxB, pflB, aceEF, ldhA and lldD and contains exogenous expression cassettes for the genes aceA, aceK, aceB and ldh 2.

Example 2 application of recombinant bacterium E.coli LA5(pMCS-LA2+ pUC19-LA4) in L-lactic acid production

Shaking flask culture experiment of recombinant bacterium E.coli LA5(pMCS-LA2+ pUC19-LA4)

1. E.coli LA5(pMCS-LA2+ pUC19-LA4) prepared in step seven of example 1 was cultured in LB liquid medium containing ampicillin and kanamycin at 37 ℃ and 200rpm for 16 hours to prepare a seed solution.

2. Inoculating the seed solution into MM liquid culture medium containing ampicillin and kanamycin at an inoculation amount of 4% by volume, culturing in a 250ml shake flask with a liquid volume of 50ml at 37 ℃ and a rotation speed of 100rpm for 24h, and collecting the fermentation broth after culturing for 12h and 24h, respectively.

3. The L-lactic acid produced by the genetic engineering bacteria and the consumed acetic acid are quantitatively detected by high performance liquid chromatography. The specific conditions are as follows:

the instrument comprises the following steps: the Shimadzu corporation Essentia LC series HPLC instrument is equipped with a DGU-20A degasser, an LC-16 liquid pump, an SIL-16 type autosampler and an RID-20A detector.

Chromatographic conditions are as follows: Bio-Rad

HPX-87H (7.8X 300 mm); the flow rate is 0.50 mL/min; the column temperature is 55 ℃; the mobile phase was 7mM sulfuric acid in water.

The detection method comprises the following steps:

taking L-lactic acid standard aqueous solution (L-lactic acid, Sigma-Aldrich, product number L1875) with L-lactic acid concentrations of 0, 1, 2, 3, 4, 5g/L, filtering with 0.22 μm microporous membrane, injecting 10 μ L of sample, performing HPLC detection, and drawing standard curve with chromatographic peak areas of L-lactic acid standard solutions with different concentrations as ordinate and different concentrations as abscissa. Taking acetic acid standard substance aqueous solution (acetic acid, Sigma-Aldrich, product number A6283) with acetic acid concentration of 0, 2, 4, 6, 8 and 10g/L respectively, filtering with a 0.22 mu m microporous filter membrane, injecting 10 mu L of sample, carrying out HPLC detection, and drawing a standard curve by taking the chromatographic peak areas of the acetic acid standard solutions with different concentrations as ordinate and the concentrations of different substances as abscissa.

Taking 2mL fermentation liquid, firstly measuring the OD value of the bacterial liquid at 600nm by using an ultraviolet spectrophotometer, then centrifuging for 10min at 12000rpm, transferring the fermentation supernatant into a new centrifugal tube, filtering by using a 0.22 mu m microporous filter membrane, injecting 10 mu L of sample, and carrying out HPLC detection.

Substituting the chromatographic peak area of the L-lactic acid of the fermentation supernatant of the sample to be detected into the standard curve, and calculating to obtain the L-lactic acid content of the fermentation supernatant of the sample to be detected. Substituting the acetic acid chromatographic peak area of the fermentation supernatant of the sample to be tested into the standard curve, calculating to obtain the residual acetic acid content of the fermentation supernatant of the sample to be tested, and subtracting the residual acetic acid content in the fermentation supernatant from the initial acetic acid content after inoculation to obtain the acetic acid amount consumed by the recombinant bacteria.

Coli LA5(pMCS-LA2+ pUC19-LA4) L-lactic acid production and acetic acid consumption in shake flask culture are shown in Table 1:

coli LA5(pMCS-LA2+ pUC19-LA4) L-lactic acid production and acetic acid consumption

Note: the data in the table are the mean values obtained from three replicates.

As can be seen from the results in Table 1, the recombinant strain E.coli LA5(pMCS-LA2+ pUC19-LA4) constructed by the invention can be fermented in a culture medium with acetic acid as a carbon source to obtain L-lactic acid, and the final L-lactic acid yield is 2.46g/L, 0.40g/g and about 53% of the theoretical yield.

Second, shake flask culture experiment of control bacterium E.coli LA5(pUC19-LA4)

1. E.coli LA5(pUC19-LA4) prepared in step eight of example 1 was cultured in LB liquid medium containing ampicillin at 37 ℃ and 200rpm for 16 hours to prepare a seed solution.

2. Inoculating the seed solution into MM liquid culture medium containing ampicillin at an inoculum size of 4% by volume, adding 50ml of solution into a 250ml shake flask, culturing at 37 deg.C and 100rpm for 24h, and collecting the fermentation broth after culturing for 12h and 24h, respectively.

3. The L-lactic acid produced by the genetically engineered bacteria and the consumed acetic acid were quantitatively determined by high performance liquid chromatography, under the specific conditions described in step 3 of the above step one, the L-lactic acid yield and acetic acid consumption of E.coli LA5(pUC19-LA4) in shake flask culture are shown in Table 2:

TABLE 2L-lactic acid production and acetic acid consumption of E.coli LA5(pUC19-LA4)

Note: the data in the table are the mean values obtained from three replicates.

The control strain e.coli LA5(pUC19-LA4) did not overexpress the acetate utilization-related acs, pta, and ackA genes compared to e.coli LA5(pMCS-LA2+ pUC19-LA4), although the L-lactate yield and acetate consumption were lower relative to e.coli LA5(pMCS-LA2+ pUC19-LA4) despite the fact that e.coli LA5(pUC19-LA4) fermented for 24h gave 1.69 g/L. It can be seen that overexpression of the genes acs, pta and ackA plays an important role in increasing acetic acid utilization and L-lactic acid synthesis of bacteria.

Third, shake flask culture experiment of control bacterium E.coli LA5(pUC19-LA24)

1. E.coli LA5(pUC19-LA24) prepared in the ninth step of example 1 was cultured in LB liquid medium containing ampicillin at 37 ℃ and 200rpm for 16 hours to obtain a seed solution.

2. Inoculating the seed solution into MM liquid culture medium containing ampicillin at an inoculum size of 4% by volume, adding 50ml of solution into a 250ml shake flask, culturing at 37 deg.C and 100rpm for 24h, and collecting the fermentation broth after culturing for 12h and 24h, respectively.

3. The L-lactic acid produced by the genetically engineered bacteria and the consumed acetic acid were quantitatively determined by high performance liquid chromatography, under the specific conditions described in step 3 of the above step one, the L-lactic acid yield and acetic acid consumption of E.coli LA5(pUC19-LA24) in shake flask culture are shown in Table 3:

TABLE 3L-lactic acid production and acetic acid consumption of E.coli LA5(pUC19-LA24)

Note: the data in the table are the mean values obtained from three replicates. The control bacterium e.coli LA5(pUC19-LA24) did not overexpress the NAD-dependent malate genes maeA and NADP-dependent malate genes maeB, compared to e.coli LA5(pUC19-LA4), and could not accumulate L-lactic acid as a fermentation product, although the bacterium could consume acetic acid and grow. Therefore, the overexpression of the genes maeA and maeB can promote the overflow of malic acid metabolic flow in the tricarboxylic acid cycle to synthesize pyruvic acid, and then the pyruvic acid is synthesized by the catalysis of L-lactic acid dehydrogenase, and the genes maeA and maeB play a key role in the synthesis of L-lactic acid.

<110> Beijing university of chemical industry

<120> genetic engineering bacteria for producing L-lactic acid by using acetic acid and construction method and application thereof

<160> 20

<170> PatentIn version 3.5

<210> 1

<211> 2036

<212> DNA

<213> Artificial sequence

<400> 1

aagagctctt gacagctagc tcagtcctag gtataatgct agctactaga gaaagaggag 60

aaatatacca tgagccaaat tcacaaacac accattcctg ccaacatcgc agaccgttgc 120

ctgataaacc ctcagcagta cgaggcgatg tatcaacaat ctattaacgt acctgatacc 180

ttctggggcg aacagggaaa aattcttgac tggatcaaac cttaccagaa ggtgaaaaac 240

acctcctttg cccccggtaa tgtgtccatt aaatggtacg aggacggcac gctgaatctg 300

gcggcaaact gccttgaccg ccatctgcaa gaaaacggcg atcgtaccgc catcatctgg 360

gaaggcgacg acgccagcca gagcaaacat atcagctata aagagctgca ccgcgacgtc 420

tgccgcttcg ccaataccct gctcgagctg ggcattaaaa aaggtgatgt ggtggcgatt 480

tatatgccga tggtgccgga agccgcggtt gcgatgctgg cctgcgcccg cattggcgcg 540

gtgcattcgg tgattttcgg cggcttctcg ccggaagccg ttgccgggcg cattattgat 600

tccaactcac gactggtgat cacttccgac gaaggtgtgc gtgccgggcg cagtattccg 660

ctgaagaaaa acgttgatga cgcgctgaaa aacccgaacg tcaccagcgt agagcatgtg 720

gtggtactga agcgtactgg cgggaaaatt gactggcagg aagggcgcga cctgtggtgg 780

cacgacctgg ttgagcaagc gagcgatcag caccaggcgg aagagatgaa cgccgaagat 840

ccgctgttta ttctctacac ctccggttct accggtaagc caaaaggtgt gctgcatact 900

accggcggtt atctggtgta cgcggcgctg acctttaaat atgtctttga ttatcatccg 960

ggtgatatct actggtgcac cgccgatgtg ggctgggtga ccggacacag ttacttgctg 1020

tacggcccgc tggcctgcgg tgcgaccacg ctgatgtttg aaggcgtacc caactggccg 1080

acgcctgccc gtatggcgca ggtggtggac aagcatcagg tcaatattct ctataccgca 1140

cccacggcga tccgcgcgct gatggcggaa ggcgataaag cgatcgaagg caccgaccgt 1200

tcgtcgctgc gcattctcgg ttccgtgggc gagccaatta acccggaagc gtgggagtgg 1260

tactggaaaa aaatcggcaa cgagaaatgt ccggtggtcg atacctggtg gcagaccgaa 1320

accggcggtt tcatgatcac cccgctgcct ggcgctaccg agctgaaagc cggttcggca 1380

acacgtccgt tcttcggcgt gcaaccggcg ctggtcgata acgaaggtaa cccgctggag 1440

ggggccaccg aaggtagcct ggtaatcacc gactcctggc cgggtcaggc gcgtacgctg 1500

tttggcgatc acgaacgttt tgaacagacc tacttctcca ccttcaaaaa tatgtatttc 1560

agcggcgacg gcgcgcgtcg cgatgaagat ggctattact ggataaccgg gcgtgtggac 1620

gacgtgctga acgtctccgg tcaccgtctg gggacggcag agattgagtc ggcgctggtg 1680

gcgcatccga agattgccga agccgccgta gtaggtattc cgcacaatat taaaggtcag 1740

gcgatctacg cctacgtcac gcttaatcac ggggaggaac cgtcaccaga actgtacgca 1800

gaagtccgca actgggtgcg taaagagatt ggcccgctgg cgacgccaga cgtgctgcac 1860

tggaccgact ccctgcctaa aacccgctcc ggcaaaatta tgcgccgtat tctgcgcaaa 1920

attgcggcgg gcgataccag caacctgggc gatacctcga cgcttgccga tcctggcgta 1980

gtcgagaagc tgcttgaaga gaagcaggct atcgcgatgc catcgtaatc tagaaa 2036

<210> 2

<211> 3499

<212> DNA

<213> Artificial sequence

<400> 2

aatctagatt gacagctagc tcagtcctag gtataatgct agctactaga gaaagaggag 60

aaatatacca tgtcgagtaa gttagtactg gttctgaact gcggtagttc ttcactgaaa 120

tttgccatca tcgatgcagt aaatggtgaa gagtaccttt ctggtttagc cgaatgtttc 180

cacctgcccg aagcacgtat caaatggaaa atggacggca ataaacagga agcggcttta 240

ggtgcaggcg ccgctcacag cgaagcgctc aactttatcg ttaatactat tctggcacaa 300

aaaccagaac tgtctgcgca gctgactgct atcggtcacc gtatcgtaca cggcggcgaa 360

aagtatacca gctccgtagt gatcgatgag tctgttattc agggtatcaa agatgcagct 420

tcttttgcac cgctgcacaa cccggctcac ctgatcggta tcgaagaagc tctgaaatct 480

ttcccacagc tgaaagacaa aaacgttgct gtatttgaca ccgcgttcca ccagactatg 540

ccggaagagt cttacctcta cgccctgcct tacaacctgt acaaagagca cggcatccgt 600

cgttacggcg cgcacggcac cagccacttc tatgtaaccc aggaagcggc aaaaatgctg 660

aacaaaccgg tagaagaact gaacatcatc acctgccacc tgggcaacgg tggttccgtt 720

tctgctatcc gcaacggtaa atgcgttgac acctctatgg gcctgacccc gctggaaggt 780

ctggtcatgg gtacacgttc tggtgatatc gatccggcga tcatcttcca cctgcacgac 840

accctgggca tgagcgttga cgcaatcaac aaactgctga ccaaagagtc tggcctgctg 900

ggtctgaccg aagtgaccag cgactgccgc tatgttgaag acaactacgc gacgaaagaa 960

gacgcgaagc gcgcaatgga cgtttactgc caccgcctgg cgaaatacat cggtgcctac 1020

actgcgctga tggatggtcg tctggacgct gttgtattca ctggtggtat cggtgaaaat 1080

gccgcaatgg ttcgtgaact gtctctgggc aaactgggcg tgctgggctt tgaagttgat 1140

catgaacgca acctggctgc acgtttcggc aaatctggtt tcatcaacaa agaaggaacc 1200

cgtcctgcgg tggttatccc aaccaacgaa gaactggtta tcgcgcaaga cgcgagccgc 1260

ctgactgcct gatttcacac cgccagctca gctggcggtg ctgttttgta acccgccaaa 1320

tcggcggtaa cgaaagagga taaaccgtgt cccgtattat tatgctgatc cctaccggaa 1380

ccagcgtcgg tctgaccagc gtcagccttg gcgtgatccg tgcaatggaa cgcaaaggcg 1440

ttcgtctgag cgttttcaaa cctatcgctc agccgcgtac cggtggcgat gcgcccgatc 1500

agactacgac tatcgtgcgt gcgaactctt ccaccacgac ggccgctgaa ccgctgaaaa 1560

tgagctacgt tgaaggtctg ctttccagca atcagaaaga tgtgctgatg gaagagatcg 1620

tcgcaaacta ccacgctaac accaaagacg ctgaagtcgt tctggttgaa ggtctggtcc 1680

cgacacgtaa gcaccagttt gcccagtctc tgaactacga aatcgctaaa acgctgaatg 1740

cggaaatcgt cttcgttatg tctcagggca ctgacacccc ggaacagctg aaagagcgta 1800

tcgaactgac ccgcaacagc ttcggcggtg ccaaaaacac caacatcacc ggcgttatcg 1860

ttaacaaact gaacgcaccg gttgatgaac agggtcgtac tcgcccggat ctgtccgaga 1920

ttttcgacga ctcttccaaa gctaaagtaa acaatgttga tccggcgaag ctgcaagaat 1980

ccagcccgct gccggttctc ggcgctgtgc cgtggagctt tgacctgatc gcgactcgtg 2040

cgatcgatat ggctcgccac ctgaatgcga ccatcatcaa cgaaggcgac atcaatactc 2100

gccgcgttaa atccgtcact ttctgcgcac gcagcattcc gcacatgctg gagcacttcc 2160

gtgccggttc tctgctggtg acttccgcag accgtcctga cgtgctggtg gccgcttgcc 2220

tggcagccat gaacggcgta gaaatcggtg ccctgctgct gactggcggt tacgaaatgg 2280

acgcgcgcat ttctaaactg tgcgaacgtg ctttcgctac cggcctgccg gtatttatgg 2340

tgaacaccaa cacctggcag acctctctga gcctgcagag cttcaacctg gaagttccgg 2400

ttgacgatca cgaacgtatc gagaaagttc aggaatacgt tgctaactac atcaacgctg 2460

actggatcga atctctgact gccacttctg agcgcagccg tcgtctgtct ccgcctgcgt 2520

tccgttatca gctgactgaa cttgcgcgca aagcgggcaa acgtatcgta ctgccggaag 2580

gtgacgaacc gcgtaccgtt aaagcagccg ctatctgtgc tgaacgtggt atcgcaactt 2640

gcgtactgct gggtaatccg gcagagatca accgtgttgc agcgtctcag ggtgtagaac 2700

tgggtgcagg gattgaaatc gttgatccag aagtggttcg cgaaagctat gttggtcgtc 2760

tggtcgaact gcgtaagaac aaaggcatga ccgaaaccgt tgcccgcgaa cagctggaag 2820

acaacgtggt gctcggtacg ctgatgctgg aacaggatga agttgatggt ctggtttccg 2880

gtgctgttca cactaccgca aacaccatcc gtccgccgct gcagctgatc aaaactgcac 2940

cgggcagctc cctggtatct tccgtgttct tcatgctgct gccggaacag gtttacgttt 3000

acggtgactg tgcgatcaac ccggatccga ccgctgaaca gctggcagaa atcgcgattc 3060

agtccgctga ttccgctgcg gccttcggta tcgaaccgcg cgttgctatg ctctcctact 3120

ccaccggtac ttctggtgca ggtagcgacg tagaaaaagt tcgcgaagca actcgtctgg 3180

cgcaggaaaa acgtcctgac ctgatgatcg acggtccgct gcagtacgac gctgcggtaa 3240

tggctgacgt tgcgaaatcc aaagcgccga actctccggt tgcaggtcgc gctaccgtgt 3300

tcatcttccc ggatctgaac accggtaaca ccacctacaa agcggtacag cgttctgccg 3360

acctgatctc catcgggccg atgctgcagg gtatgcgcaa gccggttaac gacctgtccc 3420

gtggcgcact ggttgacgat atcgtctaca ccatcgcgct gactgcgatt cagtctgcac 3480

agcagcagta agaattctt 3499

<210> 3

<211> 3189

<212> DNA

<213> Artificial sequence

<400> 3

aagagctctt gacagctagc tcagtcctag gtataatgct agctactaga gaaagaggag 60

aaatatacca tgaaaacccg tacacaacaa attgaagaat tacagaaaga gtggactcaa 120

ccgcgttggg aaggcattac tcgcccatac agtgcggaag atgtggtgaa attacgcggt 180

tcagtcaatc ctgaatgcac gctggcgcaa ctgggcgcag cgaaaatgtg gcgtctgctg 240

cacggtgagt cgaaaaaagg ctacatcaac agcctcggcg cactgactgg cggtcaggcg 300

ctgcaacagg cgaaagcggg tattgaagca gtctatctgt cgggatggca ggtagcggcg 360

gacgctaacc tggcggccag catgtatccg gatcagtcgc tctatccggc aaactcggtg 420

ccagctgtgg tggagcggat caacaacacc ttccgtcgtg ccgatcagat ccaatggtcc 480

gcgggcattg agccgggcga tccgcgctat gtcgattact tcctgccgat cgttgccgat 540

gcggaagccg gttttggcgg tgtcctgaat gcctttgaac tgatgaaagc gatgattgaa 600

gccggtgcag cggcagttca cttcgaagat cagctggcgt cagtgaagaa atgcggtcac 660

atgggcggca aagttttagt gccaactcag gaagctattc agaaactggt cgcggcgcgt 720

ctggcagctg acgtgacggg cgttccaacc ctgctggttg cccgtaccga tgctgatgcg 780

gcggatctga tcacctccga ttgcgacccg tatgacagcg aatttattac cggcgagcgt 840

accagtgaag gcttcttccg tactcatgcg ggcattgagc aagcgatcag ccgtggcctg 900

gcgtatgcgc catatgctga cctggtctgg tgtgaaacct ccacgccgga tctggaactg 960

gcgcgtcgct ttgcacaagc tatccacgcg aaatatccgg gcaaactgct ggcttataac 1020

tgctcgccgt cgttcaactg gcagaaaaac ctcgacgaca aaactattgc cagcttccag 1080

cagcagctgt cggatatggg ctacaagttc cagttcatca ccctggcagg tatccacagc 1140

atgtggttca acatgtttga cctggcaaac gcctatgccc agggcgaggg tatgaagcac 1200

tacgttgaga aagtgcagca gccggaattt gccgccgcga aagatggcta taccttcgta 1260

tctcaccagc aggaagtggg tacaggttac ttcgataaag tgacgactat tattcagggc 1320

ggcacgtctt cagtcaccgc gctgaccggc tccactgaag aatcgcagtt ctaattgaca 1380

gctagctcag tcctaggtat aatgctagct actagagaaa gaggagaaat ataccatgcc 1440

gcgtggcctg gaattattga ttgctcaaac cattttgcaa ggcttcgatg ctcagtatgg 1500

tcgattcctc gaagtgacct ccggtgcgca gcagcgtttc gaacaggccg actggcatgc 1560

tgtccagcag gcgatgaaaa accgtatcca tctttacgat catcacgttg gtctggtcgt 1620

ggagcaactg cgctgcatta ctaacggcca aagtacggac gcggcatttt tactacgtgt 1680

taaagagcat tacacccggc tgttgccgga ttacccgcgc ttcgagattg cggagagctt 1740

ttttaactcc gtgtactgtc ggttatttga ccaccgctcg cttactcccg agcggctttt 1800

tatctttagc tctcagccag agcgccgctt tcgtaccatt ccccgcccgc tggcgaaaga 1860

ctttcacccc gatcacggct gggaatctct actgatgcgc gttatcagcg acctaccgct 1920

gcgcctgcgc tggcagaata aaagccgtga catccattac attattcgcc atctgacgga 1980

aacgctgggg acagacaacc tcgcggaaag tcatttacag gtggcgaacg aactgtttta 2040

ccgcaataaa gccgcctggc tggtaggcaa actgatcaca ccttccggca cattgccatt 2100

tttgctgccg atccaccaga cggacgacgg cgagttattt attgatacct gcctgacgac 2160

gaccgccgaa gcgagcattg tttttggctt tgcgcgttct tattttatgg tttatgcgcc 2220

gctgcccgca gcgctggtcg agtggctacg ggaaattctg ccaggtaaaa ccaccgctga 2280

attgtatatg gctatcggct gccagaagca cgccaaaacc gaaagctacc gcgaatatct 2340

cgtttatcta cagggctgta atgagcagtt cattgaagcg ccgggtattc gtggaatggt 2400

gatgttggtg tttacgctgc cgggctttga tcgggtattc aaagtcatca aagacaggtt 2460

cgcgccgcag aaagagatgt ctgccgctca cgttcgtgcc tgctatcaac tggtgaaaga 2520

gcacgatcgc gtgggccgaa tggcggacac ccaggagttt gaaaactttg tgctggagaa 2580

gcggcatatt tccccggcat taatggaatt actgcttcag gaagcagcgg aaaaaatcac 2640

cgatctcggc gaacaaattg tgattcgcca tctttatatt gagcggcgga tggtgccgct 2700

caatatctgg ctggaacaag tggaaggtca gcagttgcgc gacgccattg aagaatacgg 2760

taacgctatt cgccagcttg ccgctgctaa cattttccct ggcgacatgc tgtttaaaaa 2820

cttcggtgtc acccgtcacg ggcgtgtggt tttttatgat tacgatgaaa tttgctacat 2880

gacggaagtg aatttccgcg acatcccgcc gccgcgctat ccggaagacg aacttgccag 2940

cgaaccgtgg tacagcgtct cgccgggcga tgttttcccg gaagagtttc gccactggct 3000

atgcgccgac ccgcgtattg gtccgctgtt tgaagagatg cacgccgacc tgttccgcgc 3060

tgattactgg cgcgcactac aaaaccgcat acgtgaaggg catgtggaag atgtttatgc 3120

gtatcggcgc aggcaaagat ttagcgtacg gtatggggag atgctttttt gaactagtaa 3180

aggtaccaa 3189

<210> 4

<211> 1688

<212> DNA

<213> Artificial sequence

<400> 4

aaactagttt gacagctagc tcagtcctag gtataatgct agctactaga gaaagaggag 60

aaatatacca tgactgaaca ggcaacaaca accgatgaac tggctttcac aaggccgtat 120

ggcgagcagg agaagcaaat tcttactgcc gaagcggtag aatttctgac tgagctggtg 180

acgcatttta cgccacaacg caataaactt ctggcagcgc gcattcagca gcagcaagat 240

attgataacg gaacgttgcc tgattttatt tcggaaacag cttccattcg cgatgctgat 300

tggaaaattc gcgggattcc tgcggactta gaagaccgcc gcgtagagat aactggcccg 360

gtagagcgca agatggtgat caacgcgctc aacgccaatg tgaaagtctt tatggccgat 420

ttcgaagatt cactggcacc agactggaac aaagtgatcg acgggcaaat taacctgcgt 480

gatgcggtta acggcaccat cagttacacc aatgaagcag gcaaaattta ccagctcaag 540

cccaatccag cggttttgat ttgtcgggta cgcggtctgc acttgccgga aaaacatgtc 600

acctggcgtg gtgaggcaat ccccggcagc ctgtttgatt ttgcgctcta tttcttccac 660

aactatcagg cactgttggc aaagggcagt ggtccctatt tctatctgcc gaaaacccag 720

tcctggcagg aagcggcctg gtggagcgaa gtcttcagct atgcagaaga tcgctttaat 780

ctgccgcgcg gcaccatcaa ggcgacgttg ctgattgaaa cgctgcccgc cgtgttccag 840

atggatgaaa tccttcacgc gctgcgtgac catattgttg gtctgaactg cggtcgttgg 900

gattacatct tcagctatat caaaacgttg aaaaactatc ccgatcgcgt cctgccagac 960

agacaggcag tgacgatgga taaaccattc ctgaatgctt actcacgcct gttgattaaa 1020

acctgccata aacgcggtgc ttttgcgatg ggcggcatgg cggcgtttat tccgagcaaa 1080

gatgaagagc acaataacca ggtgctcaac aaagtaaaag cggataaatc gctggaagcc 1140

aataacggtc acgatggcac atggatcgct cacccaggcc ttgcggacac ggcaatggcg 1200

gtattcaacg acattctcgg ctcccgtaaa aatcagcttg aagtgatgcg cgaacaagac 1260

gcgccgatta ctgccgatca gctgctggca ccttgtgatg gtgaacgcac cgaagaaggt 1320

atgcgcgcca acattcgcgt ggctgtgcag tacatcgaag cgtggatctc tggcaacggc 1380

tgtgtgccga tttatggcct gatggaagat gcggcgacgg ctgaaatttc ccgtacctcg 1440

atctggcagt ggatccatca tcaaaaaacg ttgagcaatg gcaaaccggt gaccaaagcc 1500

ttgttccgcc agatgctggg cgaagagatg aaagtcattg ccagcgaact gggcgaagaa 1560

cgtttctccc aggggcgttt tgacgatgcc gcacgcttga tggaacagat caccacttcc 1620

gatgagttaa ttgatttcct gaccctgcca ggctaccgcc tgttagcgta actcgagaaa 1680

ggtaccaa 1688

<210> 5

<211> 4078

<212> DNA

<213> Artificial sequence

<400> 5

aactcgagtt gacagctagc tcagtcctag gtataatgct agctactaga gaaagaggag 60

aaatatacca tggaaccaaa aacaaaaaaa cagcgttcgc tttatatccc ttacgctggc 120

cctgtactgc tggaatttcc gttgttgaat aaaggcagtg ccttcagcat ggaagaacgc 180

cgtaacttca acctgctggg gttactgccg gaagtggtcg aaaccatcga agaacaagcg 240

gaacgagcat ggatccagta tcagggattc aaaaccgaaa tcgacaaaca catctacctg 300

cgtaacatcc aggacactaa cgaaaccctc ttctaccgtc tggtaaacaa tcatcttgat 360

gagatgatgc ctgttattta taccccaacc gtcggcgcag cctgtgagcg tttttctgag 420

atctaccgcc gttcacgcgg cgtgtttatc tcttaccaga accggcacaa tatggacgat 480

attctgcaaa acgtgccgaa ccataatatt aaagtgattg tggtgactga cggtgaacgc 540

attctggggc ttggtgacca gggcatcggc gggatgggca ttccgatcgg taaactgtcg 600

ctctataccg cctgtggcgg catcagcccg gcgtataccc ttccggtggt gctggatgtc 660

ggaacgaaca accaacagct gcttaacgat ccgctgtata tgggctggcg taatccgcgt 720

atcactgacg acgaatacta tgaattcgtt gatgaattta tccaggctgt gaaacaacgc 780

tggccagacg tgctgttgca gtttgaagac tttgctcaaa aaaatgcgat gccgttactt 840

aaccgctatc gcaatgaaat ttgttctttt aacgatgaca ttcagggcac tgcggcggta 900

acagtcggca cactgatcgc agcaagccgc gcggcaggtg gtcagttaag cgagaaaaaa 960

atcgtcttcc ttggcgcagg ttcagcggga tgcggcattg ccgaaatgat catctcccag 1020

acccagcgcg aaggattaag cgaggaagcg gcgcggcaga aagtctttat ggtcgatcgc 1080

tttggcttgc tgactgacaa gatgccgaac ctgctgcctt tccagaccaa actggtgcag 1140

aagcgcgaaa acctcagtga ctgggatacc gacagcgatg tgctgtcact gctggatgtg 1200

gtgcgcaatg taaaaccaga tattctgatt ggcgtctcag gacagaccgg gctgtttacg 1260

gaagagatca tccgtgagat gcataaacac tgtccgcgtc cgatcgtgat gccgctgtct 1320

aacccgacgt cacgcgtgga agccacaccg caggacatta tcgcctggac cgaaggtaac 1380

gcgctggtcg ccacgggcag cccgtttaat ccagtggtat ggaaagataa aatctaccct 1440

atcgcccagt gtaacaacgc ctttattttc ccgggcatcg gcctgggtgt tattgcttcc 1500

ggcgcgtcac gtatcaccga tgagatgctg atgtcggcaa gtgaaacgct ggcgcagtat 1560

tcaccattgg tgctgaacgg cgaaggtatg gtactgccgg aactgaaaga tattcagaaa 1620

gtctcccgcg caattgcgtt tgcggttggc aaaatggcgc agcagcaagg cgtggcggtg 1680

aaaacctctg ccgaagccct gcaacaggcc attgacgata atttctggca agccgaatac 1740

cgcgactacc gccgtacctc catctaatag agaaagagga gaaatatacc atggatgacc 1800

agttaaaaca aagtgcactt gatttccatg aatttccagt tccagggaaa atccaggttt 1860

ctccaaccaa gcctctggca acacagcgcg atctggcgct ggcctactca ccaggcgttg 1920

ccgcaccttg tcttgaaatc gaaaaagacc cgttaaaagc ctacaaatat accgcccgag 1980

gtaacctggt ggcggtgatc tctaacggta cggcggtgct ggggttaggc aacattggcg 2040

cgctggcagg caaaccggtg atggaaggca agggcgttct gtttaagaaa ttcgccggga 2100

ttgatgtatt tgacattgaa gttgacgaac tcgacccgga caaatttatt gaagttgtcg 2160

ccgcgctcga accaaccttc ggcggcatca acctcgaaga cattaaagcg ccagaatgtt 2220

tctatattga acagaaactg cgcgagcgga tgaatattcc ggtattccac gacgatcagc 2280

acggcacggc aattatcagc actgccgcca tcctcaacgg cttgcgcgtg gtggagaaaa 2340

acatctccga cgtgcggatg gtggtttccg gcgcgggtgc cgcagcaatc gcctgtatga 2400

acctgctggt agcgctgggt ctgcaaaaac ataacatcgt ggtttgcgat tcaaaaggcg 2460

ttatctatca gggccgtgag ccaaacatgg cggaaaccaa agccgcatat gcggtggtgg 2520

atgacggcaa acgtaccctc gatgatgtga ttgaaggcgc ggatattttc ctgggctgtt 2580

ccggcccgaa agtgctgacc caggaaatgg tgaagaaaat ggctcgtgcg ccaatgatcc 2640

tggcgctggc gaacccggaa ccggaaattc tgccgccgct ggcgaaagaa gtgcgtccgg 2700

atgccatcat ttgcaccggt cgttctgact atccgaacca ggtgaacaac gtcctgtgct 2760

tcccgttcat cttccgtggc gcgctggacg ttggcgcaac cgccatcaac gaagagatga 2820

aactggcggc ggtacgtgcg attgcagaac tcgcccatgc ggaacagagc gaagtggtgg 2880

cttcagcgta tggcgatcag gatctgagct ttggtccgga atacatcatt ccaaaaccgt 2940

ttgatccgcg cttgatcgtt aagatcgctc ctgcggtcgc taaagccgcg atggagtcgg 3000

gcgtggcgac tcgtccgatt gctgatttcg acgtctacat cgacaagctg actgagttcg 3060

tttacaaaac caacctgttt atgaagccga ttttctccca ggctcgcaaa gcgccgaagc 3120

gcgttgttct gccggaaggg gaagaggcgc gcgttctgca tgccactcag gaactggtaa 3180

cgctgggact ggcgaaaccg atccttatcg gtcgtccgaa cgtgatcgaa atgcgcattc 3240

agaaactggg cttgcagatc aaagcgggcg ttgattttga gatcgtcaat aacgaatccg 3300

atccgcgctt taaagagtac tggaccgaat acttccagat catgaagcgt cgcggcgtca 3360

ctcaggaaca ggcgcagcgg gcgctgatca gtaacccgac agtgatcggc gcgatcatgg 3420

ttcagcgtgg ggaagccgat gcaatgattt gcggtacggt gggtgattat catgaacatt 3480

ttagcgtggt gaaaaatgtc tttggttatc gcgatggcgt tcacaccgca ggtgccatga 3540

acgcgctgct gctgccgagt ggtaacacct ttattgccga tacatatgtt aatgatgaac 3600

cggatgcaga agagctggcg gagatcacct tgatggcggc agaaactgtc cgtcgttttg 3660

gtattgagcc gcgcgttgct ttgttgtcgc actccaactt tggttcttct gactgcccgt 3720

cgtcgagcaa aatgcgtcag gcgctggaac tggtcaggga acgtgcacca gaactgatga 3780

ttgatggtga aatgcacggc gatgcagcgc tggtggaagc gattcgcaac gaccgtatgc 3840

cggacagctc tttgaaaggt tccgccaata ttctggtgat gccgaacatg gaagctgccc 3900

gcattagtta caacttactg cgtgtttcca gctcggaagg tgtgactgtc ggcccggtgc 3960

tgatgggtgt ggcgaaaccg gttcacgtgt taacgccgat cgcatcggtg cgtcgtatcg 4020

tcaacatggt ggcgctggcc gtggtagaag cgcaaaccca accgctgtaa ggtaccaa 4078

<210> 6

<211> 1058

<212> DNA

<213> Artificial sequence

<400> 6

aaggtacctt gacagctagc tcagtcctag gtataatgct agctactaga gaaagaggag 60

aaatatacca tggcaagtat tacggataag gatcaccaaa aagttattct cgttggtgat 120

ggcgccgttg gttcaagcta tgcctatgca atggttttgc aaggtatcgc tcaagaaatc 180

gggattgttg acattttcaa ggacaagacg aaaggtgacg caattgattt aagcaacgcg 240

ctcccattca ccagtcctaa gaagatttat tctgctgaat acagcgatgc caaggatgct 300

gatctggttg ttatcactgc tggtgctcct caaaagcctg gcgaaactcg cttggatctg 360

gttaacaaga acttgaagat tttgaagtcc attgttgatc cgatcgtgga ttctggcttt 420

aacggtatct tcttggttgc tgctaaccca gttgatatct tgacttatgc tacttggaag 480

ctttccggat tcccgaagag ccgggttgtt ggttcaggta cttctctgga caccgctcgt 540

ttccgtcaat ccattgctga aatggttaac gttgatgctc gttccgtcca cgcatatatc 600

atgggtgaac acggcgacac agaattccct gtatggtccc acgctaacat tggtggcgtt 660

accatcgctg aatgggttaa agcacatcca gaaatcaaag aagacaaact tgttaagatg 720

tttgaagacg ttcgtgacgc tgcttacgaa atcatcaaac tcaagggtgc aaccttctac 780

ggtatcgcaa ctgctttggc acggatttcc aaagcaattc ttaacgatga aaatgcggta 840

ctcccattgt ccgtttacat ggacggccaa tatggcttga acgacatcta cattggtaca 900

cctgctgtga tcaaccgcaa tggtattcag aacattctgg aaatcccatt gaccgaccac 960

gaagaagaat ccatgcagaa gtcggcttca caattgaaga aagttctgac cgatgcgttt 1020

gctaagaacg acatcgaaac acgtcagtaa tctagaaa 1058

<210> 7

<211> 1424

<212> DNA

<213> Artificial sequence

<400> 7

atgtcagaac gtttcccaaa tgacgtggat ccgatcgaaa ctcgcgactg gctccaggcg 60

gtgtaggctg gagctgcttc gaagttccta tactttctag agaataggaa cttcggaata 120

ggaacttcaa gatcccctta ttagaagaac tcgtcaagaa ggcgatagaa ggcgatgcgc 180

tgcgaatcgg gagcggcgat accgtaaagc acgaggaagc ggtcagccca ttcgccgcca 240

agctcttcag caatatcacg ggtagccaac gctatgtcct gatagcggtc cgccacaccc 300

agccggccac agtcgatgaa tccagaaaag cggccatttt ccaccatgat attcggcaag 360

caggcatcgc catgggtcac gacgagatcc tcgccgtcgg gcatgcgcgc cttgagcctg 420

gcgaacagtt cggctggcgc gagcccctga tgctcttcgt ccagatcatc ctgatcgaca 480

agaccggctt ccatccgagt acgtgctcgc tcgatgcgat gtttcgcttg gtggtcgaat 540

gggcaggtag ccggatcaag cgtatgcagc cgccgcattg catcagccat gatggatact 600

ttctcggcag gagcaaggtg agatgacagg agatcctgcc ccggcacttc gcccaatagc 660

agccagtccc ttcccgcttc agtgacaacg tcgagcacag ctgcgcaagg aacgcccgtc 720

gtggccagcc acgatagccg cgctgcctcg tcctgcagtt cattcagggc accggacagg 780

tcggtcttga caaaaagaac cgggcgcccc tgcgctgaca gccggaacac ggcggcatca 840

gagcagccga ttgtctgttg tgcccagtca tagccgaata gcctctccac ccaagcggcc 900

ggagaacctg cgtgcaatcc atcttgttca atcatgcgaa acgatcctca tcctgtctct 960

tgatcagatc ttgatcccct gcgccatcag atccttggcg gcaagaaagc catccagttt 1020

actttgcagg gcttcccaac cttaccagag ggcgccccag ctggcaattc cggttcgctt 1080

gctgtccata aaaccgccca gtctagctat cgccatgtaa gcccactgca agctacctgc 1140

tttctctttg cgcttgcgtt ttcccttgtc cagatagccc agtagctgac attcatccgg 1200

ggtcagcacc gtttctgcgg actggctttc tacgtgttcc gcttccttta gcagcccttg 1260

cgccctgagt gcttgcggca gcgtgagctt caaaagcgct ctgaagttcc tatactttct 1320

agagaatagg aacttcgaac tgcaggtcga cggatccccg gaatgcccgt ttcattacca 1380

tcattaacaa cacgctgtct gacattcgcc gtctggtgat gtaa 1424

<210> 8

<211> 1424

<212> DNA

<213> Artificial sequence

<400> 8

atgaaacaaa cggttgcagc ttatatcgcc aaaacactcg aatcggcagg ggtgaaacgc 60

gtgtaggctg gagctgcttc gaagttccta tactttctag agaataggaa cttcggaata 120

ggaacttcaa gatcccctta ttagaagaac tcgtcaagaa ggcgatagaa ggcgatgcgc 180

tgcgaatcgg gagcggcgat accgtaaagc acgaggaagc ggtcagccca ttcgccgcca 240

agctcttcag caatatcacg ggtagccaac gctatgtcct gatagcggtc cgccacaccc 300

agccggccac agtcgatgaa tccagaaaag cggccatttt ccaccatgat attcggcaag 360

caggcatcgc catgggtcac gacgagatcc tcgccgtcgg gcatgcgcgc cttgagcctg 420

gcgaacagtt cggctggcgc gagcccctga tgctcttcgt ccagatcatc ctgatcgaca 480

agaccggctt ccatccgagt acgtgctcgc tcgatgcgat gtttcgcttg gtggtcgaat 540

gggcaggtag ccggatcaag cgtatgcagc cgccgcattg catcagccat gatggatact 600

ttctcggcag gagcaaggtg agatgacagg agatcctgcc ccggcacttc gcccaatagc 660

agccagtccc ttcccgcttc agtgacaacg tcgagcacag ctgcgcaagg aacgcccgtc 720

gtggccagcc acgatagccg cgctgcctcg tcctgcagtt cattcagggc accggacagg 780

tcggtcttga caaaaagaac cgggcgcccc tgcgctgaca gccggaacac ggcggcatca 840

gagcagccga ttgtctgttg tgcccagtca tagccgaata gcctctccac ccaagcggcc 900

ggagaacctg cgtgcaatcc atcttgttca atcatgcgaa acgatcctca tcctgtctct 960

tgatcagatc ttgatcccct gcgccatcag atccttggcg gcaagaaagc catccagttt 1020

actttgcagg gcttcccaac cttaccagag ggcgccccag ctggcaattc cggttcgctt 1080

gctgtccata aaaccgccca gtctagctat cgccatgtaa gcccactgca agctacctgc 1140

tttctctttg cgcttgcgtt ttcccttgtc cagatagccc agtagctgac attcatccgg 1200

ggtcagcacc gtttctgcgg actggctttc tacgtgttcc gcttccttta gcagcccttg 1260

cgccctgagt gcttgcggca gcgtgagctt caaaagcgct ctgaagttcc tatactttct 1320

agagaatagg aacttcgaac tgcaggtcga cggatccccg gaattggaag aaaaagccga 1380

tcgcaagttt ctggataaag cgctggaaga ttaccgcgac gccc 1424

<210> 9

<211> 1424

<212> DNA

<213> Artificial sequence

<400> 9

atgtccgagc ttaatgaaaa gttagccaca gcctgggaag gttttaccaa aggtgactgg 60

gtgtaggctg gagctgcttc gaagttccta tactttctag agaataggaa cttcggaata 120

ggaacttcaa gatcccctta ttagaagaac tcgtcaagaa ggcgatagaa ggcgatgcgc 180

tgcgaatcgg gagcggcgat accgtaaagc acgaggaagc ggtcagccca ttcgccgcca 240

agctcttcag caatatcacg ggtagccaac gctatgtcct gatagcggtc cgccacaccc 300

agccggccac agtcgatgaa tccagaaaag cggccatttt ccaccatgat attcggcaag 360

caggcatcgc catgggtcac gacgagatcc tcgccgtcgg gcatgcgcgc cttgagcctg 420

gcgaacagtt cggctggcgc gagcccctga tgctcttcgt ccagatcatc ctgatcgaca 480

agaccggctt ccatccgagt acgtgctcgc tcgatgcgat gtttcgcttg gtggtcgaat 540

gggcaggtag ccggatcaag cgtatgcagc cgccgcattg catcagccat gatggatact 600

ttctcggcag gagcaaggtg agatgacagg agatcctgcc ccggcacttc gcccaatagc 660

agccagtccc ttcccgcttc agtgacaacg tcgagcacag ctgcgcaagg aacgcccgtc 720

gtggccagcc acgatagccg cgctgcctcg tcctgcagtt cattcagggc accggacagg 780

tcggtcttga caaaaagaac cgggcgcccc tgcgctgaca gccggaacac ggcggcatca 840

gagcagccga ttgtctgttg tgcccagtca tagccgaata gcctctccac ccaagcggcc 900

ggagaacctg cgtgcaatcc atcttgttca atcatgcgaa acgatcctca tcctgtctct 960

tgatcagatc ttgatcccct gcgccatcag atccttggcg gcaagaaagc catccagttt 1020

actttgcagg gcttcccaac cttaccagag ggcgccccag ctggcaattc cggttcgctt 1080

gctgtccata aaaccgccca gtctagctat cgccatgtaa gcccactgca agctacctgc 1140

tttctctttg cgcttgcgtt ttcccttgtc cagatagccc agtagctgac attcatccgg 1200

ggtcagcacc gtttctgcgg actggctttc tacgtgttcc gcttccttta gcagcccttg 1260

cgccctgagt gcttgcggca gcgtgagctt caaaagcgct ctgaagttcc tatactttct 1320

agagaatagg aacttcgaac tgcaggtcga cggatccccg gaattcgctg actaaagaac 1380

agcagcagga cgttattact cgtaccttca ctcaatctat gtaa 1424

<210> 10

<211> 1424

<212> DNA

<213> Artificial sequence

<400> 10

atgaaactcg ccgtttatag cacaaaacag tacgacaaga agtacctgca acaggtgaac 60

gtgtaggctg gagctgcttc gaagttccta tactttctag agaataggaa cttcggaata 120

ggaacttcaa gatcccctta ttagaagaac tcgtcaagaa ggcgatagaa ggcgatgcgc 180

tgcgaatcgg gagcggcgat accgtaaagc acgaggaagc ggtcagccca ttcgccgcca 240

agctcttcag caatatcacg ggtagccaac gctatgtcct gatagcggtc cgccacaccc 300

agccggccac agtcgatgaa tccagaaaag cggccatttt ccaccatgat attcggcaag 360

caggcatcgc catgggtcac gacgagatcc tcgccgtcgg gcatgcgcgc cttgagcctg 420

gcgaacagtt cggctggcgc gagcccctga tgctcttcgt ccagatcatc ctgatcgaca 480

agaccggctt ccatccgagt acgtgctcgc tcgatgcgat gtttcgcttg gtggtcgaat 540

gggcaggtag ccggatcaag cgtatgcagc cgccgcattg catcagccat gatggatact 600

ttctcggcag gagcaaggtg agatgacagg agatcctgcc ccggcacttc gcccaatagc 660

agccagtccc ttcccgcttc agtgacaacg tcgagcacag ctgcgcaagg aacgcccgtc 720

gtggccagcc acgatagccg cgctgcctcg tcctgcagtt cattcagggc accggacagg 780

tcggtcttga caaaaagaac cgggcgcccc tgcgctgaca gccggaacac ggcggcatca 840

gagcagccga ttgtctgttg tgcccagtca tagccgaata gcctctccac ccaagcggcc 900

ggagaacctg cgtgcaatcc atcttgttca atcatgcgaa acgatcctca tcctgtctct 960

tgatcagatc ttgatcccct gcgccatcag atccttggcg gcaagaaagc catccagttt 1020

actttgcagg gcttcccaac cttaccagag ggcgccccag ctggcaattc cggttcgctt 1080

gctgtccata aaaccgccca gtctagctat cgccatgtaa gcccactgca agctacctgc 1140

tttctctttg cgcttgcgtt ttcccttgtc cagatagccc agtagctgac attcatccgg 1200

ggtcagcacc gtttctgcgg actggctttc tacgtgttcc gcttccttta gcagcccttg 1260

cgccctgagt gcttgcggca gcgtgagctt caaaagcgct ctgaagttcc tatactttct 1320

agagaatagg aacttcgaac tgcaggtcga cggatccccg gaatacgctg caaaacttaa 1380

gcaatctgga aaaaggcgaa acctgcccga acgaactggt ttaa 1424

<210> 11

<211> 1424

<212> DNA

<213> Artificial sequence

<400> 11

atgattattt ccgcagccag cgattatcgc gccgcagcgc aacgcattct gccgccgttc 60

gtgtaggctg gagctgcttc gaagttccta tactttctag agaataggaa cttcggaata 120

ggaacttcaa gatcccctta ttagaagaac tcgtcaagaa ggcgatagaa ggcgatgcgc 180

tgcgaatcgg gagcggcgat accgtaaagc acgaggaagc ggtcagccca ttcgccgcca 240

agctcttcag caatatcacg ggtagccaac gctatgtcct gatagcggtc cgccacaccc 300

agccggccac agtcgatgaa tccagaaaag cggccatttt ccaccatgat attcggcaag 360

caggcatcgc catgggtcac gacgagatcc tcgccgtcgg gcatgcgcgc cttgagcctg 420

gcgaacagtt cggctggcgc gagcccctga tgctcttcgt ccagatcatc ctgatcgaca 480

agaccggctt ccatccgagt acgtgctcgc tcgatgcgat gtttcgcttg gtggtcgaat 540

gggcaggtag ccggatcaag cgtatgcagc cgccgcattg catcagccat gatggatact 600

ttctcggcag gagcaaggtg agatgacagg agatcctgcc ccggcacttc gcccaatagc 660

agccagtccc ttcccgcttc agtgacaacg tcgagcacag ctgcgcaagg aacgcccgtc 720

gtggccagcc acgatagccg cgctgcctcg tcctgcagtt cattcagggc accggacagg 780

tcggtcttga caaaaagaac cgggcgcccc tgcgctgaca gccggaacac ggcggcatca 840

gagcagccga ttgtctgttg tgcccagtca tagccgaata gcctctccac ccaagcggcc 900

ggagaacctg cgtgcaatcc atcttgttca atcatgcgaa acgatcctca tcctgtctct 960

tgatcagatc ttgatcccct gcgccatcag atccttggcg gcaagaaagc catccagttt 1020

actttgcagg gcttcccaac cttaccagag ggcgccccag ctggcaattc cggttcgctt 1080

gctgtccata aaaccgccca gtctagctat cgccatgtaa gcccactgca agctacctgc 1140

tttctctttg cgcttgcgtt ttcccttgtc cagatagccc agtagctgac attcatccgg 1200

ggtcagcacc gtttctgcgg actggctttc tacgtgttcc gcttccttta gcagcccttg 1260

cgccctgagt gcttgcggca gcgtgagctt caaaagcgct ctgaagttcc tatactttct 1320

agagaatagg aacttcgaac tgcaggtcga cggatccccg gaatgggctg ggtaaagagt 1380

tgcctgcggc actggctccc atggcgaaag ggaatgcggc atag 1424

<210> 12

<211> 652

<212> PRT

<213> Artificial sequence

<400> 12

Met Ser Gln Ile His Lys His Thr Ile Pro Ala Asn Ile Ala Asp Arg

1 5 10 15

Cys Leu Ile Asn Pro Gln Gln Tyr Glu Ala Met Tyr Gln Gln Ser Ile

20 25 30

Asn Val Pro Asp Thr Phe Trp Gly Glu Gln Gly Lys Ile Leu Asp Trp

35 40 45

Ile Lys Pro Tyr Gln Lys Val Lys Asn Thr Ser Phe Ala Pro Gly Asn

50 55 60

Val Ser Ile Lys Trp Tyr Glu Asp Gly Thr Leu Asn Leu Ala Ala Asn

65 70 75 80

Cys Leu Asp Arg His Leu Gln Glu Asn Gly Asp Arg Thr Ala Ile Ile

85 90 95

Trp Glu Gly Asp Asp Ala Ser Gln Ser Lys His Ile Ser Tyr Lys Glu

100 105 110

Leu His Arg Asp Val Cys Arg Phe Ala Asn Thr Leu Leu Glu Leu Gly

115 120 125

Ile Lys Lys Gly Asp Val Val Ala Ile Tyr Met Pro Met Val Pro Glu

130 135 140

Ala Ala Val Ala Met Leu Ala Cys Ala Arg Ile Gly Ala Val His Ser

145 150 155 160

Val Ile Phe Gly Gly Phe Ser Pro Glu Ala Val Ala Gly Arg Ile Ile

165 170 175

Asp Ser Asn Ser Arg Leu Val Ile Thr Ser Asp Glu Gly Val Arg Ala

180 185 190

Gly Arg Ser Ile Pro Leu Lys Lys Asn Val Asp Asp Ala Leu Lys Asn

195 200 205

Pro Asn Val Thr Ser Val Glu His Val Val Val Leu Lys Arg Thr Gly

210 215 220

Gly Lys Ile Asp Trp Gln Glu Gly Arg Asp Leu Trp Trp His Asp Leu

225 230 235 240

Val Glu Gln Ala Ser Asp Gln His Gln Ala Glu Glu Met Asn Ala Glu

245 250 255

Asp Pro Leu Phe Ile Leu Tyr Thr Ser Gly Ser Thr Gly Lys Pro Lys

260 265 270

Gly Val Leu His Thr Thr Gly Gly Tyr Leu Val Tyr Ala Ala Leu Thr

275 280 285

Phe Lys Tyr Val Phe Asp Tyr His Pro Gly Asp Ile Tyr Trp Cys Thr

290 295 300

Ala Asp Val Gly Trp Val Thr Gly His Ser Tyr Leu Leu Tyr Gly Pro

305 310 315 320

Leu Ala Cys Gly Ala Thr Thr Leu Met Phe Glu Gly Val Pro Asn Trp

325 330 335

Pro Thr Pro Ala Arg Met Ala Gln Val Val Asp Lys His Gln Val Asn

340 345 350

Ile Leu Tyr Thr Ala Pro Thr Ala Ile Arg Ala Leu Met Ala Glu Gly

355 360 365

Asp Lys Ala Ile Glu Gly Thr Asp Arg Ser Ser Leu Arg Ile Leu Gly

370 375 380

Ser Val Gly Glu Pro Ile Asn Pro Glu Ala Trp Glu Trp Tyr Trp Lys

385 390 395 400

Lys Ile Gly Asn Glu Lys Cys Pro Val Val Asp Thr Trp Trp Gln Thr

405 410 415

Glu Thr Gly Gly Phe Met Ile Thr Pro Leu Pro Gly Ala Thr Glu Leu

420 425 430

Lys Ala Gly Ser Ala Thr Arg Pro Phe Phe Gly Val Gln Pro Ala Leu

435 440 445

Val Asp Asn Glu Gly Asn Pro Leu Glu Gly Ala Thr Glu Gly Ser Leu

450 455 460

Val Ile Thr Asp Ser Trp Pro Gly Gln Ala Arg Thr Leu Phe Gly Asp

465 470 475 480

His Glu Arg Phe Glu Gln Thr Tyr Phe Ser Thr Phe Lys Asn Met Tyr

485 490 495

Phe Ser Gly Asp Gly Ala Arg Arg Asp Glu Asp Gly Tyr Tyr Trp Ile

500 505 510

Thr Gly Arg Val Asp Asp Val Leu Asn Val Ser Gly His Arg Leu Gly

515 520 525

Thr Ala Glu Ile Glu Ser Ala Leu Val Ala His Pro Lys Ile Ala Glu

530 535 540

Ala Ala Val Val Gly Ile Pro His Asn Ile Lys Gly Gln Ala Ile Tyr

545 550 555 560

Ala Tyr Val Thr Leu Asn His Gly Glu Glu Pro Ser Pro Glu Leu Tyr

565 570 575

Ala Glu Val Arg Asn Trp Val Arg Lys Glu Ile Gly Pro Leu Ala Thr

580 585 590

Pro Asp Val Leu His Trp Thr Asp Ser Leu Pro Lys Thr Arg Ser Gly

595 600 605

Lys Ile Met Arg Arg Ile Leu Arg Lys Ile Ala Ala Gly Asp Thr Ser

610 615 620

Asn Leu Gly Asp Thr Ser Thr Leu Ala Asp Pro Gly Val Val Glu Lys

625 630 635 640

Leu Leu Glu Glu Lys Gln Ala Ile Ala Met Pro Ser

645 650

<210> 13

<211> 400

<212> PRT

<213> Artificial sequence

<400> 13

Met Ser Ser Lys Leu Val Leu Val Leu Asn Cys Gly Ser Ser Ser Leu

1 5 10 15

Lys Phe Ala Ile Ile Asp Ala Val Asn Gly Glu Glu Tyr Leu Ser Gly

20 25 30

Leu Ala Glu Cys Phe His Leu Pro Glu Ala Arg Ile Lys Trp Lys Met

35 40 45

Asp Gly Asn Lys Gln Glu Ala Ala Leu Gly Ala Gly Ala Ala His Ser

50 55 60

Glu Ala Leu Asn Phe Ile Val Asn Thr Ile Leu Ala Gln Lys Pro Glu

65 70 75 80

Leu Ser Ala Gln Leu Thr Ala Ile Gly His Arg Ile Val His Gly Gly

85 90 95

Glu Lys Tyr Thr Ser Ser Val Val Ile Asp Glu Ser Val Ile Gln Gly

100 105 110

Ile Lys Asp Ala Ala Ser Phe Ala Pro Leu His Asn Pro Ala His Leu

115 120 125

Ile Gly Ile Glu Glu Ala Leu Lys Ser Phe Pro Gln Leu Lys Asp Lys

130 135 140

Asn Val Ala Val Phe Asp Thr Ala Phe His Gln Thr Met Pro Glu Glu

145 150 155 160

Ser Tyr Leu Tyr Ala Leu Pro Tyr Asn Leu Tyr Lys Glu His Gly Ile

165 170 175

Arg Arg Tyr Gly Ala His Gly Thr Ser His Phe Tyr Val Thr Gln Glu

180 185 190

Ala Ala Lys Met Leu Asn Lys Pro Val Glu Glu Leu Asn Ile Ile Thr

195 200 205

Cys His Leu Gly Asn Gly Gly Ser Val Ser Ala Ile Arg Asn Gly Lys

210 215 220

Cys Val Asp Thr Ser Met Gly Leu Thr Pro Leu Glu Gly Leu Val Met

225 230 235 240

Gly Thr Arg Ser Gly Asp Ile Asp Pro Ala Ile Ile Phe His Leu His

245 250 255

Asp Thr Leu Gly Met Ser Val Asp Ala Ile Asn Lys Leu Leu Thr Lys

260 265 270

Glu Ser Gly Leu Leu Gly Leu Thr Glu Val Thr Ser Asp Cys Arg Tyr

275 280 285

Val Glu Asp Asn Tyr Ala Thr Lys Glu Asp Ala Lys Arg Ala Met Asp

290 295 300

Val Tyr Cys His Arg Leu Ala Lys Tyr Ile Gly Ala Tyr Thr Ala Leu

305 310 315 320

Met Asp Gly Arg Leu Asp Ala Val Val Phe Thr Gly Gly Ile Gly Glu

325 330 335

Asn Ala Ala Met Val Arg Glu Leu Ser Leu Gly Lys Leu Gly Val Leu

340 345 350

Gly Phe Glu Val Asp His Glu Arg Asn Leu Ala Ala Arg Phe Gly Lys

355 360 365

Ser Gly Phe Ile Asn Lys Glu Gly Thr Arg Pro Ala Val Val Ile Pro

370 375 380

Thr Asn Glu Glu Leu Val Ile Ala Gln Asp Ala Ser Arg Leu Thr Ala

385 390 395 400

<210> 14

<211> 714

<212> PRT

<213> Artificial sequence

<400> 14

Val Ser Arg Ile Ile Met Leu Ile Pro Thr Gly Thr Ser Val Gly Leu

1 5 10 15

Thr Ser Val Ser Leu Gly Val Ile Arg Ala Met Glu Arg Lys Gly Val

20 25 30

Arg Leu Ser Val Phe Lys Pro Ile Ala Gln Pro Arg Thr Gly Gly Asp

35 40 45

Ala Pro Asp Gln Thr Thr Thr Ile Val Arg Ala Asn Ser Ser Thr Thr

50 55 60

Thr Ala Ala Glu Pro Leu Lys Met Ser Tyr Val Glu Gly Leu Leu Ser

65 70 75 80

Ser Asn Gln Lys Asp Val Leu Met Glu Glu Ile Val Ala Asn Tyr His

85 90 95

Ala Asn Thr Lys Asp Ala Glu Val Val Leu Val Glu Gly Leu Val Pro

100 105 110

Thr Arg Lys His Gln Phe Ala Gln Ser Leu Asn Tyr Glu Ile Ala Lys

115 120 125

Thr Leu Asn Ala Glu Ile Val Phe Val Met Ser Gln Gly Thr Asp Thr

130 135 140

Pro Glu Gln Leu Lys Glu Arg Ile Glu Leu Thr Arg Asn Ser Phe Gly

145 150 155 160

Gly Ala Lys Asn Thr Asn Ile Thr Gly Val Ile Val Asn Lys Leu Asn

165 170 175

Ala Pro Val Asp Glu Gln Gly Arg Thr Arg Pro Asp Leu Ser Glu Ile

180 185 190

Phe Asp Asp Ser Ser Lys Ala Lys Val Asn Asn Val Asp Pro Ala Lys

195 200 205

Leu Gln Glu Ser Ser Pro Leu Pro Val Leu Gly Ala Val Pro Trp Ser

210 215 220

Phe Asp Leu Ile Ala Thr Arg Ala Ile Asp Met Ala Arg His Leu Asn

225 230 235 240

Ala Thr Ile Ile Asn Glu Gly Asp Ile Asn Thr Arg Arg Val Lys Ser

245 250 255

Val Thr Phe Cys Ala Arg Ser Ile Pro His Met Leu Glu His Phe Arg

260 265 270

Ala Gly Ser Leu Leu Val Thr Ser Ala Asp Arg Pro Asp Val Leu Val

275 280 285

Ala Ala Cys Leu Ala Ala Met Asn Gly Val Glu Ile Gly Ala Leu Leu

290 295 300

Leu Thr Gly Gly Tyr Glu Met Asp Ala Arg Ile Ser Lys Leu Cys Glu

305 310 315 320

Arg Ala Phe Ala Thr Gly Leu Pro Val Phe Met Val Asn Thr Asn Thr

325 330 335

Trp Gln Thr Ser Leu Ser Leu Gln Ser Phe Asn Leu Glu Val Pro Val

340 345 350

Asp Asp His Glu Arg Ile Glu Lys Val Gln Glu Tyr Val Ala Asn Tyr

355 360 365

Ile Asn Ala Asp Trp Ile Glu Ser Leu Thr Ala Thr Ser Glu Arg Ser

370 375 380

Arg Arg Leu Ser Pro Pro Ala Phe Arg Tyr Gln Leu Thr Glu Leu Ala

385 390 395 400

Arg Lys Ala Gly Lys Arg Ile Val Leu Pro Glu Gly Asp Glu Pro Arg

405 410 415

Thr Val Lys Ala Ala Ala Ile Cys Ala Glu Arg Gly Ile Ala Thr Cys

420 425 430

Val Leu Leu Gly Asn Pro Ala Glu Ile Asn Arg Val Ala Ala Ser Gln

435 440 445

Gly Val Glu Leu Gly Ala Gly Ile Glu Ile Val Asp Pro Glu Val Val

450 455 460

Arg Glu Ser Tyr Val Gly Arg Leu Val Glu Leu Arg Lys Asn Lys Gly

465 470 475 480

Met Thr Glu Thr Val Ala Arg Glu Gln Leu Glu Asp Asn Val Val Leu

485 490 495

Gly Thr Leu Met Leu Glu Gln Asp Glu Val Asp Gly Leu Val Ser Gly

500 505 510

Ala Val His Thr Thr Ala Asn Thr Ile Arg Pro Pro Leu Gln Leu Ile

515 520 525

Lys Thr Ala Pro Gly Ser Ser Leu Val Ser Ser Val Phe Phe Met Leu

530 535 540

Leu Pro Glu Gln Val Tyr Val Tyr Gly Asp Cys Ala Ile Asn Pro Asp

545 550 555 560

Pro Thr Ala Glu Gln Leu Ala Glu Ile Ala Ile Gln Ser Ala Asp Ser

565 570 575

Ala Ala Ala Phe Gly Ile Glu Pro Arg Val Ala Met Leu Ser Tyr Ser

580 585 590

Thr Gly Thr Ser Gly Ala Gly Ser Asp Val Glu Lys Val Arg Glu Ala

595 600 605

Thr Arg Leu Ala Gln Glu Lys Arg Pro Asp Leu Met Ile Asp Gly Pro

610 615 620

Leu Gln Tyr Asp Ala Ala Val Met Ala Asp Val Ala Lys Ser Lys Ala

625 630 635 640

Pro Asn Ser Pro Val Ala Gly Arg Ala Thr Val Phe Ile Phe Pro Asp

645 650 655

Leu Asn Thr Gly Asn Thr Thr Tyr Lys Ala Val Gln Arg Ser Ala Asp

660 665 670

Leu Ile Ser Ile Gly Pro Met Leu Gln Gly Met Arg Lys Pro Val Asn

675 680 685

Asp Leu Ser Arg Gly Ala Leu Val Asp Asp Ile Val Tyr Thr Ile Ala

690 695 700

Leu Thr Ala Ile Gln Ser Ala Gln Gln Gln

705 710

<210> 15

<211> 434

<212> PRT

<213> Artificial sequence

<400> 15

Met Lys Thr Arg Thr Gln Gln Ile Glu Glu Leu Gln Lys Glu Trp Thr

1 5 10 15

Gln Pro Arg Trp Glu Gly Ile Thr Arg Pro Tyr Ser Ala Glu Asp Val

20 25 30

Val Lys Leu Arg Gly Ser Val Asn Pro Glu Cys Thr Leu Ala Gln Leu

35 40 45

Gly Ala Ala Lys Met Trp Arg Leu Leu His Gly Glu Ser Lys Lys Gly

50 55 60

Tyr Ile Asn Ser Leu Gly Ala Leu Thr Gly Gly Gln Ala Leu Gln Gln

65 70 75 80

Ala Lys Ala Gly Ile Glu Ala Val Tyr Leu Ser Gly Trp Gln Val Ala

85 90 95

Ala Asp Ala Asn Leu Ala Ala Ser Met Tyr Pro Asp Gln Ser Leu Tyr

100 105 110

Pro Ala Asn Ser Val Pro Ala Val Val Glu Arg Ile Asn Asn Thr Phe

115 120 125

Arg Arg Ala Asp Gln Ile Gln Trp Ser Ala Gly Ile Glu Pro Gly Asp

130 135 140

Pro Arg Tyr Val Asp Tyr Phe Leu Pro Ile Val Ala Asp Ala Glu Ala

145 150 155 160

Gly Phe Gly Gly Val Leu Asn Ala Phe Glu Leu Met Lys Ala Met Ile

165 170 175

Glu Ala Gly Ala Ala Ala Val His Phe Glu Asp Gln Leu Ala Ser Val

180 185 190

Lys Lys Cys Gly His Met Gly Gly Lys Val Leu Val Pro Thr Gln Glu

195 200 205

Ala Ile Gln Lys Leu Val Ala Ala Arg Leu Ala Ala Asp Val Thr Gly

210 215 220

Val Pro Thr Leu Leu Val Ala Arg Thr Asp Ala Asp Ala Ala Asp Leu

225 230 235 240

Ile Thr Ser Asp Cys Asp Pro Tyr Asp Ser Glu Phe Ile Thr Gly Glu

245 250 255

Arg Thr Ser Glu Gly Phe Phe Arg Thr His Ala Gly Ile Glu Gln Ala

260 265 270

Ile Ser Arg Gly Leu Ala Tyr Ala Pro Tyr Ala Asp Leu Val Trp Cys

275 280 285

Glu Thr Ser Thr Pro Asp Leu Glu Leu Ala Arg Arg Phe Ala Gln Ala

290 295 300

Ile His Ala Lys Tyr Pro Gly Lys Leu Leu Ala Tyr Asn Cys Ser Pro

305 310 315 320

Ser Phe Asn Trp Gln Lys Asn Leu Asp Asp Lys Thr Ile Ala Ser Phe

325 330 335

Gln Gln Gln Leu Ser Asp Met Gly Tyr Lys Phe Gln Phe Ile Thr Leu

340 345 350

Ala Gly Ile His Ser Met Trp Phe Asn Met Phe Asp Leu Ala Asn Ala

355 360 365

Tyr Ala Gln Gly Glu Gly Met Lys His Tyr Val Glu Lys Val Gln Gln

370 375 380

Pro Glu Phe Ala Ala Ala Lys Asp Gly Tyr Thr Phe Val Ser His Gln

385 390 395 400

Gln Glu Val Gly Thr Gly Tyr Phe Asp Lys Val Thr Thr Ile Ile Gln

405 410 415

Gly Gly Thr Ser Ser Val Thr Ala Leu Thr Gly Ser Thr Glu Glu Ser

420 425 430

Gln Phe

<210> 16

<211> 578

<212> PRT

<213> Artificial sequence

<400> 16

Met Pro Arg Gly Leu Glu Leu Leu Ile Ala Gln Thr Ile Leu Gln Gly

1 5 10 15

Phe Asp Ala Gln Tyr Gly Arg Phe Leu Glu Val Thr Ser Gly Ala Gln

20 25 30

Gln Arg Phe Glu Gln Ala Asp Trp His Ala Val Gln Gln Ala Met Lys

35 40 45

Asn Arg Ile His Leu Tyr Asp His His Val Gly Leu Val Val Glu Gln

50 55 60

Leu Arg Cys Ile Thr Asn Gly Gln Ser Thr Asp Ala Ala Phe Leu Leu

65 70 75 80

Arg Val Lys Glu His Tyr Thr Arg Leu Leu Pro Asp Tyr Pro Arg Phe

85 90 95

Glu Ile Ala Glu Ser Phe Phe Asn Ser Val Tyr Cys Arg Leu Phe Asp

100 105 110

His Arg Ser Leu Thr Pro Glu Arg Leu Phe Ile Phe Ser Ser Gln Pro

115 120 125

Glu Arg Arg Phe Arg Thr Ile Pro Arg Pro Leu Ala Lys Asp Phe His

130 135 140

Pro Asp His Gly Trp Glu Ser Leu Leu Met Arg Val Ile Ser Asp Leu

145 150 155 160

Pro Leu Arg Leu Arg Trp Gln Asn Lys Ser Arg Asp Ile His Tyr Ile

165 170 175

Ile Arg His Leu Thr Glu Thr Leu Gly Thr Asp Asn Leu Ala Glu Ser

180 185 190

His Leu Gln Val Ala Asn Glu Leu Phe Tyr Arg Asn Lys Ala Ala Trp

195 200 205

Leu Val Gly Lys Leu Ile Thr Pro Ser Gly Thr Leu Pro Phe Leu Leu

210 215 220

Pro Ile His Gln Thr Asp Asp Gly Glu Leu Phe Ile Asp Thr Cys Leu

225 230 235 240

Thr Thr Thr Ala Glu Ala Ser Ile Val Phe Gly Phe Ala Arg Ser Tyr

245 250 255

Phe Met Val Tyr Ala Pro Leu Pro Ala Ala Leu Val Glu Trp Leu Arg

260 265 270

Glu Ile Leu Pro Gly Lys Thr Thr Ala Glu Leu Tyr Met Ala Ile Gly

275 280 285

Cys Gln Lys His Ala Lys Thr Glu Ser Tyr Arg Glu Tyr Leu Val Tyr

290 295 300

Leu Gln Gly Cys Asn Glu Gln Phe Ile Glu Ala Pro Gly Ile Arg Gly

305 310 315 320

Met Val Met Leu Val Phe Thr Leu Pro Gly Phe Asp Arg Val Phe Lys

325 330 335

Val Ile Lys Asp Arg Phe Ala Pro Gln Lys Glu Met Ser Ala Ala His

340 345 350

Val Arg Ala Cys Tyr Gln Leu Val Lys Glu His Asp Arg Val Gly Arg

355 360 365

Met Ala Asp Thr Gln Glu Phe Glu Asn Phe Val Leu Glu Lys Arg His

370 375 380

Ile Ser Pro Ala Leu Met Glu Leu Leu Leu Gln Glu Ala Ala Glu Lys

385 390 395 400

Ile Thr Asp Leu Gly Glu Gln Ile Val Ile Arg His Leu Tyr Ile Glu

405 410 415

Arg Arg Met Val Pro Leu Asn Ile Trp Leu Glu Gln Val Glu Gly Gln

420 425 430

Gln Leu Arg Asp Ala Ile Glu Glu Tyr Gly Asn Ala Ile Arg Gln Leu

435 440 445

Ala Ala Ala Asn Ile Phe Pro Gly Asp Met Leu Phe Lys Asn Phe Gly

450 455 460

Val Thr Arg His Gly Arg Val Val Phe Tyr Asp Tyr Asp Glu Ile Cys

465 470 475 480

Tyr Met Thr Glu Val Asn Phe Arg Asp Ile Pro Pro Pro Arg Tyr Pro

485 490 495

Glu Asp Glu Leu Ala Ser Glu Pro Trp Tyr Ser Val Ser Pro Gly Asp

500 505 510

Val Phe Pro Glu Glu Phe Arg His Trp Leu Cys Ala Asp Pro Arg Ile

515 520 525

Gly Pro Leu Phe Glu Glu Met His Ala Asp Leu Phe Arg Ala Asp Tyr

530 535 540

Trp Arg Ala Leu Gln Asn Arg Ile Arg Glu Gly His Val Glu Asp Val

545 550 555 560

Tyr Ala Tyr Arg Arg Arg Gln Arg Phe Ser Val Arg Tyr Gly Glu Met

565 570 575

Leu Phe

<210> 17

<211> 533

<212> PRT

<213> Artificial sequence

<400> 17

Met Thr Glu Gln Ala Thr Thr Thr Asp Glu Leu Ala Phe Thr Arg Pro

1 5 10 15

Tyr Gly Glu Gln Glu Lys Gln Ile Leu Thr Ala Glu Ala Val Glu Phe

20 25 30

Leu Thr Glu Leu Val Thr His Phe Thr Pro Gln Arg Asn Lys Leu Leu

35 40 45

Ala Ala Arg Ile Gln Gln Gln Gln Asp Ile Asp Asn Gly Thr Leu Pro

50 55 60

Asp Phe Ile Ser Glu Thr Ala Ser Ile Arg Asp Ala Asp Trp Lys Ile

65 70 75 80

Arg Gly Ile Pro Ala Asp Leu Glu Asp Arg Arg Val Glu Ile Thr Gly

85 90 95

Pro Val Glu Arg Lys Met Val Ile Asn Ala Leu Asn Ala Asn Val Lys

100 105 110

Val Phe Met Ala Asp Phe Glu Asp Ser Leu Ala Pro Asp Trp Asn Lys

115 120 125

Val Ile Asp Gly Gln Ile Asn Leu Arg Asp Ala Val Asn Gly Thr Ile

130 135 140

Ser Tyr Thr Asn Glu Ala Gly Lys Ile Tyr Gln Leu Lys Pro Asn Pro

145 150 155 160

Ala Val Leu Ile Cys Arg Val Arg Gly Leu His Leu Pro Glu Lys His

165 170 175

Val Thr Trp Arg Gly Glu Ala Ile Pro Gly Ser Leu Phe Asp Phe Ala

180 185 190

Leu Tyr Phe Phe His Asn Tyr Gln Ala Leu Leu Ala Lys Gly Ser Gly

195 200 205

Pro Tyr Phe Tyr Leu Pro Lys Thr Gln Ser Trp Gln Glu Ala Ala Trp

210 215 220

Trp Ser Glu Val Phe Ser Tyr Ala Glu Asp Arg Phe Asn Leu Pro Arg

225 230 235 240

Gly Thr Ile Lys Ala Thr Leu Leu Ile Glu Thr Leu Pro Ala Val Phe

245 250 255

Gln Met Asp Glu Ile Leu His Ala Leu Arg Asp His Ile Val Gly Leu

260 265 270

Asn Cys Gly Arg Trp Asp Tyr Ile Phe Ser Tyr Ile Lys Thr Leu Lys

275 280 285

Asn Tyr Pro Asp Arg Val Leu Pro Asp Arg Gln Ala Val Thr Met Asp

290 295 300

Lys Pro Phe Leu Asn Ala Tyr Ser Arg Leu Leu Ile Lys Thr Cys His

305 310 315 320

Lys Arg Gly Ala Phe Ala Met Gly Gly Met Ala Ala Phe Ile Pro Ser

325 330 335

Lys Asp Glu Glu His Asn Asn Gln Val Leu Asn Lys Val Lys Ala Asp

340 345 350

Lys Ser Leu Glu Ala Asn Asn Gly His Asp Gly Thr Trp Ile Ala His

355 360 365

Pro Gly Leu Ala Asp Thr Ala Met Ala Val Phe Asn Asp Ile Leu Gly

370 375 380

Ser Arg Lys Asn Gln Leu Glu Val Met Arg Glu Gln Asp Ala Pro Ile

385 390 395 400

Thr Ala Asp Gln Leu Leu Ala Pro Cys Asp Gly Glu Arg Thr Glu Glu

405 410 415

Gly Met Arg Ala Asn Ile Arg Val Ala Val Gln Tyr Ile Glu Ala Trp

420 425 430

Ile Ser Gly Asn Gly Cys Val Pro Ile Tyr Gly Leu Met Glu Asp Ala

435 440 445

Ala Thr Ala Glu Ile Ser Arg Thr Ser Ile Trp Gln Trp Ile His His

450 455 460

Gln Lys Thr Leu Ser Asn Gly Lys Pro Val Thr Lys Ala Leu Phe Arg

465 470 475 480

Gln Met Leu Gly Glu Glu Met Lys Val Ile Ala Ser Glu Leu Gly Glu

485 490 495

Glu Arg Phe Ser Gln Gly Arg Phe Asp Asp Ala Ala Arg Leu Met Glu

500 505 510

Gln Ile Thr Thr Ser Asp Glu Leu Ile Asp Phe Leu Thr Leu Pro Gly

515 520 525

Tyr Arg Leu Leu Ala

530

<210> 18

<211> 565

<212> PRT

<213> Artificial sequence

<400> 18

Met Glu Pro Lys Thr Lys Lys Gln Arg Ser Leu Tyr Ile Pro Tyr Ala

1 5 10 15

Gly Pro Val Leu Leu Glu Phe Pro Leu Leu Asn Lys Gly Ser Ala Phe

20 25 30

Ser Met Glu Glu Arg Arg Asn Phe Asn Leu Leu Gly Leu Leu Pro Glu

35 40 45

Val Val Glu Thr Ile Glu Glu Gln Ala Glu Arg Ala Trp Ile Gln Tyr

50 55 60

Gln Gly Phe Lys Thr Glu Ile Asp Lys His Ile Tyr Leu Arg Asn Ile

65 70 75 80

Gln Asp Thr Asn Glu Thr Leu Phe Tyr Arg Leu Val Asn Asn His Leu

85 90 95

Asp Glu Met Met Pro Val Ile Tyr Thr Pro Thr Val Gly Ala Ala Cys

100 105 110

Glu Arg Phe Ser Glu Ile Tyr Arg Arg Ser Arg Gly Val Phe Ile Ser

115 120 125

Tyr Gln Asn Arg His Asn Met Asp Asp Ile Leu Gln Asn Val Pro Asn

130 135 140

His Asn Ile Lys Val Ile Val Val Thr Asp Gly Glu Arg Ile Leu Gly

145 150 155 160

Leu Gly Asp Gln Gly Ile Gly Gly Met Gly Ile Pro Ile Gly Lys Leu

165 170 175

Ser Leu Tyr Thr Ala Cys Gly Gly Ile Ser Pro Ala Tyr Thr Leu Pro

180 185 190

Val Val Leu Asp Val Gly Thr Asn Asn Gln Gln Leu Leu Asn Asp Pro

195 200 205

Leu Tyr Met Gly Trp Arg Asn Pro Arg Ile Thr Asp Asp Glu Tyr Tyr

210 215 220

Glu Phe Val Asp Glu Phe Ile Gln Ala Val Lys Gln Arg Trp Pro Asp

225 230 235 240

Val Leu Leu Gln Phe Glu Asp Phe Ala Gln Lys Asn Ala Met Pro Leu

245 250 255

Leu Asn Arg Tyr Arg Asn Glu Ile Cys Ser Phe Asn Asp Asp Ile Gln

260 265 270

Gly Thr Ala Ala Val Thr Val Gly Thr Leu Ile Ala Ala Ser Arg Ala

275 280 285

Ala Gly Gly Gln Leu Ser Glu Lys Lys Ile Val Phe Leu Gly Ala Gly

290 295 300

Ser Ala Gly Cys Gly Ile Ala Glu Met Ile Ile Ser Gln Thr Gln Arg

305 310 315 320

Glu Gly Leu Ser Glu Glu Ala Ala Arg Gln Lys Val Phe Met Val Asp

325 330 335

Arg Phe Gly Leu Leu Thr Asp Lys Met Pro Asn Leu Leu Pro Phe Gln

340 345 350

Thr Lys Leu Val Gln Lys Arg Glu Asn Leu Ser Asp Trp Asp Thr Asp

355 360 365

Ser Asp Val Leu Ser Leu Leu Asp Val Val Arg Asn Val Lys Pro Asp

370 375 380

Ile Leu Ile Gly Val Ser Gly Gln Thr Gly Leu Phe Thr Glu Glu Ile

385 390 395 400

Ile Arg Glu Met His Lys His Cys Pro Arg Pro Ile Val Met Pro Leu

405 410 415

Ser Asn Pro Thr Ser Arg Val Glu Ala Thr Pro Gln Asp Ile Ile Ala

420 425 430

Trp Thr Glu Gly Asn Ala Leu Val Ala Thr Gly Ser Pro Phe Asn Pro

435 440 445

Val Val Trp Lys Asp Lys Ile Tyr Pro Ile Ala Gln Cys Asn Asn Ala

450 455 460

Phe Ile Phe Pro Gly Ile Gly Leu Gly Val Ile Ala Ser Gly Ala Ser

465 470 475 480

Arg Ile Thr Asp Glu Met Leu Met Ser Ala Ser Glu Thr Leu Ala Gln

485 490 495

Tyr Ser Pro Leu Val Leu Asn Gly Glu Gly Met Val Leu Pro Glu Leu

500 505 510

Lys Asp Ile Gln Lys Val Ser Arg Ala Ile Ala Phe Ala Val Gly Lys

515 520 525

Met Ala Gln Gln Gln Gly Val Ala Val Lys Thr Ser Ala Glu Ala Leu

530 535 540

Gln Gln Ala Ile Asp Asp Asn Phe Trp Gln Ala Glu Tyr Arg Asp Tyr

545 550 555 560

Arg Arg Thr Ser Ile

565

<210> 19

<211> 759

<212> PRT

<213> Artificial sequence

<400> 19

Met Asp Asp Gln Leu Lys Gln Ser Ala Leu Asp Phe His Glu Phe Pro

1 5 10 15

Val Pro Gly Lys Ile Gln Val Ser Pro Thr Lys Pro Leu Ala Thr Gln

20 25 30

Arg Asp Leu Ala Leu Ala Tyr Ser Pro Gly Val Ala Ala Pro Cys Leu

35 40 45

Glu Ile Glu Lys Asp Pro Leu Lys Ala Tyr Lys Tyr Thr Ala Arg Gly

50 55 60

Asn Leu Val Ala Val Ile Ser Asn Gly Thr Ala Val Leu Gly Leu Gly

65 70 75 80

Asn Ile Gly Ala Leu Ala Gly Lys Pro Val Met Glu Gly Lys Gly Val

85 90 95

Leu Phe Lys Lys Phe Ala Gly Ile Asp Val Phe Asp Ile Glu Val Asp

100 105 110

Glu Leu Asp Pro Asp Lys Phe Ile Glu Val Val Ala Ala Leu Glu Pro

115 120 125

Thr Phe Gly Gly Ile Asn Leu Glu Asp Ile Lys Ala Pro Glu Cys Phe

130 135 140

Tyr Ile Glu Gln Lys Leu Arg Glu Arg Met Asn Ile Pro Val Phe His

145 150 155 160

Asp Asp Gln His Gly Thr Ala Ile Ile Ser Thr Ala Ala Ile Leu Asn

165 170 175

Gly Leu Arg Val Val Glu Lys Asn Ile Ser Asp Val Arg Met Val Val

180 185 190

Ser Gly Ala Gly Ala Ala Ala Ile Ala Cys Met Asn Leu Leu Val Ala

195 200 205

Leu Gly Leu Gln Lys His Asn Ile Val Val Cys Asp Ser Lys Gly Val

210 215 220

Ile Tyr Gln Gly Arg Glu Pro Asn Met Ala Glu Thr Lys Ala Ala Tyr

225 230 235 240

Ala Val Val Asp Asp Gly Lys Arg Thr Leu Asp Asp Val Ile Glu Gly

245 250 255

Ala Asp Ile Phe Leu Gly Cys Ser Gly Pro Lys Val Leu Thr Gln Glu

260 265 270

Met Val Lys Lys Met Ala Arg Ala Pro Met Ile Leu Ala Leu Ala Asn

275 280 285

Pro Glu Pro Glu Ile Leu Pro Pro Leu Ala Lys Glu Val Arg Pro Asp

290 295 300

Ala Ile Ile Cys Thr Gly Arg Ser Asp Tyr Pro Asn Gln Val Asn Asn

305 310 315 320

Val Leu Cys Phe Pro Phe Ile Phe Arg Gly Ala Leu Asp Val Gly Ala

325 330 335

Thr Ala Ile Asn Glu Glu Met Lys Leu Ala Ala Val Arg Ala Ile Ala

340 345 350

Glu Leu Ala His Ala Glu Gln Ser Glu Val Val Ala Ser Ala Tyr Gly

355 360 365

Asp Gln Asp Leu Ser Phe Gly Pro Glu Tyr Ile Ile Pro Lys Pro Phe

370 375 380

Asp Pro Arg Leu Ile Val Lys Ile Ala Pro Ala Val Ala Lys Ala Ala

385 390 395 400

Met Glu Ser Gly Val Ala Thr Arg Pro Ile Ala Asp Phe Asp Val Tyr

405 410 415

Ile Asp Lys Leu Thr Glu Phe Val Tyr Lys Thr Asn Leu Phe Met Lys

420 425 430

Pro Ile Phe Ser Gln Ala Arg Lys Ala Pro Lys Arg Val Val Leu Pro

435 440 445

Glu Gly Glu Glu Ala Arg Val Leu His Ala Thr Gln Glu Leu Val Thr

450 455 460

Leu Gly Leu Ala Lys Pro Ile Leu Ile Gly Arg Pro Asn Val Ile Glu

465 470 475 480

Met Arg Ile Gln Lys Leu Gly Leu Gln Ile Lys Ala Gly Val Asp Phe

485 490 495

Glu Ile Val Asn Asn Glu Ser Asp Pro Arg Phe Lys Glu Tyr Trp Thr

500 505 510

Glu Tyr Phe Gln Ile Met Lys Arg Arg Gly Val Thr Gln Glu Gln Ala

515 520 525

Gln Arg Ala Leu Ile Ser Asn Pro Thr Val Ile Gly Ala Ile Met Val

530 535 540

Gln Arg Gly Glu Ala Asp Ala Met Ile Cys Gly Thr Val Gly Asp Tyr

545 550 555 560

His Glu His Phe Ser Val Val Lys Asn Val Phe Gly Tyr Arg Asp Gly

565 570 575

Val His Thr Ala Gly Ala Met Asn Ala Leu Leu Leu Pro Ser Gly Asn

580 585 590

Thr Phe Ile Ala Asp Thr Tyr Val Asn Asp Glu Pro Asp Ala Glu Glu

595 600 605

Leu Ala Glu Ile Thr Leu Met Ala Ala Glu Thr Val Arg Arg Phe Gly

610 615 620

Ile Glu Pro Arg Val Ala Leu Leu Ser His Ser Asn Phe Gly Ser Ser

625 630 635 640

Asp Cys Pro Ser Ser Ser Lys Met Arg Gln Ala Leu Glu Leu Val Arg

645 650 655

Glu Arg Ala Pro Glu Leu Met Ile Asp Gly Glu Met His Gly Asp Ala

660 665 670

Ala Leu Val Glu Ala Ile Arg Asn Asp Arg Met Pro Asp Ser Ser Leu

675 680 685

Lys Gly Ser Ala Asn Ile Leu Val Met Pro Asn Met Glu Ala Ala Arg

690 695 700

Ile Ser Tyr Asn Leu Leu Arg Val Ser Ser Ser Glu Gly Val Thr Val

705 710 715 720

Gly Pro Val Leu Met Gly Val Ala Lys Pro Val His Val Leu Thr Pro

725 730 735

Ile Ala Ser Val Arg Arg Ile Val Asn Met Val Ala Leu Ala Val Val

740 745 750

Glu Ala Gln Thr Gln Pro Leu

755

<210> 20

<211> 326

<212> PRT

<213> Artificial sequence

<400> 20

Met Ala Ser Ile Thr Asp Lys Asp His Gln Lys Val Ile Leu Val Gly

1 5 10 15

Asp Gly Ala Val Gly Ser Ser Tyr Ala Tyr Ala Met Val Leu Gln Gly

20 25 30

Ile Ala Gln Glu Ile Gly Ile Val Asp Ile Phe Lys Asp Lys Thr Lys

35 40 45

Gly Asp Ala Ile Asp Leu Ser Asn Ala Leu Pro Phe Thr Ser Pro Lys

50 55 60

Lys Ile Tyr Ser Ala Glu Tyr Ser Asp Ala Lys Asp Ala Asp Leu Val

65 70 75 80

Val Ile Thr Ala Gly Ala Pro Gln Lys Pro Gly Glu Thr Arg Leu Asp

85 90 95

Leu Val Asn Lys Asn Leu Lys Ile Leu Lys Ser Ile Val Asp Pro Ile

100 105 110

Val Asp Ser Gly Phe Asn Gly Ile Phe Leu Val Ala Ala Asn Pro Val

115 120 125

Asp Ile Leu Thr Tyr Ala Thr Trp Lys Leu Ser Gly Phe Pro Lys Ser

130 135 140

Arg Val Val Gly Ser Gly Thr Ser Leu Asp Thr Ala Arg Phe Arg Gln

145 150 155 160

Ser Ile Ala Glu Met Val Asn Val Asp Ala Arg Ser Val His Ala Tyr

165 170 175

Ile Met Gly Glu His Gly Asp Thr Glu Phe Pro Val Trp Ser His Ala

180 185 190

Asn Ile Gly Gly Val Thr Ile Ala Glu Trp Val Lys Ala His Pro Glu

195 200 205

Ile Lys Glu Asp Lys Leu Val Lys Met Phe Glu Asp Val Arg Asp Ala

210 215 220

Ala Tyr Glu Ile Ile Lys Leu Lys Gly Ala Thr Phe Tyr Gly Ile Ala

225 230 235 240

Thr Ala Leu Ala Arg Ile Ser Lys Ala Ile Leu Asn Asp Glu Asn Ala

245 250 255

Val Leu Pro Leu Ser Val Tyr Met Asp Gly Gln Tyr Gly Leu Asn Asp

260 265 270

Ile Tyr Ile Gly Thr Pro Ala Val Ile Asn Arg Asn Gly Ile Gln Asn

275 280 285

Ile Leu Glu Ile Pro Leu Thr Asp His Glu Glu Glu Ser Met Gln Lys

290 295 300

Ser Ala Ser Gln Leu Lys Lys Val Leu Thr Asp Ala Phe Ala Lys Asn

305 310 315 320

Asp Ile Glu Thr Arg Gln

325

Claims (7)

1. The construction method of the recombinant bacterium comprises the following steps of carrying out A1-A14 transformation on escherichia coli to obtain the recombinant bacterium;

a1 knock-out of E.colipoxBGenes or inhibition of the samepoxBExpression of genes or inhibition of saidpoxBActivity of the protein encoded by the gene;

a2 knock-out of E.colipflBGenes or inhibition of the samepflBExpression of genes or inhibition of saidpflBActivity of the protein encoded by the gene;

a3 knock-out of E.coliaceEFGenes or inhibition of the sameaceEFExpression of genes or inhibition of saidaceEFActivity of the protein encoded by the gene;

a4 knock-out of E.colildhAGenes or inhibition of the sameldhAExpression of genes or inhibition of saidldhAActivity of the protein encoded by the gene;

a5 knock-out of E.colilldDGenes or inhibition of the samelldDExpression of genes or inhibition of saidlldDActivity of the protein encoded by the gene;

a6, increasing in said E.coliacsThe content of the gene-encoded protein; the above-mentionedacsThe gene coding protein is a protein shown as a sequence 12 in a sequence table;

a7, increasing in said E.coliptaThe content of the gene-encoded protein; the above-mentionedptaThe gene coding protein is a protein shown as a sequence 14 in a sequence table;

a8, increasing in said E.coliackAThe content of the gene-encoded protein; the above-mentionedackAThe gene coding protein is a protein shown as a sequence 13 in a sequence table;

a9, increasing in said E.coliaceAThe content of the gene-encoded protein; the above-mentionedaceAThe gene coding protein is a protein shown as a sequence 15 in a sequence table;

a10, increasing in said E.coliaceKThe content of the gene-encoded protein; the above-mentionedaceKThe gene coding protein is a protein shown as a sequence 16 in a sequence table;

a11, increasing in said E.coliaceBThe content of the gene-encoded protein; the above-mentionedaceBThe gene coding protein is a protein shown as a sequence 17 in a sequence table;

a12, increasing in said E.colimaeAThe content of the gene-encoded protein; the describedmaeAThe gene coding protein is a protein shown as a sequence 18 in a sequence table;

a13, increasing in said E.colimaeBThe content of the gene-encoded protein; the above-mentionedmaeBThe gene coding protein is a protein shown as a sequence 19 in a sequence table;

a14, increasing in said E.colildh2The content of the gene-encoded protein; the describedldh2The gene coding protein is a protein shown as a sequence 20 in a sequence table;

the Escherichia coli is a strain containingpoxBGenes, thepflBGenes, theaceEFGenes, theldhAGenes and the samelldDEscherichia coli MG1655 for the gene.

2. The method of claim 1, wherein:

a1 is prepared by introducing the recombinant vector into the Escherichia colipoxBDNA fragments of upstream and downstream homology arms of the gene are realized;

and/or, A2 is obtained by introducing the strain into the Escherichia colipflBDNA fragments of upstream and downstream homology arms of the gene are realized;

and/or, A3 is obtained by introducing the strain into the Escherichia coliaceEFDNA fragments of upstream and downstream homology arms of the gene are realized;

and/or, A4 is obtained by introducing the strain into the Escherichia colildhADNA fragments of upstream and downstream homology arms of the gene are realized;

and/or, A5 is obtained by introducing the strain into the Escherichia colilldDRealizing DNA fragments of upstream and downstream homology arms of the gene;

and/or, A6 is obtained by introducing the strain into the Escherichia coliacsOf genesacsGene expression cassette implementation;

and/or, A7 is obtained by introducing the recombinant vector containing the recombinant expression vector into the Escherichia coliptaOf genesptaGene expression cassette implementation;

and/or, A8 is obtained by introducing the strain into the Escherichia coliackAOf genesackAGene expression cassette implementation;

and/or, A9 is obtained by introducing the strain into the Escherichia coliaceAOf genesaceAGene expression cassette implementation;

and/orA10 is prepared by introducing said Escherichia coli into a culture medium containing said strainaceKOf genesaceKGene expression cassette implementation;

and/or, A11 is obtained by introducing the recombinant vector containing the recombinant expression vector into the Escherichia coliaceBOf genesaceBGene expression cassette implementation;

and/or, A12 is obtained by introducing the strain into the Escherichia colimaeAOf genesmaeAGene expression cassette implementation;

and/or, A13 is obtained by introducing the strain into the Escherichia colimaeBOf genesmaeBGene expression cassette implementation;

and/or, A14 is obtained by introducing the strain into the Escherichia colildh2Of genesldh2Gene expression cassette implementation.

3. The method of claim 2, wherein:

said composition containspoxBThe DNA fragments of the upstream and downstream homology arms of the gene are DNA molecules shown in a sequence 8 in a sequence table;

said composition containspflBThe DNA fragments of the upstream and downstream homology arms of the gene are DNA molecules shown in a sequence 9 in a sequence table;

said composition containsaceEFThe DNA fragments of the upstream and downstream homology arms of the gene are DNA molecules shown in a sequence 7 in a sequence table;

said composition containsldhAThe DNA fragments of the upstream and downstream homology arms of the gene are DNA molecules shown in a sequence 10 in a sequence table;

said composition containslldDThe DNA fragments of the upstream and downstream homology arms of the gene are DNA molecules shown in a sequence 11 in a sequence table;

and/or, the saidacsGene expression cassette, theptaGene expression cassette, theackAGene expression cassette, theaceAGene expression cassette, theaceKGene expression cassette, theaceBGene expression cassette, themaeAGene expression cassette, themaeBGene expression cassette and the use thereofldh2The promoter in the gene expression cassette is a DNA molecule shown in 9 th to 51 th sites of a sequence 1 in a sequence table;

and/or, the saidacsThe gene expression cassetteacsThe gene is a DNA molecule shown in 70 th-2028 th site of a sequence 1 in a sequence table;

and/or, the saidptaIn gene expression cassettesptaThe gene is a DNA molecule shown in the 1347-3491 site of the sequence 2 in the sequence table;

and/or, the saidackAThe gene expression cassetteackAThe gene is a DNA molecule shown in the 70 th-1272 th site of a sequence 2 in a sequence table;

and/or, the saidaceAIn gene expression cassettesaceAThe gene is a DNA molecule shown in 70 th-1374 th site of a sequence 3 in a sequence table;

and/or, the saidaceKThe gene expression cassetteaceKThe gene is a DNA molecule shown at 1436-3172 site of a sequence 3 in a sequence table;

and/or, the saidaceBThe gene expression cassetteaceBThe gene is a DNA molecule shown in 70 th-1671 th site of a sequence 4 in a sequence table;

and/or, the saidmaeAThe gene expression cassettemaeAThe gene is a DNA molecule shown in 70 th-1767 th site of a sequence 5 in a sequence table;

and/or, the saidmaeBThe gene expression cassettemaeBThe gene is a DNA molecule shown in 1791-4070 of a sequence 5 in a sequence table;

and/or, the saidldh2The gene expression cassetteldh2The gene is a DNA molecule shown in 70 th-1050 th site of a sequence 6 in a sequence table.

4. The method of claim 2, wherein:

the above-mentionedacsThe gene expression cassette is a DNA molecule shown in the 9 th-2028 th site of the sequence 1 in the sequence table;

the above-mentionedptaGene expression cassette and the use thereofackAThe gene expression cassette is a DNA molecule shown in the 9 th-3491 th site of the sequence 2 in the sequence;

the above-mentionedaceAGene expression cassette and the use thereofaceKThe gene expression cassette is a DNA molecule shown in 9 th-3172 th site of a sequence 3 in a sequence table;

the above-mentionedaceBThe gene expression cassette is in a sequence tableA DNA molecule shown in positions 9-1671 of the sequence 4;

the above-mentionedmaeAGene expression cassette and the use thereofmaeBThe gene expression cassette is a DNA molecule shown in the 9 th-4070 th site of a sequence 5 in a sequence table;

the above-mentionedldh2The gene expression cassette is a DNA molecule shown in the 9 th-1050 th site of a sequence 6 in a sequence table.

5. A recombinant bacterium produced by the method according to any one of claims 1 to 4.

6. Use of a recombinant bacterium produced by the method of any one of claims 1 to 4 in any one of the following applications:

x1, producing L-lactic acid;

x2, preparing and producing an L-lactic acid product;

x3, degrading acetic acid;

and X4, and preparing a degraded acetic acid product.

A method for producing L-lactic acid, comprising: performing biotransformation by using acetic acid as a carbon source and the recombinant bacterium prepared by the method of any one of claims 1 to 4 to prepare the L-lactic acid.

Images