CN112342233B

CN112342233B - Polynucleotide for increasing c-di-AMP production when bacteria express DacA

Info

Publication number: CN112342233B
Application number: CN202011247820.2A
Authority: CN
Inventors: 蒋宇
Original assignee: Shanghai Taoyusheng Biotechnology Co ltd
Current assignee: Shanghai Taoyusheng Biotechnology Co ltd
Priority date: 2020-11-10
Filing date: 2020-11-10
Publication date: 2022-08-26
Anticipated expiration: 2040-11-10
Also published as: CN112342233A; WO2022100543A1

Abstract

The invention discloses a polynucleotide for improving the yield of c-di-AMP when bacteria express DacA, which comprises the following components: ptet-variable translation initiation region-dacA, wherein Ptet is a promoter; the variable translation initiation region is a sequence from the first 17 bases of the ATG to 6 bases after the ATG; dacA is a gene encoding the diadenosine cyclase dacA. The recombinant strain into which the polynucleotide has been cloned is capable of producing c-di-AMP in high yield.

Description

Polynucleotide for increasing c-di-AMP production when bacteria express DacA

Technical Field

The invention belongs to the field of genetic engineering, and particularly relates to a polynucleotide for improving the yield of c-di-AMP when bacteria express a diadenosine cyclase A (DacA).

Background

In 2008, Witte et al discovered Cyclic didenosine monophosphosphate, c-di-AMP, abbreviated CDA molecule when analyzing the crystal structure of bacillus subtilis DNA integrity scanning protein a (dispa), so named dispa as diadenylated cyclase (DAC) and its catalytically active domain as Dac domain. c-di-AMP is a cyclic nucleotide molecule that is synthesized from two molecules of ATP catalyzed by diadenylase A (DacA).

Cyclic-di-AMP (c-di-AMP, CDA for short) is the second signal molecule that is widely present in bacteria. The metabolism of c-di-AMP in bacteria is closely regulated by the diaadenylate cyclases A (DacA) and Phosphodiesterase (PDE). The c-di-AMP not only regulates various physiological processes of bacterial growth, cell wall homeostasis and ion transport, but also can be recognized by various sensor/receptor proteins in eukaryotic host cells, thereby regulating and controlling anti-infective immunity. Bacterial c-di-AMP is involved in the regulation of host type I interferon responses, NF-. kappa.B signaling pathway activity, autophagy, and inflammatory corpuscle responses and other innate immune responses. In addition, c-di-AMP as a mucosal adjuvant induces host adaptive immunity. c-di-AMP is considered a newly discovered pathogen-associated molecular pattern (PAMP) and has become a new target in bacterial vaccine and drug research.

Since the bacterial c-di-AMP is involved in physiological activities such as apoptosis, the production of the c-di-AMP by using the engineered bacteria requires precise adjustment to an appropriate dose.

Escherichia coli Nissle 1917(EcN) is a nonpathogenic Escherichia coli, and was isolated from the feces of soldiers who did not have diarrhea during one major outbreak of Shigella dysentery in 1917. EcN is the most studied of the non-lactic probiotics, serotype O6: k5: h1, with a unique genome, a semi-rough O6-Lipopolysaccharide (LPS) phenotype, a K5-type capsule, 3 different fimbriae (F1A, F1C and frizzled fimbriae). EcN have specific adaptive factors such as microcin and iron uptake system, and play a key role in competition with other microorganisms. EcN can stably colonize intestinal tract for a long time, interact with intestinal epithelial cells, and can be widely used for preventing infectious diarrhea, inflammatory bowel diseases such as ulcerative colitis and Crohn's disease, preventing colonization of pathogenic bacteria in digestive tract of newborn, and performing immunoregulatory biological function.

Disclosure of Invention

We have carried out a long-term study of the genus Escherichia 1917(EcN) and have constructed a series of promising strains, including the strain TYS001, see the literature (immunothery with engineered bacteria by targeting the STING pathway for anti-tumor. animal. Daniel S.Leventhal, Anna Sokolosska, Ning Li, Christopher Plescia, Jose M.Lora. NATURE MUTUNICATIONS.2020, 11:2739. DOI: 10.1038/s 41467-020-.

When DacA is expressed using E.coli Nissle 1917(EcN), c-di-AMP is a metabolite after the dacA gene is expressed. To increase the production of c-di-AMP, we performed extensive exploration and optimization of the structure of the dacA gene expression cassette. Accordingly, it is an object of the present invention to provide a polynucleotide for increasing c-di-AMP production when DacA is expressed in bacteria, which consists of: ptet-variable translation initiation region-dacA, wherein

Ptet is a promoter; the variable translation initiation region is a sequence from the first 17 bases of the ATG to 6 bases after the ATG; dacA is a gene encoding a diadenyl cyclase A (DacA).

In the above-mentioned polynucleotide, when an ampicillin resistance gene requiring co-transcription and co-translation is ligated to dacA, the first 17 bases of ATG of the variable translation initiation region are AGGAGGTCCACTATTTG (SEQ ID NO:1),

and the alternative sequence of SEQ ID NO. 1 is selected from the group consisting of:

CCCATCGGAGTTTTAGGCAGCTTAAAC(SEQ ID NO:2)；

CCCATCGGAGTTTTAAGGAGCTTTGAT (SEQ ID NO:3), or

The variable translation initiation region has a sequence (NNNNNNATGNNNNNN) from 6 bases before ATG to two amino acid codons after ATG selected from the group consisting of:

TATTTGATGGATTTC(SEQ ID NO:4)；

GGTACAATGGATTTT(SEQ ID NO:5)；

GCTACAATGGATTTT(SEQ ID NO:6)；

CCCAATATGGATTTT(SEQ ID NO:7)。

in another embodiment, when the dacA is followed by an ampicillin resistance gene which requires co-transcription but does not require co-translation, the first 17 bases of the ATG variable translation initiation region are SEQ ID NO. 1, and the alternative sequence of SEQ ID NO. 1 is selected from SEQ ID NO. 2 or SEQ ID NO. 3; or

The sequence from 6 bases before ATG to two amino acid codons after ATG is SEQ ID NO. 5, SEQ ID NO. 6 or SEQ ID NO. 7.

In another embodiment, when dacA is followed by a gene that does not require co-transcription of ampicillin, the first 17 bases of the ATG for the variable translation initiation region are SEQ ID NO. 1 and the alternative sequence of SEQ ID NO. 1 is selected from SEQ ID NO. 2 or SEQ ID NO. 3.

In the above polynucleotide, the nucleotide sequence of Ptet may be:

CATTAATTCCTAATTTTTGTTGACACTCTATCATTGATAGAGTTATTTTACCACTCCCTATCAGTGATAGAGAAAAGTGAACTCTAGAAATAATTTTGTTTAACTTTAA(SEQ ID NO:8)。

in the above polynucleotide, the nucleotide sequence of dacA may be:

ATGGATTTCAGTAACATGTCAATCTTGCATTACTTGGCTAATATTGTTGATATTTTAGTTGTTTGGTTTGTTATTTATAAAGTTATTATGTTGATTCGTGGTACCAAAGCTGTTCAATTATTGAAGGGCATCTTCATCATCATCGCTGTTAAGTTGTTGAGTGGTTTCTTTGGCTTACAAACAGTTGAATGGATTACTGATCAAATGTTAACGTGGGGCTTTTTAGCTATCATCATCATCTTCCAACCAGAATTGCGTCGGGCATTAGAAACTTTGGGTCGTGGCAATATTTTTACGCGGTATGGTAGTCGTATTGAACGGGAACAACATCATTTGATCGAAAGTATCGAAAAGTCAACACAATATATGGCTAAGCGTCGGATTGGCGCTTTGATTTCAGTTGCACGTGATACCGGTATGGATGATTACATCGAAACAGGCATCCCATTGAACGCAAAGATCAGTTCACAATTGTTGATCAACATCTTCATCCCAAACACTCCATTGCATGATGGTGCTGTTATCATCAAGGGCAACGAAATCGCAAGTGCTGCATCATATTTACCATTGAGTGATTCACCATTTTTATCAAAGGAATTGGGTACGCGTCATCGGGCTGCATTAGGCATTAGTGAAGTTACGGATTCAATCACCATCGTTGTTAGTGAAGAAACCGGTGGCATTTCATTAACAAAAGGTGGCGAATTGTTTCGGGATGTTAGTGAAGAAGAATTGCATAAGATCTTGTTGAAGGAATTGGTTACAGTTACTGCAAAAAAGCCAAGTATTTTTAGTAAGTGGAAGGGTGGCAAGTCAGAATAA(SEQ ID NO:9)。

another aspect of the invention provides a vector comprising the polynucleotide described above.

The vector can be transformed into bacteria to form genetically engineered bacteria which express DacA and simultaneously produce c-di-AMP.

The above-mentioned polynucleotide may also be cloned into the genome of a host bacterium by a method other than plasmid transformation to obtain a bacterium expressing the above-mentioned polynucleotide. The above polynucleotides can be cloned into the bacterial genome by gene editing, for example.

The gene editing can adopt a CRISPR-Cas9 system.

Preferably, the bacterium may be E.coli, preferably E.coli Nissle 1917 (EcN).

When the engineering bacteria constructed by the polynucleotide disclosed by the invention express DacA, the yield of c-di-AMP can be improved, and the c-di-AMP is accurately adjusted to a proper dosage.

Drawings

FIG. 1 is a schematic diagram of the structure of plasmid pTargetN 20-exo-Ptet-dacA.

Detailed Description

The bacteria sense signals on the cell surface through the second signal molecules and activate intracellular target molecules, and original signals are amplified so as to activate the expression of a series of specific genes in the cells, and finally, various physiological and biochemical processes of the bacteria are influenced. The presence of c-di-AMP (CDA) has been found in a variety of bacteria, and not only regulates a variety of physiological processes such as bacterial growth metabolism, but also is recognized by the host and induces an immune response. Therefore, c-di-AMP becomes a new target for research of bacterial infection drugs and vaccines.

When the genetic engineering bacteria express DacA, c-di-AMP is a metabolite, and the yield of c-di-AMP can be improved by constructing a gene expression cassette of a Ptet-variable translation initiation region-DacA structure, so that the aim of accurately adjusting the dosage of c-di-AMP is fulfilled.

Herein, for the sake of convenience of description, a protein such as DacA (adenylate cyclase a) is sometimes used in combination with the name of its encoding gene (DNA) DacA, and those skilled in the art will understand that they represent different substances in different description occasions. Their meaning will be readily understood by those skilled in the art based on the context and context.

The present invention will be described in further detail with reference to specific examples. It should be understood that the following examples are illustrative only and are not intended to limit the scope of the present invention.

The addition, content and concentration of various substances are referred to herein, wherein the percentage refers to the mass percentage unless otherwise specified.

In the examples herein, if no specific description is made about the reaction temperature or the operation temperature, the temperature is usually referred to as room temperature (15 to 30 ℃).

Examples

Materials and methods

The whole gene synthesis, primer synthesis and sequencing in the examples were performed by Nanjing Kingsler Biotechnology Ltd.

The molecular biological experiments in the examples include plasmid construction, digestion, ligation, competent cell preparation, transformation, culture medium preparation, and the like, and are mainly performed with reference to "molecular cloning experimental manual" (third edition), sambrook, d.w. rasel (american), translation of huang peitang et al, scientific press, beijing, 2002). The specific experimental conditions can be determined by simple experiments if necessary.

PCR amplification experiments were performed according to the reaction conditions or kit instructions provided by the supplier of the plasmid or DNA template. If necessary, can be adjusted by simple experimentation.

LB culture medium: 10g/L tryptone, 5g/L yeast extract, 10g/L sodium chloride, pH7.2, and high temperature and high pressure sterilizing at 121 deg.C for 20 min.

2YT medium: 16g/L tryptone, 10g/L yeast extract, 5g/L sodium chloride, pH7.0, and high temperature and high pressure sterilizing at 121 deg.C for 20 min.

Example 1 construction of a Gene engineering bacterium expressing DacA

The dacA gene was inserted into the exo/cea site of TYS001 strain (genotype EcN. delta. dapA. delta. thyA) to form TYS002 strain (genotype EcN. delta. dapA. delta. thyA. delta. exo:: Ptet-dacA).

The strains TYS001 and TYS002 are preserved by Shanghai Toudan Cheng Biotechnology Limited responsibility company, any unit and person can obtain the bacteria and related plasmids for verifying the invention, but the bacteria and related plasmids are not allowed by the Shanghai Toudan Cheng Biotechnology Limited responsibility company to be used for other purposes including development and utilization, scientific research and teaching.

The construction of the strain TYS002 and the related plasmids comprises the following steps.

1.1 construction of plasmid pTargetF-exo

The construction method comprises the following steps: primers N20-exo-F (BsaI) (5'-TAGTTTTATTGATATATTTACGTC-3') and N20-exo-R (BsaI) (5'-AAACGACGTAAATATATCAATAAA-3') were designed and annealed by PCR and overlapped. Then, the DNA fragment is connected with a pTarget fragment T4 ligase which is cut by BasI, transformed into Escherichia coli DH5a competence, coated with an LB-spec100 mu g/ml plate, and grown with a transformant for sequencing verification to be correct. The plasmid pTargetF-exo was obtained.

1.2 construction of plasmid pTargetN20-exo-Ptet-dacA

The construction method comprises the following steps: the pTargetF-exo plasmid constructed above is cut by EcoRI/HindIII enzyme to obtain a fragment 1, the exo upstream homology arm, tetR-Ptet, dacA, rrnB terminator and the exo downstream homology arm are subjected to OVERlap PCR connection, and then Gibson connection is carried out on the exo upstream homology arm, the tetR-Ptet, the dacA, the rrnB terminator and the exo downstream homology arm; alternatively, all fragments were directly Gibson ligated to obtain plasmid pTargetN20-exo-Ptet-dacA, as shown in FIG. 1.

The sequence of the above DNA fragment is shown below:

exo upstream homology arm sequence (exo-L):

gcttccagaggaagctttgcgtgtgcgccagtgccgaacactgttgttttcccactctcctttttcgatccgacgaccagaatggactgagataccagccttcatggccgagatatgcggtcggtcaggtggtatttgaaaccagactgaagcccacggtcgtcatcgggacgcaggccgccgccgtgcatggtatcagtgagcaggcactctgcggagcaccatcatggactgatgtggtgcggcaactgcgtcatgcaatcggggaccgaccagtaattatctttaatgcccggttcgacatccgcattctgaaaaagactgctgccgcacatagcgatccggctgactggctggaagaactgacggtatattgtgtgatggagctggctgcaggatattatggagcctccaaccgctatggcactatttcactggcctgtgctgccagccagaccggactgaactgggaagggcaggcacactcagcgatcgctgacgcacggatgacggcaggggtggtaaacgctattgctgcatatcatctggaactgctgcaggaacaggcacggctgaaaacctgactgcctggcctgtataccgcaatcatttacgttatccag；

tetR-Ptet-RBS (dotted underlined sequence is tetR terminator and tail sequence, bold sequence is tetR, single underlined sequence is Ptet, last 17 capitalized base sequence is RBS (ribosome binding site)):

dacA：SEQ ID NO:9；

rrnB-T1T2 terminator:

gatggtagtgtggggtctccccatgcgagagtagggaactgccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctcctgagtaggacaaatccgccgggagcggatttgaacgttgcgaagcaacggcccggagggtggcgggcaggacgcccgccataaactgccaggcatcaaattaagcagaaggccatcctgacggatggccttttggatcctctagagtcgacctgcaggcatgcaagcttggcgtaatcatggtcatagctgtttcctgtgt；

exo downstream homology arm sequence (exo-R):

aatagcaatcccccagatacctaatgtagttccagcaagcacggccgggcagcttgttctgcctgcgttttcttcaattgagcagtagaccatttagctgtggcatgaatggctgcagaactttcactgttgctacctccagttccaccaccgctgccagagccactcccgtctggattatcattcaaaagagtaatgattacctgccccttatcatcataaggaacaccatctttatagtacgctacagctgtttccattataaaatcctctttgacattaaaaacaatcagttaaaaataagtactgcatatataattactggttttatatacagcataaaaattacgccgctgcgttttccctgtcaaccctgtggattttcatttttgtgaaaacgatcaaaaaacaactactcacaattcgacagtcccgccagataccgcaaaaccggccagacgttaccgttttccgggaccatgatatgagccccgttggggagggtatggagttgctgaaaatgacggtcagattgagttcaccgttttattgttacaggaggccagggcttgtctgctaccggtccggacgagagggataccgggaatttgaatccggttaactgagccggaca.

1.3 Integrated Process:

reference is made to "Multigene editing in the Escherichia coli genome via the CRISPR-Cas9 system.Jiang, Yu, Chen, Biao, Duan, Chunlan, Sun, Bingbingg, Yang, Junjie, Yang, Sheng, Kelly, R.M., Applied and Environmental Microbiology,2015,81(7): 2506-2514". Initially, plasmid pCas is electrotransformed on TYS001 strain and then the resulting pTargetN20-exo-Ptet-dacA plasmid is electrotransformed, and integration into Ptet-dacA at the exo/cea site is confirmed by PCR verification and sequencing to obtain TYS002 strain.

Example 2 Strain fermentation and validation

The CDA yield was checked by fermentation with TYS001 and TYS002 strains.

2.1 fermentation step:

(1) inoculating glycerol strain to LB-dapa-thy (wherein dapa is 2,6-Diaminopimelic Acid (2,6-Diaminopimelic Acid) with the dosage of 100 μ g/ml, and thy is thymine (thymine) with the dosage of 3mM) in a common test tube, and culturing at 37 ℃ and 250rpm overnight for about 16 h;

(2) inoculating 20ml/250ml 2YT-dapa-thy common triangular shake flask according to the inoculation amount of 1/100v/v, culturing at 37 ℃ and 250rpm for 1.5-2.0h, and then adding 200ng/ml ATC (anhydrotetracycline) for induction for 4.5-5.0 h;

(3) gradually diluting the bacterial solution with PBS, coating LB-dapa-thy plate, culturing overnight in 37 deg.C incubator, and counting. Another sample was taken 1ml, centrifuged at 13000rpm for 10min, and the supernatant was removed and stored at-20 ℃.

2.2 detection of CDA yield:

the thallus treatment method comprises the following steps:

reference documents: an Essential Poison Synthesis and Degradation of Cyclic Di-AMP in Bacillus subtilis Jan Gundlach, Felix M.P.Mehne, et al, J Bacteriol 197: 3265-3274. DOI 10.1128/JB.00564-15.

(1) Suspending 1.0ml of the centrifuged thallus with 500. mu.l of 10mM Tris-HCl buffer solution with pH7.5, centrifuging at 13000rpm for 10min, and collecting the thallus; freezing at-80 deg.C for 10 min;

(2) adding 150 μ l lysozyme solution (containing 2mg/ml lysozyme in 10mM Tris-HCl solution), suspending the precipitate, shaking at 250rpm for 30 min;

(3) placing the cell lysate at-80 deg.C for 10min, and boiling for 10 min;

(4) adding 800 μ l of extraction mixture I (acetonitrile/methanol 1:1), vortex shaking for 45S, and ice-cooling at 4 deg.C for 15 min;

(5) centrifuging at 13000rpm at 4 deg.C for 10min, collecting supernatant, and placing in a new 2.0ml EP tube;

(6) adding 200 μ l of extraction mixed solution II (acetonitrile/methanol/water 2:2:1) into the centrifuged precipitate, shaking with vortex for 45s, and carrying out ice bath at 4 ℃ for 15 min;

(7)13000rpm, 4 ℃, centrifuging for 10min, collecting the supernatant, and placing in the 2.0ml EP tube of the step (5);

(8) adding 200 μ l of extraction mixture II (acetonitrile/methanol/water 2:2:1) into the centrifuged precipitate again, shaking with vortex for 45s, and carrying out ice bath at 4 deg.C for 15 min;

(9)13000rpm, 4 ℃, centrifuging for 10min, collecting the supernatant, and placing in the 2.0ml EP tube of the step (5);

(10) all the collected supernatants are placed at-20 ℃ for incubation for 16h, and then taken out for centrifugation at 13000rpm and 4 ℃ for 20 min;

(11) the supernatant was transferred to a new 2.0ml EP tube, dried at 38 ℃ on a shaker at 100rpm, and dissolved in 1.0ml sterile distilled water after drying. Waiting for HPLC detection.

2.3 reference "qualitative analysis of Cyclo-AMP synthesized by P.gingivalis by HPLC-tandem mass spectrometry. The method for detecting c-di-AMP by HPLC in Zhongyin plum blossom, Yangxuejun, Dujuan, Zhao Wanhong, Chenxiandan, Houjin in Huaxi oral medicine journal, No. 3 rd stage 307 and 311 of 2016 performs CDA detection.

Example 3 construction of variable translation initiation regions

The variable translation initiation region includes randomization of 6 bases before ATG and randomization of synonymous codons for two amino acids after ATG, resulting in sequence NNNNNNATGNNNNNN.

3.1 construction of random libraries:

reference is made to the Applied and Environmental Microbiology 2015,81(7):2506-2514. Using the CRISPR-Cas9 system of E.coli, a PAM sequence recognized and cleaved by Cas9 is first introduced before the open reading frames of the genome Ptet and dacA, and SD (S) or (W) -ampR is ligated after dacA as hosts S and W. A plasmid library of pTargetT containing randomized sequences of the translation initiation region was constructed.

The method for constructing the strain is briefly described as follows:

inserting Ptet-N20-dacA-SD (S or W) -Amp-Terminator sequence into exo/cea site of EcN delta dapA delta thyA strain (TYS 001); wherein the original RBS (ribosome binding site) sequence was deleted between Ptet and dacA, and 2 PAM recognition regions of Cas9 were inserted for subsequent cleavage followed by insertion of RBS degenerate sequences:

a sequence (lowercase) inserted before dacA (containing 2 available N20) is:

5’-Ptet-gacgatagttcatagggtccaggcggAGTAACATGT-3’，

wherein underlined A is the 10 th base of the dacA coding region. The first 3 codons were subjected to synonymous mutations, followed by random fragment library insertion.

3.2 construction of random mutation library of translation initiation region as follows:

the two degenerate primers Ptet-TIR-dacA-F1 and dacA-TIR-Ptet-R were annealed (1 ℃ C. for every 10 s) to form a double-stranded library (plasmid backbone homology regions underlined):

Ptet-TIR-dacA-F1：

5’-TTTAACTTTAAAGGAGGTCCACNNNNNNATGGAYTTYAGTAACATGTCAATCTT GCATT-3’

dacA-TIR-Ptet-R：

3’-AAATTGAAATTTCCTCCAGGTGNNNNNNTACCTRAARTCATTGTACAGTTAGAACGTAA-5’

plasmid pTargeTN20-dacA-RBS (N20) (see Applied and Environmental Microbiology,2015,81(7): 2506) -2514, where N20 is GACGATAGTTCATAGGGTCC.) was digested with EcoRI/HindIII and overlap products of about 800bp each of homologous arms on both sides of RBS to obtain a linearized backbone, and transformed into TransT1 by Gibson ligation to obtain pTargeTN20- Δ RBS (Ptet-dacA) -TIR plasmid library.

Example 4 transformant screening

The above pTargeTN20- Δ RBS (Ptet-dacA) -TIR plasmid mix library was transferred into hosts S and W containing Cas9 plasmid, and LB-dapa + thy-kan-spec double-antibody plates were coated. The colonies were scraped off with LB medium using a smear bar. Mu.l each was plated on LB-dapa + thy + amp plates with increasing amp concentrations from 12.5. mu.g/ml to 3200. mu.g/ml. And screening to obtain strains TYS003, TYS005 and TYS 006.

Example 5 construction of a Strain that Co-transcribes a non-Co-translated ampicillin resistance Gene

Ampicillin resistance gene point mutation termination translation method:

a PAM region was selected to be located in the inserted ampicillin resistance gene AmpR, TAATAA was introduced, and translation was terminated. The sequence of AmpR is shown below.

AmpR gene sequence (PAM (N20) region underlined, TAATAA inserted after sequence atgtcaattcaacatttccgt):

atgtcaattcaacatttccgtgtcgcccttattcccttttttgcggcattttgccttcctgtttttgctcacccagaaacgctggtgaaagtaaaagatgctgaagatcagttgggtgcacgagtgggttacatcgaactggatctcaacagcggtaagatccttgagagttttcgccccgaagaacgttttccaatgatgagcacttttaaagttctgctatgtggcgcggtattatcccgtattgacgccgggcaagagcaactcggtcgccgcatacactattctcagaatgacttggttgagtactcaccagtcacagaaaagcatcttacggatggcatgacagtaagagaattatgcagtgctgccataaccatgagtgataacactgcggccaacttacttctgacaacgatcggaggaccgaaggagctaaccgcttttttgcacaacatgggggatcatgtaactcgccttgatcgttgggaaccggagctgaatgaagccataccaaacgacgagcgtgacaccacgatgcctgtagcaatggcaacaacgttgcgcaaactattaactggcgaactacttactctagcttcccggcaacaattaatagactggatggaggcggataaagttgcaggaccacttctgcgctcggcccttccggctggctggtttattgctgataaatctggagccggtgagcgtgggtctcgcggtatcattgcagcactggggccagatggtaagccctcccgtatcgtagttatctacacgacggggagtcaggcaactatggatgaacgaaatagacagatcgctgagataggtgcctcactgattaagcattggtaa。

construction and insertion methods Using the CRISPR-Cas9 system of E.coli (see Applied and Environmental Microbiology,2015,81(7):2506-2514.), the strain TYS004 was obtained, which co-transcribed the co-translated ampicillin resistance gene.

Example 6 engineering Strain investigation of sequence differences in translation initiation region

The results of the investigation of the effect of the sequences of different translation initiation regions on the CDA yield are shown in Table 1 below.

TABLE 1 CDA production of strains differing in translation initiation region sequence

As can be seen from Table 1, the difference in the sequence of the translation initiation region results in the difference in the transcription and translation effects of the strains on the ampicillin resistance gene, and the c-di-AMP production after fermentation.

Example 7 engineering Strain investigation of different RBS sequences

For the RBS sequences used to regulate the expression of the dacA gene in the above polynucleotides, 9 groups of RBS sequences were selected by optimizing the sequences by RBS online salislab (quote website: https:// salislab. net/software /), with the intensity values from R300 to R119539, and the RBS intensity before optimization was R385.

RBS replacement of the dacA gene of strain TYS 002:

the RBS of the pTargetN20-exo-Ptet-dacA plasmid constructed in example 1 was replaced with the required RBS sequence, primers were designed for PCR amplification, DH5a competent plasmid was transformed, LB-spec plate was coated, and the obtained plasmid was referred to Applied and Environmental Microbiology 2015,81(7):2506-2514. the reported CRISPR-Cas9 system of Escherichia coli was re-transformed into TYS001 strain, and thus a strain with a different required RBS sequence could be obtained. The strength of dacA gene expression was examined for strains with different RBS sequences, and the results are shown in Table 2.

TABLE 2 translation Strength of the dacA Gene in strains of different RBS sequences

RBS sequences	Translation strength
		CCCATCGGAGTTTTAAGGAGGTTTAAT	119539
CCCATCGGAGTTTTAAGGAGGTTTGAT	21327
		CCCATCGGAGTTTTAAGGAGGTTAGAC	6925
CCCATCGGAGTTTTAAGGAGCTTAGAC	1946
		CCCATCGGAGTTTTAGGCAGGTTTAAT	1637
CCCATCGGAGTTTTAAGGAGCTTTGAT(SEQ ID NO:3)	1099
		CCCATCGGAGTTTTATGGAGCTTTAAC	725
CCCATCGGAGTTTTAGGCAGCTTAAAC(SEQ ID NO:2)	300

As can be seen from Table 2, the differences in RBS sequences and the intensity of regulation of the expression of the dacA gene resulted in significant differences in the translation intensity of the dacA gene in the strains.

Example 8 optimization of RBS sequences

In the polynucleotide of the present invention, the first 17 bases of the translation initiation region ATG of dacA gene, SEQ ID NO. 1 and its alternative sequences, SEQ ID NO. 2 and SEQ ID NO. 3, are RBS sequences for regulating the expression of dacA gene. The production of c-di-AMP after expression of the dacA gene was examined by strain fermentation. The results are shown in Table 3.

TABLE 3 c-di-AMP yields after fermentation of strains with different RBS sequences

Bacterial strains	RBS sequences	No induction of CDA (μ M)	Post-induction CDA (μ M)
				TYS002	SEQ ID NO:1(ATG)	1.23±0.58	16.95±5.45
TYS007	SEQ ID NO:2(ATG)	0.75±0.05	22.45±10.95
				TYS008	SEQ ID NO:3(ATG)	2.65±1.15	26.00±2.80

As can be seen from Table 2, the c-di-AMP yields when two strains TYS007 and TYS008 fermented and expressed dacA gene are improved compared with TYS002 before optimization through RBS sequence optimization.

The experiments show that the engineered bacteria constructed by the polynucleotide of the invention can improve the yield of c-di-AMP when expressing DacA.

Sequence listing

<110> Shanghai Toudan Cheng Biotechnology Limited responsibility company

<120> Polynucleotide for increasing c-di-AMP production when DacA is expressed in bacteria

<130> SHPI2010563

<160> 9

<170> SIPOSequenceListing 1.0

<210> 1

<211> 17

<212> DNA

<213> Artificial sequence ()

<400> 1

aggaggtcca ctatttg 17

<210> 2

<211> 27

<212> DNA

<213> Artificial sequence ()

<400> 2

cccatcggag ttttaggcag cttaaac 27

<210> 3

<211> 27

<212> DNA

<213> Artificial sequence ()

<400> 3

cccatcggag ttttaaggag ctttgat 27

<210> 4

<211> 15

<212> DNA

<213> Artificial sequence ()

<400> 4

tatttgatgg atttc 15

<210> 5

<211> 15

<212> DNA

<213> Artificial sequence ()

<400> 5

ggtacaatgg atttt 15

<210> 6

<211> 15

<212> DNA

<213> Artificial sequence ()

<400> 6

gctacaatgg atttt 15

<210> 7

<211> 15

<212> DNA

<213> Artificial sequence ()

<400> 7

cccaatatgg atttt 15

<210> 8

<211> 109

<212> DNA

<213> Artificial sequence ()

<400> 8

cattaattcc taatttttgt tgacactcta tcattgatag agttatttta ccactcccta 60

tcagtgatag agaaaagtga actctagaaa taattttgtt taactttaa 109

<210> 9

<211> 822

<212> DNA

<213> Artificial sequence ()

<400> 9

atggatttca gtaacatgtc aatcttgcat tacttggcta atattgttga tattttagtt 60

gtttggtttg ttatttataa agttattatg ttgattcgtg gtaccaaagc tgttcaatta 120

ttgaagggca tcttcatcat catcgctgtt aagttgttga gtggtttctt tggcttacaa 180

acagttgaat ggattactga tcaaatgtta acgtggggct ttttagctat catcatcatc 240

ttccaaccag aattgcgtcg ggcattagaa actttgggtc gtggcaatat ttttacgcgg 300

tatggtagtc gtattgaacg ggaacaacat catttgatcg aaagtatcga aaagtcaaca 360

caatatatgg ctaagcgtcg gattggcgct ttgatttcag ttgcacgtga taccggtatg 420

gatgattaca tcgaaacagg catcccattg aacgcaaaga tcagttcaca attgttgatc 480

aacatcttca tcccaaacac tccattgcat gatggtgctg ttatcatcaa gggcaacgaa 540

atcgcaagtg ctgcatcata tttaccattg agtgattcac catttttatc aaaggaattg 600

ggtacgcgtc atcgggctgc attaggcatt agtgaagtta cggattcaat caccatcgtt 660

gttagtgaag aaaccggtgg catttcatta acaaaaggtg gcgaattgtt tcgggatgtt 720

agtgaagaag aattgcataa gatcttgttg aaggaattgg ttacagttac tgcaaaaaag 780

ccaagtattt ttagtaagtg gaagggtggc aagtcagaat aa 822

Claims

1. A polynucleotide for increasing c-di-AMP production when bacteria express DacA, comprising:

ptet-variable translation initiation region-dacA, wherein

Ptet is a promoter; the variable translation initiation region is a sequence from the first 17 bases of the ATG to 6 bases after the ATG; dacA is a gene encoding a diadenosine cyclase, dacA,

when dacA is followed by an ampicillin resistance gene which requires co-transcription and co-translation, the first 17 bases of ATG of the variable translation initiation region are replaced by a sequence selected from the group consisting of SEQ ID NO 1:

CCCATCGGAGTTTTAGGCAGCTTAAAC（SEQ ID NO: 2）；

CCCATCGGAGTTTTAAGGAGCTTTGAT (SEQ ID NO:3), or

The variable translation initiation region sequence NNNNNNATGNNNNNN from 6 bases before the ATG to 6 bases after the ATG is selected from the group consisting of:

GGTACAATGGATTTT（SEQ ID NO: 5）；

GCTACAATGGATTTT（SEQ ID NO: 6）；

CCCAATATGGATTTT（SEQ ID NO: 7）。

2. the polynucleotide of claim 1, wherein when dacA is followed by an ampicillin resistance gene that requires co-transcription but does not require co-translation, the first 17 bases of the variable translation initiation region ATG are replaced from the original SEQ ID No. 1 to SEQ ID No. 2 or SEQ ID No. 3; or

The sequence from 6 bases before ATG to 6 bases after ATG is SEQ ID NO 5, SEQ ID NO 6 or SEQ ID NO 7.

3. The polynucleotide of claim 1, wherein the first 17 bases of ATG of the variable translation initiation region are replaced from the original SEQ ID NO. 1 to SEQ ID NO. 2 or SEQ ID NO. 3 when dacA is followed by a gene that does not require co-transcription of ampicillin resistance.

4. The polynucleotide of claim 1, wherein the nucleotide sequence of Ptet is SEQ ID NO 8.

5. The polynucleotide of claim 1, wherein the nucleotide sequence of dacA is SEQ ID NO 9.

6. A vector comprising the polynucleotide of any one of claims 1-5.

7. A bacterium transformed with the vector of claim 6.

8. A bacterium expressing the polynucleotide of any one of claims 1-5.

9. The bacterium of claim 7 or 8, which is Escherichia coli Nissle 1917 (EcN).